Stand and Deliver: Performed by Eric Clapton, Written by Van Morrison

Stand and Deliver: Performed by Eric Clapton, Written by Van Morrison

 

Original video, posted on December 4, 2020, has been deleted from YouTube. Here is the original link.

[As a service to protect truth from censorship & to share widely, mirrored copies of this video are available at Truth Comes to Light BitChute, Brighteon, Lbry/Odysee channels. All credit, along with our sincere thanks, goes to the original source of this video. Please follow links provided to support their work.]

Stand and Deliver, written by Van Morrison and performed by Eric Clapton was released today on YouTube.

Proceeds will go to Morrison’s Lockdown Financial Hardship Fund, which assists musicians facing difficulties as a result of the coronavirus and resulting lockdown measures.

Stand and Deliver is available for download and streaming from iTunes, Amazon Music, Deezer and all other outlets from Dec. 4.

Eric Clapton website:
https://www.ericclapton.com/

Eric Clapton YouTube channel
https://www.youtube.com/user/ericclapton

Van Morrison website:
https://www.vanmorrison.com/

Van Morrison YouTube channel:
https://www.youtube.com/user/vanmorrisonofficial

 

Lyrics

sourced from Genius.com

Stand and deliver
Dick Turpin wore a mask too
Stand and deliver
Dick Turpin wore a mask too
Take a look in the mirror
I got what’s happenin’ to you

Do you wanna be a free man
Do you wanna be a slave?
Do you wanna be a free man
Do you wanna be a slave?
Do you wanna be a king
Or just remain a knave?

Do you wanna be a pauper
Or do you wanna be a prince?
Do you wanna be a pauper
Or do you wanna be a prince?
You wanna get robbed from behind?
Cast your fate to the wind

Magna Carta, Bill of Rights
Constitution, what’s it worth?
You know they gonna grind us down
‘Till it really hurts

Is this a sovereign nation
Or just a fascist state?
You better look out, people
‘Fore it gets to late

[Instrumental interlude]

You wanna be your own driver
Or keep on floggin’ the dead horse?
You wanna be your own driver
Or keep on floggin’ the dead horse?
You wanna make it better
Or do you wanna make it worse?

Stand and deliver
Dick Turpin wore a mask too
Stand and deliver
Dick Turpin wore a mask too
Take a look in the mirror
I got what’s happenin’ to you




Qantas Airlines: No Jab No Flight

Qantas Airlines: No Jab No Flight

by Del Bigtree with Jefferey Jaxen, The HighWire
December 4, 2020

 

The CEO of Australian airline Qantas triggered a frenzy by being the first major airline to announce their intention to require #Covid19 vaccines for their passengers. The HighWire reports.




Operation VECTOR Exposed — This Is Why the Coming Vaccine Rollout Must Be Rejected!

MUST SEE: Operation VECTOR Exposed — THIS Is Why The Coming Vaccine Rollout MUST BE REJECTED!!!

by Dan Dicks, Press for Truth
December 3, 2020

 

The Canadian Armed Forces have engaged operation VECTOR, its vaccine rollout plan to immunize the entire population of Canada.

The plan is being rushed through under the guise that COVID-19(84) is the biggest threat to humanity and therefore the military (who have recently been caught engaging in propaganda campaigns to scare the Canadian people) is now tasked with ensuring a nationwide rollout as early as Spring of 2021.

In this video Dan Dicks of Press For Truth exposes operation vector as a plan that must be avoided at all costs!

DO NOT get the shot because the shot IS the pandemic!

WATCH ON  BITCHUTE   FLOTE   LBRY   MINDS




Will Face Masks Cause Facial Deformities in Children?

Will Face Masks Cause Facial Deformities in Children?

by John C. A. Manley, MuchAdoAboutCorona.ca
December 3, 2020

 

“When wearing a mask, most of us breathe with our upper chest muscles and with our mouth open,” states Children’s Minnesota on their website. While the hospital admits this can cause “increased stress and anxiety” there are other more long-lasting concerns.

According to a paper, in the peer-reviewed journal General Dentistry, “children’s whose mouth breathing is untreated” may develop the following deformities:

  • long, narrow faces
  • narrow mouths
  • high palatal vaults
  • misalignment between the teeth of the two dental arches
  • gummy smiles

As well as “many other unattractive facial features.”

Yet, how many children are being taught how to breathe while wearing a mask? Instead, many (if not most) are sucking in air through their mouth, as an instinctual reaction to the rise in carbon dioxide. This lowers the position of their tongue, which is key factor in normal facial development.

As the author of the paper, Dr. Yosh Jefferson, DMD, states: “If mouth breathing is treated early, its negative effect on facial and dental development and the medical and social problems associated with it can be reduced or averted.”

Instead, face masks may very well exacerbate the problem leading to a generation of deformed children. Because, it’s not just the mouth breathing. How will a growing face and two developing ears respond to a muzzle stretched around it for hours each day?

And, for what? There is no proof masks are effective at stopping infection. And, even if they were, children are practically immune from COVID-19 (a deadly disease that oddly focuses on old people who were on the verge of dying already).

But don’t worry, kids, if you grow up with an odd looking face all you have to do is… keep wearing your mask. No one will notice.

Facial deformities: Yet another reason to stop the masking madness.


 

John C. A. Manley has spent over a decade ghostwriting for medical doctors, as well as naturopaths, chiropractors and Ayurvedic physicians. He publishes the COVID-19(84) Red Pill Posts – an email-based newsletter dedicated to preventing the governments of the world from using an exaggerated pandemic as an excuse to violate our freedom, health, privacy, livelihood and humanity.  You can visit his website at: MuchAdoAboutCorona.ca




Rutherford Institute Challenges Baltimore’s Use of City-Wide, Daytime Aerial Surveillance to Spy On and Track Citizens

Rutherford Institute Challenges Baltimore’s Use of City-Wide, Daytime Aerial Surveillance to Spy On and Track Citizens

by The Rutherford Institute
December 2, 2020

 

PDF:
The amicus brief in
Leaders of a Beautiful Struggle v. Baltimore Police Department

 

RICHMOND, Va. — Pushing back against efforts to extend the government’s spying powers, The Rutherford Institute has asked a federal appeals court to end Baltimore’s use of aerial surveillance to continuously track and monitor the activities of citizens throughout the city. In an amicus brief filed in partnership with Electronic Freedom Foundation, National Assn. of Criminal Defense Lawyers, and Brennan Center for Justice, Rutherford Institute attorneys have asked the U.S. Court of Appeals to rule that the city’s Aerial Investigative Research program, which uses plane-based cameras to record ground movements and is integrated with other city surveillance systems, violates the Fourth Amendment’s prohibition on unreasonable searches and seizures. The brief in Beautiful Struggle v. Baltimore Police Department, which asks the Appeals Court to reconsider and reverse its earlier ruling upholding the program, argues that the comprehensive collection of data and tracking of over a half million people every day is a severe infringement on privacy rights and chills the exercise of the rights of speech and assembly protected by the First Amendment.

“We’re on the losing end of a technological revolution that has already taken hostage our computers, our phones, our finances, our entertainment, our shopping, our appliances, and now, it’s focused its sights on us from the air,” said constitutional attorney John W. Whitehead, president of The Rutherford Institute and author of Battlefield America: The War on the American People. “By subjecting Americans to surveillance without their knowledge or compliance and then storing the data for later use, the government has erected the ultimate suspect society. In such an environment, there is no such thing as ‘innocent until proven guilty.’”

Concerned over rising crime rates within the city, in 2016, the Baltimore Police Department began secretly implementing an Aerial Investigative Research (AIR) program that deployed three planes equipped with cameras to record activities and the movements of persons throughout the entire city during daytime hours. When news reports revealed the existence of the AIR program, it was shut down due to strong public opposition. But the program was revived when a new police chief was appointed and its implementation was approved by the city council. Under the reimplemented program, airborne cameras continuously capture video of 90% of the city during daylight hours. The captured images can detect individuals and track their movements. Although individuals appear as a pixilated dot on the AIR images and cannot be identified from those images, the AIR system is also integrated with other surveillance systems, including over 800 surveillance cameras using facial recognition technology and automated license plate readers that can track the movements of vehicles. In April 2020, a coalition of community organizers and activists sued the city, asserting that AIR’s pervasive surveillance violates the Fourth Amendment’s prohibition on unreasonable searches and seizures. After the district court refused to order that the AIR program be stopped, the coalition appealed to a panel of circuit court judges, which determined that the aerial surveillance was no more extensive than other systems used by the government. In the appeal, The Rutherford Institute and its coalition partners argue that the AIR program’s capacity to track individuals is just as objectionable as the government’s use of cell phone location information, which the Supreme Court found violates the Fourth Amendment.

The Rutherford Institute, a nonprofit civil liberties organization, provides legal assistance at no charge to individuals whose constitutional rights have been threatened or violated and educates the public on a wide spectrum of issues affecting their freedoms.




EPA Forced to Study Glyphosate, Finds Pesticide Could Injure or Kill 93% of Endangered Species

EPA Forced to Study Glyphosate, Finds Pesticide Could Injure or Kill 93% of Endangered Species

The long-anticipated draft biological evaluation released by the EPA found that 1,676 endangered species are likely to be harmed by glyphosate, the active ingredient in Monsanto’s Roundup, the world’s most-used pesticide.

by Center for Biological Diversity
sourced from The Defender, Children’s Health Defense

 

The U.S. Environmental Protection Agency (EPA) released a draft biological evaluation last week finding that glyphosate is likely to injure or kill 93% of the plants and animals protected under the Endangered Species Act.

The long-anticipated draft biological evaluation released by the agency’s pesticide office found that 1,676 endangered species are likely to be harmed by glyphosate, the active ingredient in Roundup and the world’s most-used pesticide.

The draft biological opinion also found that glyphosate adversely modifies critical habitat for 759 endangered species, or 96% of all species for which critical habitat has been designated.

“The hideous impacts of glyphosate on the nation’s most endangered species are impossible to ignore now,” said Lori Ann Burd, environmental health director at the Center for Biological Diversity. “Glyphosate use is so widespread that even the EPA’s notoriously industry-friendly pesticide office had to conclude that there are hardly any endangered species that can manage to evade its toxic impacts.

Hundreds of millions of pounds of glyphosate are used each year in the U.S., mostly in agriculture but also on lawns, gardens, landscaping, roadsides, schoolyards, national forests, rangelands, power lines and more.

According to the EPA, 280 million pounds of glyphosate are used just in agriculture, and glyphosate is sprayed on 298 million acres of crop land each year. 84% of glyphosate pounds applied in agriculture are applied to soy, corn and cotton, commodity crops that are genetically engineered to tolerate being drenched with quantities of glyphosate that would normally kill a plant.

Glyphosate is also widely used in fruit and vegetable production.

“As we prepare to feast on our favorite Thanksgiving dishes, the ugly truth of how harmful industrial-scale agriculture has become in the U.S. has never been so apparent,” said Burd. “If we want to stop the extinction of amazing creatures like monarch butterflies, we need the EPA to take action to stop the out-of-control spraying of deadly poisons.”

The EPA has, for decades, steadfastly refused to comply with its obligation under the Endangered Species Act to assess the harms of pesticides to protected plants and animals. But it was finally forced to do this evaluation under the terms of a 2016 legal agreement with the Center for Biological Diversity.

Emails obtained in litigation brought against Monsanto/Bayer by cancer victims and their families have uncovered a disturbingly cozy relationship between the agency and the company on matters involving the glyphosate risk assessment.

In one example, when the U.S. Department of Health and Human Services announced it would be reviewing glyphosate’s safety, an EPA official assured Monsanto he would work to thwart the review, saying, “If I can kill this, I should get a medal.” The Health and Human Services review was delayed for three years.

Monsanto/Bayer has also enjoyed broad support from the Trump White House. A domestic policy advisor in the Trump administration stated, “We have Monsanto’s back on pesticides regulation.”

Earlier this year, relying on confidential industry research, the EPA reapproved glyphosate. The EPA’s assessment contradicts a 2015 World Health Organization analysis of published research that determined glyphosate is a probable carcinogen.

President-elect Joe Biden has already tapped Michael McCabe, a former consultant to chemical giant DuPont, to join his Environmental Protection Agency transition board, drawing broad outrage, including from Erin Brockovich.




1,500+ Staten Island Residents Gather in Protest Following Arrest of Pub Owner | 25 Sheriffs Blocked Entrance & Issued $50,000 in Fines

1,500+ Staten Island Residents Gather in Protest Following Arrest of Pub Owner | 25 Sheriffs Blocked Entrance & Issued $50,000 in Fines

sourced from Fox News YouTube channel
December 2, 2020

 

Over 1,500 residents of Staten Island protest the arrest of Mac’s Pub owner Danny Presti who defied state orders and kept his business open. Danny Presti and Attorney Lou Gelormino join ‘Tucker Carlson.




Lockdowns Are Based on Fraud: Open Letter to People Who Want Freedom

Lockdowns Are Based on Fraud: Open Letter to People Who Want Freedom

by Jon Rappoport, No More Fake News
December 3, 2020

 

This article is arranged so you see the fraud in more detail as you read further.

QUICK OVERVIEW

The lockdowns are based on high levels of COVID cases.

“We have so many new cases, we have to lock down.”

This claim is based on the diagnostic PCR test.

The more tests you do, the more positive results come up. A positive result is taken to mean: the person is infected with the virus.

But overwhelmingly, these so-called “infected” people have no symptoms. They are healthy. Nevertheless, each one is called a “COVID case.” This is absurd.

A case should mean the person has clinical symptoms; he is sick.

These people aren’t sick, and there is no indication they will get sick.

So…expand testing, test millions of people, obtain results claiming “infection,” call all these healthy people “cases,” and order lock downs.

This is a straight-out con. The real goal is lockdowns and economic devastation.

IS THE PCR TEST DECEPTIVE?

You need one piece of background here.

The PCR test is run in “cycles.” Each cycle is a quantum leap in amplifying or magnifying the original tiny, tiny piece of material taken from the patient’s swab sample. It’s like blowing up a small photo to an amazing size.

The question is: how many cycles should the PCR test be run at? This is vital issue, because the number of cycles changes the result.

July 16, 2020, podcast, “This Week in Virology” [1]: Tony Fauci makes a point of saying the PCR COVID test is useless and misleading when the test is run at “35 cycles or higher.” A positive result, indicating infection, cannot be accepted or believed.

Here, in techno-speak, is an excerpt from Fauci’s key quote (starting at about the 4-minute mark [1]): “…If you get [perform the test at] a cycle threshold of 35 or more…the chances of it being replication-competent [aka accurate] are miniscule…you almost never can culture virus [detect a true positive result] from a 37 threshold cycle…even 36…”

Too many cycles, and the test will turn up all sorts of irrelevant material that will be wrongly interpreted as relevant.

That’s called a false positive.

What Fauci failed to say on the video is: the FDA, which authorizes the test for public use, recommends the test should be run up to 40 cycles. Not 35.

Therefore, all labs in the US that follow the FDA guideline are knowingly or unknowingly participating in fraud. Fraud on a monstrous level, because…

Millions of Americans are being told they are infected with the virus on the basis of a false positive result, and…

The total number of COVID cases in America—which is based on the test—is a gross falsity.

The lockdowns and other restraining measures are based on these fraudulent case numbers.

Let me back up and run that by you again. Fauci says the test is useless when it’s run at 35 cycles or higher. The FDA says run the test up to 40 cycles, in order to determine whether the virus is there. This is the crime in a nutshell.

If anyone in the White House has a few brain cells to rub together, pick up a giant bullhorn and start revealing the truth to the American people.

“Hello, America, you’ve been tricked, lied to, conned, and taken for a devastating ride. On the basis of fake science, the country was locked down.”

If anyone in the Congress has a few brain cells operating, pull Fauci into a televised hearing and, in ten minutes, make mincemeat out of the fake science that has driven this whole foul, stench-ridden assault on the US economy and its citizens.

All right, here are two chunks of evidence for what I’ve written above. First, we have a CDC quote on the FDA website, in a document titled: “CDC 2019-Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic Panel For Emergency Use Only.” [2] See pdf page 38 (doc page 37). This document is marked, “Effective: 12/01/2020.” That means, even though the virus is being referred to by its older name, the document is still relevant as of Dec 2020. “For Emergency Use Only” refers to the fact that the FDA has certified the PCR test under a traditional category called “Emergency Use Authorization.”

FDA: “…a specimen is considered positive for 2019-nCoV [virus] if all 2019-nCoV marker (N1, N2) cycle threshold growth curves cross the threshold line within 40.00 cycles ([less than] 40.00 Ct).”

Naturally, MANY testing labs reading this guideline would conclude, “Well, to see if the virus is there in a patient, we should run the test all the way to 40 cycles. That’s the official advice.”

A disastrous inference.

Then we have a New York Times article (August 29/updated September 17) headlined: “Your coronavirus test is positive. Maybe it shouldn’t be.” [3] Here are money quotes:

“Most tests set the limit at 40 [cycles]. A few at 37.”

“Set the limit” would usually mean, “We’re going to look all the way to 40 cycles, to see if the virus is there.”

The Times: “This number of amplification cycles needed to find the virus, called the cycle threshold, is never included in the results sent to doctors and coronavirus patients…”

Boom. That’s the capper, the grand finale. Labs don’t or won’t reveal their collusion in this crime.

Get the picture?

IS THE PCR TEST USEFUL AND MEANINGFUL?

Now let’s go to published official literature, and see what it reveals. Spoiler alert: the admitted holes and shortcomings of the test are devastating.

From “CDC 2019-Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic Panel For Emergency Use Only.” [2]:

“Detection of viral RNA may not indicate the presence of infectious virus or that 2019-nCoV is the causative agent for clinical symptoms.” (doc page 40)

Translation: A positive test doesn’t guarantee that the COVID virus is causing infection at all. And, ahem, reading between the lines, maybe the COVID virus might not be in the patient’s body at all, either.

From the World Health Organization (WHO): “Coronavirus disease (COVID-19) technical guidance: Laboratory testing for 2019-nCoV in humans”:

“Several assays that detect the 2019-nCoV have been and are currently under development, both in-house and commercially. Some assays may detect only the novel virus [COVID] and some may also detect other strains (e.g. SARS-CoV) that are genetically similar.”

Translation: Some PCR tests register positive for types of coronavirus that have nothing to do with COVID—including plain old coronas that cause nothing more than a cold.

The WHO document adds this little piece: “Protocol use limitations: Optional clinical specimens for testing has [have] not yet been validated.”

Translation: We’re not sure which tissue samples to take from the patient, in order for the test to have any validity.

From the FDA: “LabCorp COVID-19RT-PCR test EUA Summary: ACCELERATED EMERGENCY USE AUTHORIZATION (EUA) SUMMARYCOVID-19 RT-PCR TEST (LABORATORY CORPORATION OF AMERICA)” [5]:

“…The SARS-CoV-2RNA [COVID virus] is generally detectable in respiratory specimens during the acute phase of infection. Positive results are indicative of the presence of SARS-CoV-2 RNA; clinical correlation with patient history and other diagnostic information is necessary to determine patient infection status…THE AGENT DETECTED MAY NOT BE THE DEFINITE CAUSE OF DISEASE (CAPS are mine). Laboratories within the United States and its territories are required to report all positive results to the appropriate public health authorities.”

Translation: On the one hand, we claim the test can “generally” detect the presence of the COVID virus in a patient. But we admit that “the agent detected” on the test, by which we mean COVID virus, “may not be the definite cause of disease.” We also admit that, unless the patient has an acute infection, we can’t find COVID. Therefore, the idea of “asymptomatic patients” confirmed by the test is nonsense. And even though a positive test for COVID may not indicate the actual cause of disease, all positive tests must be reported—and they will be counted as “COVID cases.” Regardless.

From a manufacturer of PCR test kit elements, Creative Diagnostics, “SARS-CoV-2 Coronavirus Multiplex RT-qPCR Kit” [6]:

“This product is for research use only and is not intended for diagnostic use.”

Translation: Don’t use the test result alone to diagnose infection or disease. Oops.

“non-specific interference of Influenza A Virus (H1N1), Influenza B Virus (Yamagata), Respiratory Syncytial Virus (type B), Respiratory Adenovirus (type 3, type 7), Parainfluenza Virus (type 2), Mycoplasma Pneumoniae, Chlamydia Pneumoniae, etc.”

Translation: Although this company states the test can detect COVID, it also states the test can read FALSELY positive if the patient has one of a number of other irrelevant viruses in his body. What is the test proving, then? Who knows? Flip a coin.

“Application Qualitative”

Translation: This clearly means the test is not suited to detect how much virus is in the patient’s body. That’s another indication that the test is useless for determining whether the patient is ill—since millions and millions of virus must be present, in order to produce illness.

“The detection result of this product is only for clinical reference, and it should not be used as the only evidence for clinical diagnosis and treatment. The clinical management of patients should be considered in combination with their symptoms/signs, history, other laboratory tests and treatment responses. The detection results should not be directly used as the evidence for clinical diagnosis, and are only for the reference of clinicians.”

Translation: Don’t use the test as the exclusive basis for diagnosing a person with COVID. And yet, this is exactly what health authorities are doing all over the world. All positive tests must be reported to government agencies, and they are counted as COVID cases.

Those quotes, from official government and testing sources, torpedo the whole “scientific” basis of the test.

CONCLUSION: The PCR test is useless and deceptive. It provides de facto dictators the opportunity to cite “new case levels” and lock down populations, creating economic and human devastation.

RESIST, REBEL, PROTEST, OPEN UP THE ECONOMY ANY WHICH WAY YOU CAN.


SOURCES:

[1] https://www.youtube.com/watch?v=a_Vy6fgaBPE

[2] https://www.fda.gov/media/134922/download

[3] nytimes.com/2020/08/29/health/coronavirus-testing.html

[4] https://web.archive.org/web/20200301092906/http://www.who.int/emergencies/diseases/novel-coronavirus-2019/technical-guidance/laboratory-guidance (for http://www.who.int/emergencies/diseases/novel-coronavirus-2019/technical-guidance/laboratory-guidance)

[5] https://www.fda.gov/media/136151/download

[6] https://www.creative-diagnostics.com/pdf/CD019RT.pdf




Beverly Hills and Louisville Revolt Against Dining Bans as Lockdown Defiance Continues to Spread Across America

Beverly Hills and Louisville Revolt Against Dining Bans as Lockdown Defiance Continues to Spread Across America

In Beverly Hills, California, city leaders are demanding L.A. County repeal its ban on outdoor dining, while restaurants in Louisville, Kentucky pledge to reopen regardless of what the governor orders.

by Jon Miltimore, Foundation for Economic Education
December 3, 2020

 

When Kentucky Gov. Andy Beshear announced a week before Thanksgiving he was closing all indoor service for restaurants and bars because of rising COVID-19 case numbers, Richard Hayhoe had a simple message for his customers.

“Come hungry, come inside,” said Hayhoe, the owner of Beans Cafe and Bakery in Dry Ridge, a rural community about 50 miles north of Lexington.

Instead of complying with Beshear’s order, Hayhoe opted to keep his restaurant open, saying the governor’s order was not about public health.

“This is no longer just about health, it is about control,” Hayhoe wrote in a social media post.

Hayhoe’s act of civil disobedience appears to have started something.

USA Today reports that dozens of Louisville restaurants recently announced they will reopen their dining rooms (at 50 percent capacity) on December 14—regardless of what Beshear does. (Kentucky’s shutdown order is slated to expire at 5:00 PM on December 13.)

The group, called the Kentucky Restaurant Rescue Coalition, started an online petition that has garnered more than 5,000 signatures as of Wednesday morning.

“If Governor Beshear does not rescind restaurant closures, restaurants will reopen on December 14 at 50%,” reads the petition.

The news from Kentucky comes amid a surge of backlash against economic lockdowns, which have wreaked damage on America’s small businesses, the broader economy, and the mental health of Americans.

The opposition has taken many forms—from criticism from Waffle House to enforcement defiance from Weld County Colorado to civil disobedience in Brooklyn and Buffalo—and continues to spread.

In Beverly Hills, California, city leaders are demanding Los Angeles County repeal its ban on outdoor dining.

“The resolution demands a motion be placed on the December 8, 2020 agenda of the Los Angeles County Board of Supervisors to repeal the current Health Order,” Beverly Hills City Council said in a press release.

Reports say Beverly Hills is also exploring creating its own city public health department, similar to Pasadena, which currently allows outdoor dining. (If nothing else, the coronavirus is helping Americans rediscover the virtue of federalism and decentralization.)

The fact that politicians in California—and Beverly Hills of all places!—are growing disenchanted with the punishing and ineffective lockdowns is a sign that Americans are tired of being ordered around by politicians who blithely choose which parts of the economy stay open and what gets shut down, while ignoring their own rules.

Churches? Closed. Strip clubs? Sure. Restaurants? Sorry. Liquor stores? Okay. Private gatherings? Nope. Lottery ticket sales? You bet! The sheer banality of these orders has given lie to the notion that public health is driving the lockdowns.

“Who knew public health would so perfectly align with secular convenience?” Justice Neil Gorsuch recently quipped in a Supreme Court case overturning Gov. Andrew Cuomo’s coronavirus restrictions on houses of worship in New York.

The case for forced lockdowns was always dubious, especially in the absence of clear data on the mortality risk of COVID-19. But the fact that lockdowns are continuing today in light of the evidence we now have—which shows lockdowns are incredibly harmful and terribly ineffective at slowing the spread of a virus, which appears to have been in the US since 2019, according to new CDC research—is maddening.

As Jason Riley recently pointed out in the Wall Street Journal, many Americans are simply done with all of it.

“What’s going on is not simply hypocrisy but an infantilization of the American public,” Riley wrote. “There’s a widespread assumption among liberal elites that the rest of us are incapable of calculating risks and taking necessary precautions to ride out the pandemic, and it’s insulting.”

Across the United States—from Beverly Hills to Louisville to New York City and beyond—Americans are finally resisting. In doing so, Americans are channeling the tradition of civil disobedience that is part of our DNA and was used by figures ranging from Sam Adams to Henry David Thoreau to Susan B. Anthony and Dr. Martin Luther King Jr.

“This is a form of mass civil disobedience like nothing the country has seen since the 1960s,” Riley notes. “Some of it is born of Covid fatigue, to be sure. But the endless parade of politicians flouting their own rules surely has also played a role. It began shortly after the spring lockdowns and if anything has become more commonplace, even farcical.”

The paradox of civil disobedience, which Thoreau called the “true foundation of liberty,” is that it empowers those who lack power through peaceful non-compliance. Throughout history, it has proven an effective tool against injustice and the use of capricious and arbitrary power.

And it was arbitrary power that compelled Richard Hayhoe, the owner of Beans Cafe and Bakery to take a stand against state lockdown orders.

“Small businesses,” Hayhoe told Neal Cavuto, “are being made to submit to these orders that just seem arbitrary.”

Indeed. Nevertheless, Hayhoe’s non-compliance may come with consequences, which is why he has started a legal defense fund.

Americans like Hayhoe may soon have to determine how far they’re willing to go to peacefully oppose the injustice of lockdowns in the face of politicians who have the power and show no signs of wishing to relent.

“You’re not going back to normal,” New York Gov. Andrew Cuomo recently told reporters.

As governments heap threats and penalties on those who defy orders by peacefully conducting business to stay afloat, Americans seeking to steel themselves can find inspiration and courage in these words from Thoreau.

“[The state] is not armed with superior wit or honesty, but with superior physical strength,” Thoreau wrote in Civil Disobedience. “I was not born to be forced. I will breathe after my own fashion. Let us see who is the strongest.”




Creating and Destroying Magnetic Fields at a Distance

Creating and Destroying Magnetic Fields at a Distance

by Joseph P. Farrell, Giza Death Star
December 3, 3030

 

P.S.J. spotted and shared this story, and it’s definitely in the “whopper doozie” category. First, a bit of basics (which are covered in the article). We all know magnets (or electrical coils) can set up a magnetic field around them. Put bluntly, no coil or magnet, no magnetic field. The corollary of this is that while magnetic fields can exist in space, they have to have source, where the field strength will be greatest. With that, let’s turn to the story P.S.J. spotted:

Physicists could do the ‘impossible’: Create and destroy magnetic fields from afar

Here’s the essence of the technique:

Mach-Batlle and her colleagues, though, thought they might be able to get around that problem. They were inspired by work in optics that uses engineered materials known as metamaterials (designed to have properties not found in any naturally-occuring material) to get around limits on resolution set by the wavelength of light. Similarly, they thought, hypothetical magnetic materials might enable the impossible in the world of magnetic fields.

The researchers envisioned a material with a magnetic permeability of negative 1. A material’s magnetic permeability indicates how much that material increases or decreases a magnetic field when exposed to that field. In a material with a magnetic permeability of negative 1, the direction of the magnetism induced within the material would be the opposite of the direction of the initial magnetic field.

Of course, a new method of inducing magnetic fields that relied on materials that don’t exist wouldn’t be particularly useful. But even though this hypothetical material with negative permeability doesn’t exist, physicists can create a sort of temporary “material” out of electric current running through a specific arrangement of wires. That’s because current induces magnetism and vice versa, a consequence of Maxwell’s Equations of electromagnetism.

“In the end, we do not use any material, we use a precise arrangement of currents that can be regarded as an active metamaterial,” Mach-Batlle told Live Science.

To create the field from a distance, Mach-Batlle and her team created a hollow cylinder made of about 20 wires surrounding one long interior wire. When current runs through these wires, it creates a magnetic field that looks the same as if the long interior wire were actually outside the device. It’s the electromagnetic equivalent of a ventriloquist throwing her voice; the source of the field is not actually outside the device, but the field itself is indistinguishable from the field that would have resulted if the source were outside the device. 

“We create the illusion of having this source at a distance,” Mach-Batlle said. The researchers published their findings Oct. 23 in the journal Physical Review Letters.

Now what’s intriguing here is that as usual, the “selling point” for the idea is how much wonderful human health benefits the technique might be able to achieve. For example, the article notes the following immediately after the above description of the technique:

Possible applications beyond drug delivery include canceling out magnetic fields from afar, a technique that could be useful in quantum computing to reduce “noise” from external fields that can interfere with measurements. Another use might be improving transcranial magnetic stimulation, which uses magnets to stimulate neurons in the brain to treat depression. Being able to control magnetic fields at a distance could improve the targeting of transcranial magnetic stimulation, so that doctors could better focus on particular regions in the human brain.

As one might imagine, however, I have my own high octane speculations about what this development might actually portend. Note that first sentence in the quoted paragraph above: “Possible applications beyond drug delivery include canceling out magnetic fields from afar, a technique that could be useful in quantum computing to reduce “noise” from external fields that can interfere with measurements.” Stories abound in the alternative research field of electromagnetic interference with motors and engines. For example, there is the story of Italian dictator Benito Mussolini telling his wife, who wanted to take a country drive, to travel down a particular highway at a particular time because at that particular time something noteworthy would happen. Mrs. Mussolini dutifully complied so the story goes, and at the precise time her husband indicated on that particular highway, her automobile engine died. Similar stories of massive electrical installations causing disruptions in motors occur from Nazi Germany, and so on. Many of these stories – particularly the ones from Germany – also involve coil arrangements.

So imagine, now, the technique outlined in this article is “scaled up” to massive proportions. One might have a means not only of cancelling “noise” from external fields that could interfere with quantum computing, one might also have a means of interfering with magnetic fields in dynamos, generators, and electrical motors of all types, in effect shutting them down in a fashion similar to electromagnetic pulse (EMP), typically produced by nuclear bombs when detonated. Only the difference here is that one would have a means of “firing” that could be reused over and over. With some tweaking, one might be able to “scramble” the electromagnetic functioning of the brain, inducing, or wiping, memories, and so on.

On and on the list could go. The bottom line?

Well, I for one suspect that maybe this latest technique really isn’t so new. Rather, I suspect that what has been discovered is perhaps the basis behind some of those stories we’ve been hearing about for a while…

And if, as the article suggests, a metamaterial with a negative magnetic permeability were ever found… well, one can imagine the uses to which it might be put. Any takers for a bet they’re not already looking for it?

See you on the flip side…




James Corbett w/ John Titus: Central Bank Digital Currencies and the Global Monetary Reset

John Titus on Central Bank Digital Currencies

by James Corbett, The Corbett Report
December 2, 2020

 

A tectonic shift is taking place in the monetary paradigm right now as central banks around the world gear up to shift us into a system of central bank digital currencies. Joining us to break down the history, context and ramifications of this idea is John Titus of Best Evidence.

Watch on Archive / BitChute / LBRY / Minds / YouTube or Download the mp4

SHOW NOTES:

Best Evidence

Interview 1533 – John Titus Exposes the Fed’s Coronavirus Lies

IMF Conference: Cross-Border Payment—A Vision for the Future

Wherefore Art Thou Reserves? S3 E1

Money As Debt Official Site + Part I / Part II / Part III

Bob Murphy’s Review of Stephanie Kelton’s MMT Book

A New Bretton Woods Moment




Covert Op: “The Virus” As Cover Story

Covert Op: “The Virus” As Cover Story

by Jon Rappoport, No More Fake News
December 2,  2020

 

For months, I’ve been demonstrating that no one has proved SARS-CoV-2 exists (start here).

Instead, elite planners have been selling A STORY ABOUT A VIRUS.

In covert intelligence operations, this would be called a cover story. It obscures true goals. It justifies crimes that would otherwise be nakedly exposed.

In a really large covert op, the cover story hides a number of goals and justifies a number of crimes.

For example, in my 1988 book, AIDS INC., I showed how the cover story about HIV was used in Africa.

For a very long time, the true causes of illness and death in areas of Africa were: hunger; protein-calorie malnutrition; starvation; poverty; war; good farm land stolen from the people; corporate pollution; toxic medicines and vaccines; toxic pesticides; overcrowding in cities; lack of basic sanitation.

Most if not all of these causes could have been eliminated. But local governments did not want healthy people. Sick and dying people were easier to control.

Colluding with, and paying off, local government leaders, transnational corporations set up shop in these African countries and used the healthier people to work on their giant commercial farms and in their factories.

But in 1984, suddenly, there was a new (cover) story broadcast and sold to the world: what was really decimating Africa was HIV. THIS explained all the illness and dying.

The true causes, listed above, were shoved into the background.

Those true crimes were hidden, were permitted to continue unabated.

Not only that, the HIV cover story paved the way for pharmaceutical companies to rack up profits by selling extremely toxic AIDS drugs (e.g., AZT) to Africa.

The HIV test, which turned out false positives like Niagara Falls, made these drugs seem necessary—as fake case numbers soared.

People dying from the toxic medical treatments were, of course, listed as AIDS deaths.

Sound familiar?

These days, the coronavirus cover story obscures crimes according to the same general pattern.

EVERYONE is considered an agent of potential infection. Therefore, a new Chinese strategy: universal lockdowns.

COVID-19 is essentially an intelligence-agency type covert op.

The short-term goal is wrecking economies. The long-term goal is taking the population into a new world of technocratic control.

Selling this as necessary all comes back to THE VIRUS COVER STORY.

“We’re not forcing technocracy down the throats of the people. Certainly not. We’re simply doing what we must, because of the danger of the virus…”

There is another routine element in covert operations: FALSE TRAILS.

These are embellishments on the basic story, promoted to hide the fact that the cover story is a lie. The aim in 2020 is: get people arguing about the nature and origin and composition of the virus.

Why? Because as long as people are arguing about these issues, they are re-enforcing the idea that the virus exists and is dangerous. Thus, the basic cover story is strengthened.

“Sowing dissension in the ranks” is another aspect of false trails. A classic example is the JFK assassination, and the myriad accusations that have been flung between independent researchers, each of whom has a different explanation for the murder of the president.

This past spring, there was a period when such accusations were breaking out among independent COVID investigators. As a result, there was no unanimity about the tyrannical nature of the lockdowns. Thankfully, that moment of ill-will seems to have passed.

Always identify and return to the cover story. Walk around it. Look at it from all sides. Walk into it from one side and exit from the other. Test it. The vital clues are there.

Another classic example: 2009, La Gloria, Mexico. Smithfield Foods, the largest pork producer in the world, operates a giant pig farm. 950,000 pigs.

The urine and feces from these 950,000 pigs run out into the open air and forms what are called lagoons. They’re so large, you can see them from outer space.

Workers spray the toxic lagoons with a toxic foam. It’s routine.

Workers, and people in the surrounding neighborhood, are getting sick and dying. So new contractors are brought in to spray the lagoons with yet another toxic chemical.

Out of nowhere, guess who shows up? The CDC.

Guess what they conclude? It’s not the urine and feces lagoons or the toxic chemicals causing illness and death. No. Of course not.

It’s a new mysterious virus. H1N1.

And voila, we have a new cover story and a new epidemic, called Swine Flu.

The cover story serves a number of purposes, as time passes. But the most obvious one is: Smithfield Foods is protected. They get away with murder.

And to cap it all off, four years later, in 2013, Smithfield, still protected, sells itself to a Chinese company, Shuanghui International Holdings, for $4.72 billion.

Makes you wonder. I can imagine a few Chinese intelligence professionals sitting in a room in Beijing, in 2013, expressing astonishment. “Can you believe the CDC? They sold a cover story about a virus that was so ridiculous…but it worked. Suppose we followed suit, but on a grand scale? We claim an outbreak is occurring in one of our cities. We invite the CDC and the World Health Organization to come in and help. There is no virus, but we know they’ll ‘find a new one.’ They always do. Then, boom. We do something no one has ever done before. We lock down 50 million people overnight and provide a model to the rest of the world. Other countries line up and lock down their populations, wrecking their economies. Meanwhile, we announce China has ‘recovered,’ we cancel our lockdowns and put everybody back to work. It’s a war with no shots fired, and we win. Do you think we could pull it off? Do you think we could sell it? Maybe we should talk to Bill Gates. He’s a smart guy. He always has interesting ideas…”




To Those Who Are Masking Themselves, Holding Their Breath, Cooperating With Practices That Damage the Brains of Children, Harm Themselves and Break Down Society

To Those Who Are Masking Themselves, Holding Their Breath, Cooperating With Practices That Damage the Brains of Children, Harm Themselves and Break Down Society


Brief Excerpts:

And when you wear masks just to be nice, just to go along like the woman in the video, you’re training everybody, you’re training the next generation. And, therefore, the controllers, the ones that know all of these experiments and understand human nature because it’s been there whole job for 70, 80, a hundred years to study human nature, they will count on you to train the next generation. There won’t even have to be a law or a rule. It’s just what people do. We just wear masks for some reason. We don’t get to see each others faces. We don’t get to breathe healthy air. We stew in our own juices. We compromise our immune system. You see whay they’re not bringing in actual laws about this. They don’t need to. You will train the next generation.

And you might be saying to yourself “Well, no, no, listen. There is a bad virus and people have a right to be safe from it.” You might be thinking that way in a collectivized, hive mind, mind set. You think to yourself,  “Well, you know, I don’t know. I don’t know what to believe, so better safe than sorry. Plus it’s really just no big deal to me. I’ll just slap on this mask when I run into the store. That way I don’t have to argue with anyone. That way the people who really are scared aren’t scared of me.” … This is what you’re saying to yourself. I know. But what about the people who aren’t scared, the people who know the facts? Don’t we get any shake in this society anymore? Are we going to just change everything we do to please people who are of X, Y, Z? What’s next? What is next? What else will you do for people who are afraid? They’ve already conditioned us for this — through myriad of means…

###

Somehow, we flipped everything on its head… We can’t make all of society change their habits for your weakness. Otherwise, we have to do that for everyone.


This Is Too Important

by Polly St. George, Amazing Polly
November 30, 2020

 

Original video available at Amazing Polly BitChute channel under the title “This is Too Important”

If you want a future for yourself or your children, stop wearing the masks.

I go over the experiments they have run on us vis a vis social conformity and I try to show that even science has been corrupted by the force of “group consensus.”

You have to stand on your own two feet and not cave to the pressure of what everyone else is doing. It’s too important.

Mask studies to get you started: https://pdmj.org/

Asch Experiment: https://www.youtube.com/watch?v=qA-gbpt7Ts8

First Follower: https://www.youtube.com/watch?v=fW8amMCVAJQ&t=42s

Buzzer experiment: https://www.youtube.com/watch?v=o8BkzvP19v4

[As a service to protect truth from censorship & to share widely, mirrored copies of this video are available at Truth Comes to Light BitChute, Brighteon, Lbry/Odysee channels. All credit, along with our sincere thanks, goes to the original source of this video. Please follow links provided to support their work.]

Connect with Polly St. George: https://amazingpolly.net/contact.html


See also:

I Just Had So Much Fun in Mask Land!  



Satire: The Elitists Who Control You

The Elitists Who Control You

by JP Sears, AwakenWithJP
December 1, 2020

 

Meet the elitists who control you.

Ever wonder who controls the media and politicians that control you?

Here they are! Meet the elite face to face!




Warp Speed Ahead: COVID-19 Vaccines Pave the Way for a New Frontier in Surveillance

Warp Speed Ahead: COVID-19 Vaccines Pave the Way for a New Frontier in Surveillance

by John W. Whitehead, The Rutherford Institute
December 1, 2020

 

Man’s conquest of Nature, if the dreams of some scientific planners are realized, means the rule of a few hundreds of men over billions upon billions of men.” —C. S. Lewis, The Abolition of Man

Like it or not, the COVID-19 pandemic with its veiled threat of forced vaccinations, contact tracing, and genetically encoded vaccines is propelling humanity at warp speed into a whole new frontier—a surveillance matrix—the likes of which we’ve only previously encountered in science fiction.

Those who eye these developments with lingering mistrust have good reason to be leery: the government has long had a tendency to unleash untold horrors upon the world in the name of global conquest, the acquisition of greater wealth, scientific experimentation, and technological advances, all packaged in the guise of the greater good.

Indeed, “we the people” have been treated like lab rats by government agencies for decades now: caged, branded, experimented upon without our knowledge or consent, and then conveniently discarded and left to suffer from the after-effects.

You don’t have to dig very deep or go very back in the nation’s history to uncover numerous cases in which the government deliberately conducted secret experiments on an unsuspecting populacemaking healthy people sick by spraying them with chemicals, injecting them with infectious diseases and exposing them to airborne toxins.

Now this same government—which has taken every bit of technology sold to us as being in our best interests (GPS devices, surveillance, nonlethal weapons, etc.) and used it against us, to track, control and trap us—wants us to fall in line as it prepares to roll out COVID-19 vaccines that owe a great debt to the Pentagon’s Defense Advanced Research Projects Agency for its past work on how to weaponize and defend against infectious diseases.

The Trump Administration by way of the National Institute of Health awarded $22.8 million to seven corporations to develop artificial intelligence (AI), machine learning, etc., with smart phone apps, wearable devices and software “that can identify and trace contacts of infected individuals, keep track of verified COVID-19 test results, and monitor the health status of infected and potentially infected individuals.”

This is all part of Operation Warp Speed, which President Trump has likened to the Manhattan Project, a covert government effort spearheaded by the military to engineer and build the world’s first atomic bomb.

There is every reason to tread cautiously.

There is a sinister world beyond that which we perceive, one in which power players jockey for control over the one commodity that is a necessary ingredient for total domination: you.

By you, I mean you the individual in all your singular humanness.

Remaining singularly human and retaining your individuality and dominion over yourself—mind, body and soul—in the face of corporate and government technologies that aim to invade, intrude, monitor, manipulate and control us may be one of the greatest challenges before us.

These COVID-19 vaccines, which rely on messenger RNA technology that influences everything from viruses to memory, are merely the tipping point.

The groundwork being laid with these vaccines is a prologue to what will become the police state’s conquest of a new, relatively uncharted, frontier: inner space, specifically, the inner workings (genetic, biological, biometric, mental, emotional) of the human race.

If you were unnerved by the rapid deterioration of privacy under the Surveillance State, prepare to be terrified by the surveillance matrix that will be ushered in on the heels of the government’s rollout of this COVID-19 vaccine.

The term “matrix” was introduced into our cultural lexicon by the 1999 film The Matrix in which Neo, a computer programmer/hacker, awakens to the reality that humans have been enslaved by artificial intelligence and are being harvested for their bio-electrical energy.

Hardwired to a neuro-interactive simulation of reality called the “Matrix,” humans are kept inactive and docile while robotic androids gather the electricity their bodies generate. In order for the machines who run the Matrix to maintain control, they impose what appears to be a perfect world for humans to keep them distracted, content, and submissive.

Here’s the thing: Neo’s Matrix is not so far removed from our own technologically-hardwired worlds in which we’re increasingly beholden to corporate giants such as Google for powering so much of our lives. As journalist Ben Thompson explains:

Google+ is about unifying all of Google’s services under a single log-in which can be tracked across the Internet on every site that serves Google ads, uses Google sign-in, or utilizes Google analytics. Every feature of Google+—or of YouTube, or Maps, or Gmail, or any other service—is a flytrap meant to ensure you are logged in and being logged by Google at all times.

Everything we do is increasingly dependent on and, ultimately, controlled by our internet-connected, electronic devices. For example, in 2007, there were an estimated 10 million sensor devices connecting human utilized electronic devices (cell phones, laptops, etc.) to the Internet. By 2013, it had increased to 3.5 billion. By 2030, it is estimated to reach 100 trillion.

Much, if not all, of our electronic devices will be connected to Google, a neural network that approximates a massive global brain.

Google’s resources, beyond anything the world has ever seen, includes the huge data sets that result from one billion people using Google every single day and the Google knowledge graph “which consists of 800 million concepts and billions of relationships between them.”

The end goal? The creation of a new “human” species, so to speak, and the NSA, the Pentagon and the “Matrix” of surveillance agencies are part of the plan. As William Binney, one of the highest-level whistleblowers to ever emerge from the NSA, said, “The ultimate goal of the NSA is total population control.”

Mind you, this isn’t population control in the classic sense. It’s more about controlling the population through singularity, a marriage of sorts between machine and human beings in which artificial intelligence and the human brain will merge to form a superhuman mind.

“Google will know the answer to your question before you have asked it,” predicts transhumanist scientist Ray Kurzweil. “It will have read every email you’ve ever written, every document, every idle thought you’ve ever tapped into a search-engine box. It will know you better than your intimate partner does. Better, perhaps, than even yourself.”

The term “singularity”—that is, computers simulating human life itself—was coined years ago by mathematical geniuses Stanislaw Ulam and John von Neumann. “The ever accelerating progress of technology,” warned von Neumann, “gives the appearance of approaching some essential singularity in the history of the race beyond which human affairs, as we know them, could not continue.”

The plan is to develop a computer network that will exhibit intelligent behavior equivalent to or indistinguishable from that of human beings by 2029. And this goal is to have computers that will be “a billion times more powerful than all of the human brains on earth.”

Neuralink, a brain-computer chip interface (BCI), paves the way for AI control of the human brain, at which point the disconnect between humans and AI-controlled computers will become blurred and human minds and computers will essentially become one and the same. “In the most severe scenario, hacking a Neuralink-like device could turn ‘hosts’ into programmable drone armies capable of doing anything their ‘master’ wanted,” writes Jason Lau for Forbes.

Advances in neuroscience indicate that future behavior can be predicted based upon activity in certain portions of the brain, potentially creating a nightmare scenario in which government officials select certain segments of the population for more invasive surveillance or quarantine based solely upon their brain chemistry.

Case in point: researchers at the Mind Research Center scanned the brains of thousands of prison inmates in order to track their brain chemistry and their behavior after release. In one experiment, researchers determined that inmates with lower levels of activity in the area of the brain associated with error processing allegedly had a higher likelihood of committing a crime within four years of being released from prison. While researchers have cautioned against using the results of their research as a method of predicting future crime, it will undoubtedly become a focus of study for government officials.

There’s no limit to what can be accomplished—for good or ill—using brain-computer interfaces.

Researchers at Duke University Medical Center have created a brain-to-brain interface between lab rats, which allows them to transfer information directly between brains. In one particular experiment, researchers trained a rat to perform a task where it would hit a lever when lit. The trained rat then had its brain connected to an untrained rat’s brain via electrodes. The untrained rat was then able to learn the trained rat’s behavior via electrical stimulation. This even worked over great distances using the Internet, with a lab rat in North Carolina guiding the actions of a lab rat in Brazil.

Clearly, we are rapidly moving into the “posthuman era,” one in which humans will become a new type of being. “Technological devices,” writes journalist Marcelo Gleiser, “will be implanted in our heads and bodies, or used peripherally, like Google Glass, extending our senses and cognitive abilities.”

Transhumanism—the fusing of machines and people—is here to stay and will continue to grow.

In fact, as science and technology continue to advance, the ability to control humans will only increase. In 2014, for example, it was revealed that scientists have discovered how to deactivate that part of our brains that controls whether we are conscious or not. When researchers at George Washington University sent high frequency electrical signals to the claustrum—that thin sheet of neurons running between the left and right sides of the brain—their patients lost consciousness. Indeed, one patient started speaking more slowly until she became silent and still. When she regained consciousness, she had no memory of the event.

Add to this the fact that increasingly humans will be implanted with microchips for such benign purposes as tracking children or as medical devices to assist with our health. Such devices “point to an uber-surveillance society that is Big Brother on the inside looking out,” warns Dr. Katina Michael. “Governments or large corporations would have the ability to track people’s actions and movements, categorize them into different socio-economic, political, racial, or consumer groups and ultimately even control them.”

As I make clear in my book Battlefield America: The War on the American People, control is the issue.

In fact, Facebook and the Department of Defense are working to manipulate our behavior. In a 2012 study, Facebook tracked the emotional states of over 600,000 of its users. The goal of the study was to see if the emotions of users could be manipulated based upon whether they were fed positive or negative information in their news feeds. The conclusion of the study was that “emotional states can be transferred to others via emotional contagion, leading people to experience the same emotions without their awareness.”

All of this indicates a new path forward for large corporations and government entities that want to achieve absolute social control. Instead of relying solely on marauding SWAT teams and full-fledged surveillance apparatuses, they will work to manipulate our emotions to keep us in lock step with the American police state.

Now add this warp speed-deployed vaccine to that mix, with all of the associated unknown and fearsome possibilities for altering or controlling human epigenetics, and you start to see the perils inherent in blindly adopting emerging technologies without any restrictions in place to guard against technological tyranny and abuse.

It’s one thing for the starship Enterprise to boldly go where no man has gone before, but even Mr. Spock recognized the dangers of a world dominated by AI. “Computers make excellent and efficient servants,” he observed in “The Ultimate Computer” episode of Star Trek, “but I have no wish to serve under them.”




Under Guise of ‘Racial Justice,’ Johns Hopkins Lays Out Plan to Vaccinate Ethnic Minorities and Mentally Challenged First

Under Guise of ‘Racial Justice,’ Johns Hopkins Lays Out Plan to Vaccinate Ethnic Minorities and Mentally Challenged First
Claims made by Johns Hopkins Center for Health Security about its strategy for vaccinating ethnic minorities and the mentally challenged first, “as a matter of justice,” suggest ulterior motives.

by Jeremy Loffredo and  Whitney Webb
sourced from The Defender, Children’s Health Defense, December 1, 2020
originally published November 25, 2020 at Unlimited Hangout

 

With the first COVID-19 vaccine candidate set to receive an Emergency Use Authorization from the U.S. government in a matter of days, its distribution and allocation is set to begin “within 24 hours” of that vaccine’s imminent approval.

The allocation strategy of COVID-19 vaccines within the U.S. is set to dramatically differ from previous national vaccination programs. One key difference is that the vaccine effort itself, known as Operation Warp Speed, is being almost completely managed by the U.S. military, along with the Department of Homeland Security and the National Security Agency, as opposed to civilian health agencies, which are significantly less involved than previous national vaccination efforts and have even been barred from attending some Warp Speed meetings. In addition, for the first time since 2001, law enforcement officers and Department of Homeland Security officials are set to not be prioritized for early vaccination.

Another key difference is the plan to utilize a phased approach that targets “populations of focus” identified in advance by different government organizations, including the CDC’s Advisory Committee on Immunization Practices (ACIP). Characteristics of those “populations of focus,” also referred to as “critical populations” in official documentation, will then be identified by the secretive, Palantir-developed software tool known as “Tiberius” to guide Operation Warp Speed’s vaccine distribution efforts. Tiberius will provide Palantir access to sensitive health and demographic data of Americans, which the company will use to “help identify high-priority populations at highest risk of infection.”

This report is the first of a three-part series unmasking the racist components of the Pentagon-run project to both develop and distribute a COVID-19 vaccine. It explores the COVID-19 vaccine allocation strategy first outlined by the Johns Hopkins Center for Health Security and subsequent government allocation strategies that were informed by Johns Hopkins.

The main focus of this allocation strategy is to deliver vaccines first to racial minorities but in such a way as to make those minorities feel “at ease” and not like “guinea pigs” when receiving an experimental vaccine that those documents admit is likely to cause “certain adverse effects … more frequently in certain population subgroups.” Research has shown that those “subgroups” most at risk for adverse effects are these same minorities.

The documents also acknowledge that information warfare and economic coercion will likely be necessary to combat “vaccine hesitancy” among these minority groups. It even frames this clearly disproportionate focus on racial minorities as related to national concerns over “police brutality,” claiming that giving minorities the experimental vaccine first is necessary to combat “structural racism” and ensure “fairness and justice” in the healthcare system and society at large.

Part 2 of this series will discuss how Palantir, a company currently helping Department of Homeland Security and law enforcement violently target African Americans and Latinos, will be in charge of allocating “tailored” COVID-19 vaccines to those same minorities as well as Palantir’s origins and its executives’ views on race. Part 3 will explore the direct ties between a COVID-19 vaccine front-runner and the Eugenics Society, which was re-named the Galton Institute in 1989.

The planners

The Trump administration has been criticized for its rush to develop and deploy a COVID-19 vaccine and particularly for installing Monclef Slaoui, a former pharmaceutical executive with ongoing conflicts of interest, as chief scientific adviser for Operation Warp Speed, the Pentagon-run program to produce and distribute the vaccine. Yet, if and when a Biden administration takes power, Operation Warp Speed is set to proceed with little, if any, modification.

The Johns Hopkins Center for Health Security (CHS) director Tom Inglesby, who will serve on the Biden Health and Human Services (HHS) transition team, has praised Slaoui, telling Stat News that the longer someone like him can remain in charge of the nation’s COVID-19 vaccine effort, “the better it is for the country.”

Inglesby, who led discussions at the CHS’s Event 201 exercise in October 2019 and who was one of the primary authors of the controversial Johns Hopkins Dark Winter exercise in 2001, is emblematic of the U.S. government’s and the mainstream media’s general reliance on the Johns Hopkins Bloomberg School of Public Health (of which CHS is part) for pandemic-related matters. Slaoui regularly appears on network TV as a COVID-19 oracle and has been called “one of the nation’s go-to experts on the spread of the coronavirus.” Readers may note that the Johns Hopkins “coronavirus tracker” has been used by virtually every mainstream news source since the beginning of COVID-19 reporting. This relationship is expected to continue, if not intensify, in a Biden administration.

Both Kathleen Hicks, the lead on Biden’s Department of Defense (DOD) transition team, and Alexander Bick, on Biden’s National Security Council transition team, are scholars at Johns Hopkins Kissinger Center for Global Affairs, reflecting the university’s broader influence on a future Biden administration. Yet, the most significant way the Biden transition intersects with Johns Hopkins is through the CHS.

Originally called the Center for Civilian Biodefense Strategies, the CHS is a think tank within Johns Hopkins that regularly gives recommendations to both the U.S. government and the World Health Organization (WHO) and, like the Bill and Melinda Gates Foundation, has emerged as a voice of authority on all matters COVID-19 in the U.S. The center’s founding director was D. A. Henderson, best known for his role in the WHO-sponsored smallpox vaccination campaign. Henderson also held several government positions, including serving as associate director of the Office of Science and Technology Policy under George H. W. Bush. He was also the longtime dean of the Johns Hopkins School of Public Health.

Another member of the Biden transition team is Luciana Borio, a current member of the CHS steering committee. As both a former FDA scientist and former National Security Council member, Borio signifies the relationship between the national security state and the biosecurity state. She’s currently a vice president of In-Q-Tel, the venture-capital arm of the CIA.

In-Q-Tel’s current executive vice president, Tara O’Toole, who at the onset of the COVID-19 outbreak declared that “the best way ever to protect those who are well is with vaccines,” is Inglesby’s mentor and predecessor as director of the CHS. She was also a key player and the lead author of the CHS’s Dark Winter and CladeX bioterror simulations. The Engineering Contagion series published by The Last American Vagabond earlier this year explored the Dark Winter simulation in depth, including how the simulation eerily predicted the 2001 anthrax attacks that followed soon after September 11, 2001, with several participants demonstrating apparent foreknowledge of those attacks.

Ending racism with vaccines?

The Centers for Disease Control and Prevention (CDC) has consistently referenced materials developed by the CHS in its recent COVID-19 vaccine allocation literature. These CDC-issued materials form the backbone of the various vaccine allocation strategies issued by many state governments. Chief among these is the COVID-19 Vaccination Program Interim Playbook, published at the end of October. A key aspect of that program is the determination of “critical populations for COVID-19 vaccination, including those groups identified to receive the first available doses of COVID-19 vaccine when supply is expected to be limited.”

In August, the CHS published its Inglesby cowritten Interim Framework for COVID-19 Vaccine Allocation and Distribution, which is cited by the CDC as a key reference for its nationwide COVID-19 vaccine-allocation strategy. This report will examine this document, in particular, as well as other related documents that reveal that ethnic and racial minorities, specifically those over sixty-five and those who make up part of the “essential” workforce, are set to be the first to receive experimental COVID-19 vaccines.

The Interim Framework argues there is a need to prioritize ethnic minorities, particularly African Americans and Latino Americans, in order to reflect “fairness and justice.” It states that “a critical difference” between COVID-19 vaccine allocation and the “context envisioned in the 2018 guidance for pandemic influenza vaccine allocation” is the fact that the U.S. is “currently in the midst of a national reckoning on racial injustice, prompted by cases of police brutality and murder.” It goes on to state that “although structural racism was as present in the 2018 and previous influenza epidemics as it is today, the general public acknowledgment of racial injustice was not.”

It goes without saying that police brutality is decidedly unrelated to vaccine allocation as is increased national awareness of racial injustice as it relates to police brutality. This is further compounded by the police, in this document, being removed as a priority group for COVID-19 vaccine allocation, despite having been designated a priority group in all other government vaccine-allocation guidance since the 2001 anthrax attacks. Also odd is that it is only increased access of minorities to the COVID-19 vaccine that is cited as a way to address “structural racism in health systems,” not other policies that would be more likely to address the problem such as Medicare for All.

In addition, the Interim Framework admits that “communities of color, particularly Black populations, may be more wary of officials responsible for vaccine-related decisions due to past medical injustices committed by authorities on Black communities.” There is a long list of these “medical injustices” committed against minority communities by the U.S. government, including the infamous Tuskegee syphilis experiments, which are discussed in detail later.

Another odd passage on “justice” and “equity” as it relates to vaccinating ethnic minorities first states:

“In the context of vaccine allocation, treating individuals fairly has sometimes been defined as treating everyone the same or equally, for example, by distributing vaccines on a first-come, first-served basis or by giving everyone an equal chance at getting a vaccine via a lottery. Because the impact of the vaccine is different for different people (i.e., some people are at greater risk of death), the straightforward ways of treating people equally are often rejected as unfair or as an inefficient use of vaccine …

“In the context of vaccine allocation, promoting equity and social justice requires addressing higher rates of COVID-19–related severe illness and mortality among systematically disadvantaged or marginalized groups …

“As a matter of justice, these disparities in COVID-19 risk and adverse outcomes across racial and ethnic groups should be addressed in our overall COVID-19 response.”

This extreme emphasis on the “fairness and justice” of prioritizing minorities for the vaccine is contradicted by other claims made in the same document. For example, the document also states:

“The ultimate safety of an approved vaccine is not completely knowable until it has been administered to millions of people. During clinical trials, tens of thousands of individuals will receive the vaccine but that may fail to show safety concerns that occur with less frequency, such as 1 in a million. This can be a concern for particularly severe adverse effects.”

It also notes: “It is also possible that certain adverse effects may occur more frequently in certain population subgroups, which may not be apparent until millions are vaccinated.”

Notably, African Americans are understood to be at a higher risk for adverse reactions to vaccines. According to a study by the University of Pennsylvania, African Americans exhibit a disproportionately higher immune response to certain flu shots. And in 2014, the Mayo Clinic found that African Americans have almost double the immune response to the rubella vaccine as Caucasian Americans. Immune reactions that are too strong can result in more adverse events and inflammatory responses such as transverse myelitis, a debilitating inflammation and paralysis of the spinal cord. A 2010 study in the Journal of Toxicology and Environmental Health showed that African American boys were at significantly greater risk of suffering severe neurological injury from the hepatitis B shot as compared to Caucasians.

This raises the question as to whether African Americans should be prioritized for a poorly tested vaccine when the available science shows that this demographic may be at a higher risk for adverse reactions to vaccines. Previous coronavirus vaccine projects triggered immune responses so strong that the test animals died, and the vaccine projects got scrapped. The Johns Hopkins CHS Interim Framework claiming that vaccinating African Americans and other ethnic minorities first represents “fairness and justice” and would address “structural racism” does not square with its admission that the safety of the COVID-19 vaccine is “not completely knowable” until millions have received it and that “certain adverse effects may occur more frequently in certain population subgroups.”

Who is really to blame for ‘vaccine hesitancy’?

For a successful rollout of a COVID-19 vaccine, the federal government will need to reckon with “vaccine hesitancy,” which the WHO named as one of the top ten threats to global health in 2019 and which is a major concern discussed at length in the August Interim Framework on COVID-19 vaccination strategies.

According to recent polls, such hesitancy is, understandably, most prevalent among African Americans, the group that has most commonly been used as human guinea pigs by the U.S. government and associated scientific and medical institutions. For instance, there are the infamous Tuskegee University experiments, devised by the U.S. Public Health Service (now a division of HHS) and the CDC. The unwitting participants in the study, all of whom were African American, were told that they were receiving free health-care services from the federal government, while actually they were being intentionally untreated for syphilis so government scientists could study the devastating progression of the disease. Deception was critical to the experiment, as the participants did not know they were part of an experiment at all and were also kept unaware of their true diagnosis. While Tuskegee may be the most well-known example of racist medical experimentation in the U.S., it’s far from the only one.

For example, during the Manhattan Project, the undertaking that produced the atom bomb, the U.S. government contracted dozens of physicians to inject unknowing hospital patients with up to 4.7 micrograms of radioactive plutonium, forty-one times normal lifetime exposure. The goal of this experiment was to pinpoint the dosage at which radioactive elements such as plutonium would cause illnesses like leukemia, and to measure the amount of radioactivity that lingers in the blood, tissues, bones, and urine. Between 1944 and 1994 the Atomic Energy Commission supported thousands of experimental projects sanctioning such radiation on human subjects, most of whom were African Americans.

From 1954 to 1962, the Sloan-Kettering Institute, which receives hundreds of millions of dollars of NIH funds annually, injected over four hundred African American inmates at Ohio State Prison with live cancer cells to observe how the body might destroy them. The primary sponsor for this research was the National Institutes of Health, which also partially sponsored the Tuskegee experiments.

From 1987 through 1991, U.S. researchers administered as much as five hundred times the approved dosage of the Edmonton-Zagreb (EZ) measles vaccine to African American and Latino babies in low-income Los Angeles neighborhoods as part of a vaccine experiment. Consent forms did not inform parents of the increased dosage or of the fact that the vaccine was experimental. Parents were also not informed that the vaccine had already been given to 2,000 children in Haiti, Senegal, and Guinea-Bissau with disastrous results. For example, in Senegal, children who received the jab died at a rate  80% higher than children who did not receive it. The CDC would later characterize the U.S. trials as “clearly a mistake.”

Between 1992 and 1997, Columbia University’s Lowenstein Center for the Study and Prevention of Childhood Disruptive Behavior Disorders conducted studies that sought to establish a link between genetics and violence, focusing on minority children in New York City. These experiments targeted 126 boys between the ages of six and ten, 100% of whom were either African American, Latino, or biracial. In exchange for $100 and a $25 Toys “R” Us gift card, the children, selected because their older brothers had come into contact with the juvenile probation system, were taken from their homes, denied food and water, and given a drug called fenfluramine. Prior to these experiments, fenfluramine had never been administered to people under the age of twelve, and it was already known that the drug was associated with heart-valve damagebrain damage, and death.

Such historical facts raise obvious questions about the reasons for “vaccine hesitancy” and how they are currently being approached by the U.S. government and related institutions. While it would make the most sense to combat this problem by holding to account the people responsible for past abuses, such as those described above, the opposite has been the case. Instead, the CHS and other institutions, particularly regarding the coming COVID-19 vaccination campaign, have proposed several other means of combatting “vaccine hesitancy,” ranging from deception to information warfare to economic coercion.

A dark legacy poised to continue

Given the long-standing exploitive relationship between U.S. medicine and ethnic minorities, the August Interim Framework addresses the situation that communities of color, and in particular black populations, “may be more wary of officials responsible for vaccine-related decisions due to past medical injustices.” It states: “Anticipate hesitancy among marginalized populations who may be fearful or wary of seeking vaccination at sites that have historically caused mistrust.”

Another CHS paper, published in July, “The Public’s Role in COVID-19 Vaccination,” which is cited heavily in the August framework, acknowledged the U.S. “legacy of experimentation on Black men and women.”

However, the CHS document also notes that more than one COVID-19 vaccine candidate “may be available at the same time” and they “may have different safety and efficacy profiles across different population groups and may have different logistical requirements.” It adds that “it is also possible that certain adverse effects may occur more frequently in certain population subgroups, which may not be apparent until millions are vaccinated.”

It is notable that Palantir, the CIA-linked government technology contractor, has been put in charge of creating the software that will “decide” which “population subgroups” are given what vaccine. Palantir is perhaps best known for its controversial role in targeting undocumented immigrants through its contracts with ICE and its role in predictive-policing efforts that disproportionately targeted African Americans. It is certainly unsettling that those same ethnic groups that Palantir is most controversial for targeting on behalf of the national-security state and law enforcement are the same “critical populations” that the company will initially identify for the U.S. military–led COVID-19 vaccination program, Operation Warp Speed.

In addition, in a move that can only aggravate minority community “vaccine hesitancy,” the August CHS Interim Framework recommends that the CDC transform the current “vaccines adverse-event reporting system” from a voluntary system that relies on individuals sending in reports to the government to “an active surveillance system” that “monitors all vaccine recipients,” possibly via unspecified “electronic mechanisms.”

The Last American Vagabond reported last month that Operation Warp Speed, seemingly having taken a cue from the Interim Framework, plans to utilize “incredibly precise … tracking systems” that will “ensure that patients each get two doses of the same vaccine and to monitor them for adverse health effects.” Those systems will be managed, in part, by the intelligence-linked tech giants Google and Oracle.

The main stated purpose of these “tracking systems,” referred to in other Warp Speed documents as “pharmacovigilance systems,” is to monitor the longer-term effects of new, unlicensed vaccine-production methods that are being used in the production of every Warp Speed COVID-19 vaccine candidate. Per Warp Speed’s own documents, these methods “have limited previous data on safety in humans … the long-term safety of these vaccines will be carefully assessed using pharmacovigilance surveillance and Phase 4 (post-licensure) clinical trials,” following the administration of the COVID-19 vaccines to the prioritized “critical populations.”

A strategy takes shape

Given the above, the unprecedented facets of the Warp Speed COVID-19 vaccination plan — that is, its focus on ethnic minorities as the first to receive the experimental COVID-19 vaccine, its interest in giving different vaccine candidates to “different population groups,” and studying the largely unknown effects through “tracking systems” and unspecified “electronic mechanisms”— are all things that would obviously further fuel mistrust by those ethnic groups that have historically been targets of medical experimentation by the U.S. government.

Furthermore, that COVID-19 vaccine development and distribution efforts are being spearheaded by the military and national-security apparatus, as well as having the intimate involvement of controversial contractors such as Palantir, will likely exacerbate minority distrust as Operation Warp Speed advances, given that these same groups are those most often found to be on the receiving end of militarized state violence.

Also concerning is that law enforcement, military, and Department of Homeland Security officials will no longer be priority vaccine-allocation targets, for the first time since the 2001 anthrax attacks, while no convincing reason for their exclusion is offered.

Yet, instead of honestly addressing these unprecedented recommendations, the effort to get around the “vaccine hesitancy” issue as it relates to minorities plans to rely on tactics that avoid addressing any of these issues directly. In one example, although the August Interim Framework recommends “directly prioritizing” ethnic minorities, it recognizes that doing so “could further threaten the fragile trust that some have in the medical and public health system, particularly if there is the perception that there has been a lack of testing to assess vaccine safety and that they are the ‘guinea pigs.’” The document also states that “the implementation of directly prioritizing communities of color could also be challenging and divisive, as determining how to access specific populations and how to determine eligibility based on race or ethnicity includes many sensitive challenges.”

As a workaround for such concerns, the CHS suggests that “prioritizing other cohorts of the population, such as essential workers or those with underlying health conditions associated with poorer COVID-19 outcomes, could also indirectly help address the disproportionate burden of this pandemic on communities of color” due to the high representation of those minorities in the essential workforce.

The document continues: “While this approach might avoid some of the challenges outlined above, it would also need to be implemented in a way that ensures vaccines are equitably distributed across subcategories of these categories.” Thus, it suggests prioritizing “those individuals and groups who face both severe health and severe economic risks, specifically essential workers at higher risk of severe illness — or whose household members are at higher risk — who will suffer severe economic harm if they stop working.” Those groups at “higher risk of severe illness,” the document later notes, are incidentally ethnic minorities.

In other words, the strategy proposed by the CHS is to specifically prioritize cohorts of the U.S. population that contain high proportions of ethnic minorities without directly prioritizing those minorities in order to, somewhat deceptively, avoid exacerbating “vaccine hesitancy” concerns among those groups by directly singling them out.

The Interim Framework acknowledges the high prevalence of ethnic minorities in the essential workforce and cites a paper published in April 2020 by the Center for Economic and Policy Research that notes “people of color are overrepresented in many occupations with frontline industries.”

In addition to prioritizing essential workforce cohorts, which have a high percentage of ethnic minorities, the CHS document also suggests that prisoners, another group where ethnic minorities are heavily overrepresented, and “undocumented immigrant communities of color” should also be prioritized. Like the essential workforce strategy, this would ensure increased vaccine uptake by ethnic minorities without prioritizing them directly.

It is also worth noting that, in addition to the focus on ethnic minorities, the Interim Framework also recommends that “differently abled and mentally challenged populations, who can experience difficulties in accessing healthcare and could be in higher-risk living settings, such as assisted living facilities,” be included as a “target population” along with ethnic minorities.

This strategy as laid out by the CHS appears to have been embraced by the CDC’s ACIP, which is the official government body that will designate the “target populations” of the COVID-19 vaccination strategy.

Also in August, Kathleen Dooling, a CDC epidemiologist writing on behalf of ACIP’s COVID-19 Vaccines Work Group, stated that “groups for early phase vaccination” should be those that “overlap” the most with, first, those with “high risk” medical conditions, second, essential workers, and, third, adults over sixty-five. As previously noted, the essential workforce is predominantly composed of ethnic minorities.

Notably, the “high risk” medical conditions listed in this same document are conditions that are all significantly more prevalent among ethnic minorities, such as type 2 diabetesobesitychronic kidney diseaseserious heart conditions, and sickle cell disease. Cancer is also listed and, while prevalent across the U.S. population at large, the incidence of cancer is highest among African Americans.

Particularly notable is the inclusion of sickle cell disease, as African Americans in the U.S. have a much higher probability of having that condition than any other group. According to 2010 data analyzed by the CDC, the sickle cell gene, which is necessary in both parents for a child to inherit sickle cell disease, is present in 73 per 1,000 African American newborns, compared to three per 1,000 Caucasian newborns.

The “overlap” strategy fits with current CDC ACIP guidelines for vaccine recommendations, which hold that, if vaccination supply is limited, the CDC should “reduce the extra burden the disease is having on people already facing disparities.” The “overlap” strategy as laid out in the recent ACIP COVID-19 Vaccines Work Group document, however, has the inevitable end result of ensuring that the vast majority of those who will first receive the experimental COVID-19 vaccine will be ethnic minorities over the age of sixty-five and ethnic minorities in the essential workforce.

Also noteworthy in relation to the prioritization of ethnic minorities is that in March the government interpreted federal regulations to grant liability immunity to any entity producing, distributing, manufacturing, or administering COVID-19 countermeasures, including vaccines. According to HHS, this move may also “provide immunity from certain liability under civil rights laws,” meaning that those involved with the COVID-19 vaccination campaign may not be liable if found to violate the rights of groups protected under civil rights law, that is, ethnic minorities.

Controlling the narrative

Another tactic promoted by the CHS, as well as the CDC and Warp Speed, to combat “vaccine hesitancy” is aggressive communication strategies that include “saturating” the media landscape with provaccine content while greatly reducing content deemed to promote “vaccine hesitancy.” The national-security state, which is managing Operation Warp Speed, has become increasingly involved in this media effort, particularly by censoring content that is considered to be anti-vaccine (including, in their view, news outlets critical of the pharmaceutical industry and vaccine manufacturers) by using counterterror tools that have previously been used to disrupt online terrorist propaganda.

After the October 2019 coronavirus pandemic simulation, Event 201, the CHS issued a statement that media companies have a responsibility to ensure that “authoritative messages are prioritized.” The CHS had co-sponsored Event 201 alongside the World Economic Forum and the Bill and Melinda Gates Foundation.

There is much more to this information war than just the rapidly accelerating online censorship effort. For instance, the official Operation Warp Speed document “From the Factory to the Frontlines” notes that “strategic communications and public messaging are critical to ensure maximum acceptance of vaccines, requiring a saturation of messaging across the national media.” It also states that “working with established partners — especially those that are trusted sources for target audiences — is critical to advancing public understanding of, access to, and acceptance of eventual vaccines” and that “identifying the right messages to promote vaccine confidence, countering misinformation, and targeting outreach to vulnerable and at-risk populations will be necessary to achieve high coverage.”

The document also notes that Warp Speed will employ the CDC’s three-pronged strategic framework known as “Vaccinate with Confidence” for its communications thrust. The third pillar of that strategy is called “Stop Myths” and has as a main focus “establish[ing] partnerships to contain the spread of misinformation” as well as “work[ing] with local partners and trusted messengers to improve confidence in vaccines.”

Like the official Warp Speed guidance, the CDC Interim Framework also sees “community outreach” as an essential element for a successful vaccine campaign and suggests funding and training community health workers to promote vaccination specifically to “underserved, disproportionately affected groups.” It details how the U.S. government might engage African Americans, Latino Americans, and lower-income populations to build trust in connection with vaccine recommendations and get around “concerns that they are ‘testing subjects’ for a novel vaccine.”

The CHS document notes, for example, the importance of cultural competence when promoting vaccines, advising that vaccinating at “churches, schools, culturally specific community centers or senior centers” might sit better with marginalized populations and make them feel more at ease. Such considerations were further elaborated on by Luciana Borio in September. That month, the vice president of In-Q-Tel and member of Biden’s transition team, wrote that while it may be appropriate to use U.S. military resources for vaccination efforts, “any such federal engagement must be done in a collaborative manner sensitive to public perceptions that may be engendered by having a public health function fulfilled by individuals in uniform.”

A July CHS paper, “The Public’s Role in COVID-19 Vaccination,” a document Luciana Borio also helped write, argued, “Vaccination sites should not be heavily policed or send any signals that the site may be unsafe for Black or other minority communities.” This CHS paper further states that “trusted community spokespersons” should be utilized for a “communication campaign,” amplifying “vaccine-affirming, personally relevant messages.” Like similar WHO materials, it advocates tailoring the campaign to specific audiences and identifying a network of spokespeople to deliver a “salient and specific message repeatedly, delivered by multiple trusted messengers and via diverse media channels.”

The CDC also recommends vaccine administration at places such as university parking lots, soup kitchens, public libraries, and faith-based organizations. An October CDC report reads: “For people living in institutions, consider vaccination at intake; for people attending colleges/universities, vaccinate at enrollment.” It also proposes that U.S. states and territories utilize nontraditional vaccination sites such as homeless shelters and food pantries.

The prospect of red-carpet celebrities, influencers, and “trusted messengers” endorsing public-health policy is not unthinkable. According to NBC New York, New York and New Jersey have already recruited celebrities to urge residents to follow CDC guidelines. Actors including Julia Roberts, Penelope Cruz, Sarah Jessica Parker, Robin Wright, and Hugh Jackman earlier this year joined a coordinated campaign to “pass the mic to COVID-19 experts.”

In addition, this summer the WHO paid PR firm Hill & Knowlton Strategies $135,000 to identify micro-influencers, macro-influencers, and what it calls “hidden heroes” who “shape and guide conversations” to promote WHO messaging on social media and promote the organization’s image as a COVID-19 authority. Hill & Knowlton are controversial for having previously manufactured the false “incubator baby” testimony delivered in front of Congress that propelled the U.S. into the first Gulf War in the early 1990s.

The Public’s Role in COVID-19 Vaccination” also urges using groups such as faith-based organizations, schools, homeowners’ associations, and unions trusted by “hard-to-reach audiences” to convey positive vaccine messages and to “modulate public perceptions of vaccination.” Accordingly, the July CHS paper notes “the importance of using outside groups who have relationships with the community, instead of direct government involvement.” It should be noted that during the Tuskegee experiments, the U.S. Public Health Service hired Eunice Rivers, a black nurse with a close relationship to the local minority community, to maintain contact with those who were part of the experiment to ensure they continued to participate.

This outsourcing framework as laid out by the CHS is reproduced in the federal government’s own literature. An October CDC report, Interim Playbook for Jurisdiction Operations, describes the importance of engaging what minority populations would consider “trusted sources” such as union representatives, college presidents, athletic coaches, state licensure boards, homeless shelter staff, soup kitchen managers, and faith leaders to “address hesitancy” in relation to the COVID-19 vaccine.

Operation Warp Speed’s document “From the Factory to the Frontlines,” released the same day as the CDC Interim Playbook, gives more specific examples of the government’s ongoing work with organizations “representing minority populations,” stating that faith-based organizations can be critical. “HHS’s Center for Faith and Opportunity Initiatives is working with minority-serving faith and community groups … and encouraging participation in the vaccination program,” the document reads. It also states that an “information campaign” led by HHS’s public affairs department is already working to “target key populations and communities to ensure maximum vaccine acceptance.”

Of note is that a member of Biden’s Office of Management and Budget (OMB) transition team is Bridget Dooling. The OMB houses the Office of Information and Regulatory Affairs, which reviews all regulations across the federal government. Dooling previously worked at OIRA, and from 2009 until 2011 worked under the direction of then-OIRA administrator Cass Sunstein. On Twitter, Dooling regularly interacts with Sunstein. She has frequently promoted Sunstein’s work on Twitter, especially this past month.

Notably, in 2008, Sunstein authored a paper encouraging the U.S. government to employ covert agents to “cognitively infiltrate” online dissident groups that promote antigovernment “conspiracy theories” and to maintain a vigorous “counter misinformation establishment.”

Elements of his strategy for tackling anti-government “conspiracy theories” are analogous to the aforementioned CHS theme of using “outside groups who have relationships with the community” instead of the government directly. “Governments can supply these independent bodies with information and perhaps prod them into action from behind the scenes,” he contended in his paper.

Sunstein was recently made chair of the World Health Organization’s Technical Advisory Group on Behavioral Insights and Sciences for Health to ensure “vaccine acceptance and uptake in the context of COVID-19.”

In September he also wrote an opinion piece for Bloomberg, “How to Fight Back against Coronavirus Vaccine Phobia,” suggesting that “high-profile people who are respected and admired by those who lack confidence in vaccines” will help sell the public on the safety of vaccines. “Trusted politicians, athletes or actors — thought to be ‘one of us’ rather than ‘one of them’ — might explicitly endorse vaccination,” he writes.

When all else fails, coerce

In addition to this information warfare approach to combating “vaccine hesitancy,” the government also intends to stave off possible hesitancy through economic coercion, that is, by using economic incentives, even linking vaccination to entrance into the workforce, housing assistance, food, travel, and education.

Sunstein’s Bloomberg piece, for example, states that when a vaccine is available, “an economic incentive, such as a small gift certificate, can help” make it easy for “people who are at particular risk. Such gift cards will inevitably be more effective at swaying decisions of the poor.”

Former 2020 Presidential Candidate and U.S. Representative for Maryland’s 6th congressional district John Delaney recently penned an article in the Washington Post, “Pay Americans to Take a Coronavirus Vaccine,” in which he argues a way to overcome the “historical level of distrust” in the vaccine development process is to take advantage of the current economic crisis and “pay people to take a COVID vaccine.” Delaney writes, “Such an incentive might be the most effective way to persuade people to overcome suspicion or even fear …”

CHS’s “The Public’s Role in COVID-19 Vaccination,” paper also details how bundling services like “food security, rent assistance, [and] free clinic services” with vaccination can increase vaccine intake. “Local and state public health agencies should explore opportunities to bundle COVID-19 vaccination with other safety net services,” it suggests. One way of doing this is to simply provide “food aid, employment aid, or other preventative health services” that “may be urgently needed” at vaccination sites. “[And] in some cases,” says the CHS, “it also may be acceptable and feasible to deliver vaccination via home visits by community health nurses when vaccination is bundled with delivery of other services.”

This strategy for increasing vaccine intake parallels what the CHS proposes in order to make digital contact tracing technology (DCTT) widespread in the population without mandating it outright. “Instead of making use fully voluntary and initiated by users, there are ways that DCTT could be put into use without users’ voluntary choice,” a recent CHS paper “Digital Contact Tracing for Pandemic Response” reads. It continues: “For example, use of an app could be mandated as a precondition for returning to work or school, or even further, to control entry into a facility or transportation (such as airplanes) through scanning of a QR code.”

Palantir and priority populations

Aside from the troubling aspects of the COVID-19 vaccination strategy as outlined above, there is the separate issue of the way in which these “populations of focus” will be chosen and identified. Palantir, the big data firm with deep and persisting ties to the CIA, has created a new software tool expressly for Warp Speed called Tiberius. Not only will Tiberius use Palantir’s Gotham software and its artificial intelligence components to “help identify high-priority populations,” it will produce delivery timetables and map out the locations for vaccine distribution based on the masses of data it has collected through various contracts with HHS and data-sharing alliances with In-Q-Tel, Amazon, Google and Microsoft, among others.

These data include extremely sensitive information about American citizens and the lack of privacy safeguards governing Palantir’s growing access to American healthcare data has even gotten the attention of Congress, with several senators and representatives warning in July that Palantir’s massive stores of data “could be used by other federal agencies in unexpected, unregulated, and potentially harmful ways, such as in the law and immigration enforcement context.”

Given that Palantir, at present, is best known for targeting the same minorities that are slated to be “priority populations” for early receipt of the experimental COVID-19 vaccine, Tiberius and the company behind it, including the obsessive “race war” fears of its top executive, will be explored in Part 2 of this series.


Jeremy Loffredo is a reporter for The Defender.




Lawyers Petition for New Anthrax Investigation

Lawyers Petition for New Anthrax Investigation

by James Corbett, The Corbett Report
December 1, 2020

 

David Meiswinkle and Mick Harrison of the Lawyers’ Committee for 9/11 Inquiry join James to discuss their petition to Congress for a redress of grievances related to government misconduct in the investigation of the 2001 anthrax attacks.

Watch on Archive / BitChute / LBRY / Minds / YouTube or Download the mp4

SHOW NOTES:

Lawyers’ Committee for 9/11 Inquiry

Interview 1383 – Lawyers Petition for 9/11 Grand Jury

Anthrax Petition Executive Summary

Lawyers’ Committee Anthrax Petition

Anthrax Exhibits Index

Interview 1212 – From Anthrax to Iraq with Graeme MacQueen

Interview 864 – Dr. Meryl Nass Exposes the Anthrax Cover Up

Exhibit NAS NRC review of FBI anthrax science report 13098

U.S. Germ Warfare Research Pushes Treaty Limits

Episode 383 – COVID-911: From Homeland Security to Biosecurity

Episode 388 – False Flags and the Dawn of Bioterrorism




Joseph P. Farrell: Just Who Is Klaus Schwabb?

Just Who Is Klaus Schwabb?

by Joseph P. Farrell, Giza Death Star
December 1, 2020

 

I’ve been receiving so much email containing articles about “the Great Reset” – usually in conjunction with the covid planscamdemic, digital “currencies”, 2020 American election fraud, and so on – that I decided to do something a little unusual for today’s blog, and high octane speculation. I decided to do just a bit of “dirt scratching” about the familiar face of the “Great Reset” crowd, Dr. Klaus Schwabb. I say “dirt scratching” rather than “digging” because what I ran across was… well… perplexing.  There are plenty of articles about him, his agenda, and so on. But these are of a speculative nature.

Schwabb is of course that German guy whose bald pate and perpetually scowling face has been seen in various interviews on the propatainment media lately, opining about the coming golden age vhen everyone vill be surveilled (or perhaps better put, “serveilled”), vill not own any property, und everyone vill haff a guaranteed income, and so on.  In short, he’s a globaloneyist sourpuss, handing out edicts and pronouncements in a heavy German accent of vhat he vants ze vorld to be.

I cannot help, when I look and listen to this man, to think of Ian Fleming’s James Bond movies and books, and the shadowy organization called SPECTRE, which is an acronym for Special Executive for Counter-intelligence, Terrorism, Revenge and Extortion. This organization is headed – if you remember your Bond movies – by a German character named Ernst Stavro Blofeld, who in his most memorable incarnation was played by British actor Donald Pleasance, bald, and perpetually hovering around white cats. There were other actors who played Blofeld, of course, including most recently Christopher Waltz, but Pleasance always hit the image of Blofeld on the head for me…

… as does Klaus Schwabb, and that raises the issue of Schwabb’s World Economic Forum as being a sort of real-world counterpart to SPECTRE.

But I digress.

What is interesting about Herr Blofe… er… Schwabb is his biography. Or rather, lack thereof. Just for kicks and giggles, check out the Wikipedia article on this arachnid (that’s a fancy taxonomical term for spiders and ticks):

https://en.wikipedia.org/wiki/Klaus_Schwab

Here we read some mildly intriguing things:

Klaus Martin Schwab (German pronunciation:[klaʊs ˈmaʁtiːn ʃvaːp]; born 30 March 1938) is a German engineer and economist best known as the founder and executive chairman of the World Economic Forum.[1] His wife and first collaborator,[2][3] Hilde, co-founded the Schwab Foundation for Social Entrepreneurship with him.

Ok… he’s born in Germany in 1938. From there we leap to this:

Schwab holds a doctorate in Economics from the University of Fribourg[4], a doctorate in Engineering from the ETH Zurich (Swiss Federal Institute of Technology)[5] and a Master of Public Administration from the John F. Kennedy School of Government at Harvard University[6]. Before pursuing his doctorates, he graduated as an engineer from the ETH Zurich, and as an economist from the University of Fribourg.[citation needed].

Additionally, he has been the recipient of 17 honorary doctorates[7], including from the London School of Economics[8], the National University of Singapore[9]KAIST[10], and over a dozen other universities, from Kaunas to Haifa to Bangkok.[11][12][13]. He is also an honorary professor of the University of Geneva, the Ben-Gurion University of Israel[14] and the China Foreign Affairs University.[15]

He obtained his “Abitur” or high school diploma from the Humanistisches Gymnasium in Ravensburg, Germany.

And later on in the entry we’re informed that it was indeed Schwabb who invented the idea of “stakeholders”:

In 1971, Schwab founded the European Management Forum,[23] which in 1987 became the World Economic Forum, as a not-for-profit foundation committed to improving the state of the world. He founded the WEF in 1971, the same year in which he published Moderne Unternehmensführung im Maschinenbau[24] (Modern Enterprise Management in Mechanical Engineering). In that book, he argued that the management of a modern enterprise must serve not only shareholders but all stakeholders (die Interessenten), to achieve long-term growth and prosperity. Schwab has championed the multistakeholder concept since the WEF’s inception. In 2015, the WEF was formally recognised by the Swiss Government as an “international body”[25]. Under Schwab’s management, the WEF has been keen to promote its image as a driver for reconciliation efforts in different parts of the world, acting as a catalyst of numerous collaborations and international initiatives.

In 1998, Schwab and his wife founded the Schwab Foundation for Social Entrepreneurship, another NGO based in GenevaSwitzerland.

In 2004, Schwab created a new foundation using the US$1 million prize money from the Dan David Prize he received that year from Israel. The Forum of Young Global Leaders[26] aims to create a dynamic global community of exceptional people (under 40) with the vision, courage and influence to drive positive change in the world.

And finally, of course, he’s the recipient of numerous awards from the high and mighty:

He was knighted by Queen Elisabeth (Knight Commander of the Order of St Michael and St George, 2006), received the Knight Commanders Cross of Germany (2012) and the Grand Cordon of the Rising Sun of Japan (2013)[33]. He is a Knight of the Légion d’Honneur of France (1997), received the Candlelight Award from then U.N. Secretary-General Kofi Annan (New York, 2001)[34] and received the China Reform Friendship Medal (2018).

Now you might be asking yourself a question, and believe me, it’s the same question I’m asking myself: OK, Herr Professor Doktor des  Globaloneyismus was born in Regensburg in 1938, and the next entry of note we have is him founding the precursor to the World Economic Forum, the European Management Forum, in 1971, a gap of – oh look – 33 years. What was he doing in that 33 years? Well, presumably earning all those doctorates in processology and bureaucratese and technocratism and learning how to become Ernst Stavro Blofeld. With whom did he study? We’re not told. What were his dissertations about? We’re not told. What were his memberships and associations? We’re not told. Who were his parents? We’re not told (although, as one might expect, I entertain some suspicions in all these regards).

In short, there’s a giant lacuna of some 33 years in this globaloney guru’s public record that raises all sorts of questions in my mind. We know, via relatively easily available public sources, next to nothing about this man’s early life.

Almost as if someone, somewhere, does not want those family ties or early associations too well known.

And that, dear readers, sends my suspicion meter into the red zone.

See you on the flip side…

 


Tidbit: More on Ernst Stavro Blofeld 

Apropos of today’s main blog, there’s this intriguing article on our real life Ernst Stavro Blofeld:

Perhaps it would be better to call  this inhuman and anti-human quackademic, Ernst Stavro Blowhard…

 

Connect with Dr. Joseph P. Farrell at Giza Death Star




NYC Pub Declares Itself “Autonomous Zone” After Government Tries To Shut It Down

NYC Pub Declares Itself “Autonomous Zone” After Government Tries To Shut It Down

by toulour, ZeroHedge
November 29, 2020

 

In what is a hilarious bit of irony for Democrat politicians in New York, a pub that had its liquor license yanked due to Covid rules has now declared itself an “Autonomous Zone” and is continuing to do business.

The bar, called Mac’s Public House in Staten Island, said publicly: “We refuse to abide by any rules and regulations put forth by the Mayor of NYC and Governor of NY State.”

They also painted “AUTONOMOUS ZONE” on the sidewalk outside the bar and put signs in the windows claiming “As of November 20, 2020, we hereby declare this establishment an AUTONOMOUS ZONE”.

The pub had its liquor license revoked by the state and was slapped with thousands of dollars in fines after defying New York’s latest move to “orange zone status” (whatever that means) thanks to the very huge brain of “Emmy nominated” Governor Andrew Cuomo.

Co-owner Danny Presti told The Post: “At this point, we’re OK with it, because we’re not paying it. [The Sheriff’s Department] is issuing us $1,000 fines, so they keep coming back. We’re still here. We’re not letting them in.”

Co-owner Keith McAlarney said in a recent YouTube video: “We’re not backing down. You think you scared me by . . . saying I don’t have a license now to serve liquor now? Well guess what? That liquor license is on the wall. If that liquor license is gonna come off the wall, it’s gonna be done by Cuomo. You wanna come down here and pull that license off the wall?” 

He continued: “De Bozo – you want to come down here and pull the license off the wall? Feel free to end up comin’ down, and we’ll end up having a conversation before you even think about stepping foot on my property. I will not back down.”

On Saturday, the bar was operating without a license, offering booze for free to a small group of customers. The move is try and exploit a loophole in Cuomo’s bill by not actually charging customers.

One customer said: “He’s alright, he’s doing the right thing.”

Another customer – who didn’t pay for his drink and left a $100 tip on a glass of water – said: “I totally support what he is doing. I don’t support the tyrannical nonsense they have in place.” 

Here is a video update on the bar from the weekend:




Johns Hopkins Study Explodes COVID Death Hoax; It’s Re-Labeling on a Grand Scale

Johns Hopkins Study Explodes COVID Death Hoax; It’s Re-Labeling on a Grand Scale
“This patient who died had an ordinary heart attack.”
“Not anymore. We’re repackaging it as COVID.”

 

by Jon Rappoport, No More Fake News
November 30, 2020

 

Don’t blink. Johns Hopkins may delete or retract their analysis at any moment. Their author’s study is devastating. Too hot to handle.

UPDATE: Yes, I wrote that opener a few hours before Johns Hopkins stepped in and DID retract the article. Boom. [1] [2] [3] [4]

Hopkins claims the article has been used to spread misinformation about the pandemic, and contains factual errors. CDC is cited as one correct source of facts. Hmm.

Regardless, here is my article, finished before the Johns Hopkins retraction. Since then, I’ve only polished it a bit in several places, for clarity:

Months ago, I told you this, in a number of articles: The overwhelming percentage of people who are “dying from the virus” are actually dying from traditional diseases.

These people have been relabeled and repackaged as “COVID-19.”

It has nothing to do with “the virus.”

A new analysis from Johns Hopkins confirms this in spades.

The Johns Hopkins News-Letter article, in a student publication, is headlined, “A closer look at US deaths due to COVID-19.” It lays out the case made by “Genevieve Briand, assistant program director of the Applied Economics master’s degree program at Hopkins.”

As you keep reading, keep this in mind: If the so-called increase in mortality from COVID is offset, almost exactly, by a decrease in deaths from all other major diseases…

Indicating that the so-called COVID deaths are nothing more than an exercise in re-labeling, then…

You can say there is a new coronavirus, but it’s even less harmful than flu, because virtually everybody recovers…

Or you can say the whole story of a new coronavirus is a fake narrative. There is no new virus.

My readers know I’ve been offering much evidence for the latter conclusion.

Here are key quotes from the Johns Hopkins News-Letter article:

“These data analyses suggest that in contrast to most people’s assumptions, the number of deaths by COVID-19 is not alarming. In fact, it has relatively no effect on deaths in the United States.”

“This comes as a shock to many people. How is it that the data lie so far from our perception?”

“When Briand looked at the 2020 data during that seasonal period, COVID-19-related deaths exceeded deaths from heart diseases. This was highly unusual since heart disease has always prevailed as the leading cause of deaths. However, when taking a closer look at the death numbers, she noted something strange. As Briand compared the number of deaths per cause during that period in 2020 to [deaths per cause in] 2018, she noticed that instead of the expected drastic increase across all causes, there was a significant decrease in deaths due to heart disease. Even more surprising, as seen in the graph below, this sudden decline in deaths is observed for all other causes.”

“This trend is completely contrary to the pattern observed in all previous years. Interestingly, as depicted in the table below, the total decrease in deaths by other causes almost exactly equals the increase in deaths by COVID-19. This suggests, according to Briand, that the COVID-19 death toll is misleading. Briand believes that deaths due to heart diseases, respiratory diseases, influenza and pneumonia may instead be [may have been] recategorized as being due to COVID-19.”

“The CDC classified all deaths that are related to COVID-19 simply as COVID-19 deaths. Even patients dying from other underlying diseases but are infected with COVID-19 count as COVID-19 deaths. This is likely the main explanation as to why COVID-19 deaths drastically increased while deaths by all other diseases experienced a significant decrease.”

“’All of this points to no evidence that COVID-19 created any excess deaths. Total death numbers are not above normal death numbers. We found no evidence to the contrary,’ Briand concluded.”

“’If [the COVID-19 death toll] was not misleading at all, what we should have observed is an increased number of heart attacks and increased COVID-19 numbers. But a decreased number of heart attacks and all the other death causes doesn’t give us a choice but to point to some misclassification [re-labeling],’ Briand replied.”

“In other words, the effect of COVID-19 on deaths in the U.S. is considered problematic only when it increases the total number of deaths or the true death burden by a significant amount in addition to the expected deaths by other causes. Since the crude number of total deaths by all causes before and after COVID-19 [was first announced] has stayed the same, one can hardly say, in Briand’s view, that COVID-19 deaths are concerning.”

Of course, there is some mealy-mouthed backtracking in the article. The virus is deadly and the pandemic is real, etc. But the data are the data.

The whole COVID operation is a hoax.

If I thought other honest researchers would investigate and re-calculate the Hopkins analysis, I would say, let’s see what they come up with. But based on my experience, there will be, at best, a brief flurry of articles in the press about this extraordinary finding, and then the scientific and press denizens will move on, as if nothing happened. That is their way. They briefly expose a scandal and then they slither off to cover up the scandal.

The other possibility is: Hopkins will retract the analysis, claiming it was flawed. That is the other strategy the low-crawling creatures sometimes deploy.

So there you have it.

Hoax. Con. Fake.

As I keep reporting, the virus (never proven to exist) is the cover story for the true phase-one goal: destruction of the economy.

If the virus were real, if it were attacking people left and right, the all-cause mortality numbers would be through the roof.

But they aren’t.

“I have a great idea, Bill. Let’s declare a fake pandemic. We’ll report all sorts of high death numbers. But really, we’ll just be subtracting numbers from other traditional diseases that cause deaths, and we’ll add those numbers to our fake pandemic.”

“Sounds great, Tony. Can you pull it off? I mean, it’s pretty obvious.”

“Sure, we can pull it off. And if some journalist with a mainstream reputation or an institution suddenly develops a brief infection of ETHICS, we’ll call their work a mistake or a lapse in judgment.”

“You mean an institution like the World Health Organization or Johns Hopkins?”

“Right. We’ll say the institution didn’t issue the study, it was just one of their people, a lone researcher. And if necessary, the institution, under pressure, will back off. But that’s assuming anyone noticed the study in the first place. Normally, these ‘revelations’ surface for a moment and then sink like a stone. No one cares. A pandemic is a money waterfall. The beneficiaries won’t sacrifice their bottom lines, or their reputations…”

Of course, people can rise up and raise holy hell.


SOURCES:

[1] https://www.jhunewsletter.com/article/2020/11/a-closer-look-at-u-s-deaths-due-to-covid-19

[2] https://web.archive.org/web/20201126163323/https://www.jhunewsletter.com/article/2020/11/a-closer-look-at-u-s-deaths-due-to-covid-19

[3] https://drive.google.com/file/d/1iO0K75EZAF8dkNDkDmM3L4zNNY0X-Xw5/view

[4] https://www.youtube.com/watch?v=3TKJN61aflI




Police for Freedom: Spanish Police Rise Up Against “Covid” Lies & Mandates — Saying No to Masks, Forced Vaccines & Crimes Against Humanity

Police for Freedom: Spanish Police Rise Up Against “Covid” Lies & Mandates — Saying No to Masks, Forced Vaccines & Crimes Against Humanity

 

Marching with Policias por la Libertad in Valencia 

by Dawn of Peace
November 30, 2020

 

Original video is available at Dawn of Peace YouTube channel.

An amazing movement is beginning to take form in Spain as a group of police has come together to blow the whistle on the systemic human rights abuse and take a stand for freedom.

On the 28th of November, Policías por la Libertad (Police for Freedom) were leading the peaceful march through Valencia, supported by Dawn of Peace, Doctors for Truth, Scientists for Truth, Firemen for Freedom and Truth, Soberanía y Salud as well as Rebelión en La Granja.

We are coming together and standing on the right side of history! Join us!

Contact the groups here:
Policías por la Libertad : https://www.policiasporlalibertad.org
Dawn of Peace : https://dawnofpeace.org
Medicos por la Verdad : https://medicosporlaverdad.es
Soberanía y Salud : https://soberaniaysalud.com/ https://soberaniaysalud.com/
Rebelión en La Granja : https://t.me/ReVelionenlagranja
Difusión Josep Pamies : https://t.me/BoticaBerde

 



See Related:

‘Police for Freedom’: Spanish Officers Demonstrate Against the Coronavirus Lockdown and Masks

by Amy Mek, RAIR Foundation USA
November 30, 2020

 

On November 28, 2020, “Police for Freedom” a group comprised of Spanish Law Enforcement officers, held a demonstration in the streets of downtown Valencia, Spain. The officers are protesting against their socialist government’s management of the Chinese coronavirus, the violation of citizens freedoms, and the mandated mask measures.

The demonstrators held signs declaring, “Enough with the Lies, “Enough with the Human Rights Abuse”, “The police want to breathe”, and “No to the Vaccine”.

“Police for Freedom” is a recently formed group that brings together members of State Security Forces and private surveillance groups to ensure the rights of Spanish citizens are protected. This same patriotic group held a large march in Madrid on November 7.

The groups spokesperson Sonia Vescovacci, a national police officer on leave of absence, has called for the civil liberties of citizens to be respected. Vescovacci has encouraged her fellow officers to fail to comply with the government tyrannical orders to punish people who do not use masks or deny the seriousness of the pandemic.

Although the group instructed all participants to wear masks, a large portion of the demonstrators did not listen to their request. Following the rally, Valencia’s local government targeted police, the event organizers and participants for failing to comply with the states coronavirus measures. Ninety police officers have received fines for demonstrating against the “Imposition of masks” without wearing them.

Read More Here

 




James Corbett: When False Flags Go Virtual

When False Flags Go Virtual

by James Corbett, Corbett Report
November 29, 2020

 

Imagine this: you wake up to the blaring of your alarm clock and immediately reach for your smartphone to scroll your Insta feed before getting out of bed. But instead of the usual delightful and informative Instagram posts, today you’re greeted by a “server not found” error.

Deciding that it’s too early in the morning to deal with this, you hop in the shower . . . but for some reason Alexa won’t play your Spotify playlist through your bathroom smart speakers. You have to shower in silence like a luddite.

Getting frustrated, you head downstairs for breakfast. You prop your iPad up next to you and go to check your email while stuffing your face with your morning bowl of Cheeri-GMOs (now with extra HFCS!) but you’re not getting any new messages. You turn on your smart TV and navigate to YouTube so you can catch up on all the latest news from MSNBC, but all you get is the never ending spiral of the spinning “loading” wheel.

Twitter? Down.

Facebook? No luck.

Reddit? Forget it!

Increasingly desperate, you try in vain to remember how to turn on your regular terrestrial TV. Then you recall you have something collecting dust in a closet somewhere: a radio. You turn it on, fumble with the dial, and find a station just in time to hear the announcement:

“. . . is claiming responsibility for the outage. Once again, widespread outages across a range of internet services is sweeping the globe this morning, as a shadowy new terror group emerges to take responsibility . . .”

Suddenly, your phone starts making a strange sound. You don’t know what it’s doing at first, until you realize it’s ringing. One of your friends is calling you. On the phone. Not texting, tweeting, messaging or snapchatting. Actually calling you.

“Hello?”

“Hey Norm! You hear about the big news? Internet’s down!”

“Yeah.”

“They say it’s some kind of new terror group. Cybeterrorists In Action. C.I.A. for short. Sounds pretty scary.”

. . . Oh, OK, I’ll stop teasing. Of course this doesn’t describe you or your daily routines, dear reader. I know you’re the clued-in, switched-on sort who peruses The Corbett Report and avoids normie internet sites like the plague (the real plague, not this ginned-up COVID cold).

But don’t scoff at the scenario. A scene like this one could play out one day for billions of Normie McNormesons around the world. And when it does, there will already be a plan in place for changing the internet as we know it.

As I know you know, the transition from the homeland security state to the biosecurity state that I documented in COVID-911 raises the specter of false flag bioterrorism. But there are other vectors for false flag attacks that could cause massive disruption to our lives, and, like every spectacular false flag event, increase the power and control of the deep state. In this case, I’m thinking of false flag cyberterrorism.

The idea of a “cyber 9/11” coming along to disrupt the internet has been around since the actual 9/11 occurred. Back in 2003, even as the Pentagon was feverishly drafting its plans to “fight the net” as if it were “an enemy weapons system,” Mike McConnell, the ex-director of the National Security Agency (NSA), was fearmongering over the possibility of a cyber attack “equivalent to the attack on the World Trade Center” if a new institution were not created to oversee cybersecurity. In the following years, report after report continued to use the horror of 9/11 as a way of fueling public hysteria over cyberterrorism until just such a US Cyber Command was created.

But the creation of CYBERCOM did not end the cyber threat anymore than the creation of the Department of Homeland Security ended the terror threat, and for precisely the same reason: the real terror threat doesn’t come from the cave-dwelling terrorists that the politicians tell us to be afraid of. No, the real terror threat comes from the very agencies that have been tasked with “saving” the public from the terrorist bogeymen.

Case in point: Stuxnet. As you might recall, Stuxnet was a military-grade cyberweapon co-developed by the United States and Israel that specifically targeted Iran’s nuclear enrichment facility at Natanz. As we later learned, Stuxnet was only one part of a full-scale military cyberattack against Iran codenamed Nitro Zeus.

Yes, to the surprise of absolutely no one, the largest and costliest cyberweapon ever developed (or at least officially acknowledged) was not the product of an Al-CIA-da cyberterror group or even the dreaded “Russian hackers,” but the militaries of the US and Israel. Neither should it be surprising to learn that the intelligence agencies have crafted ways of making such cyberweapons appear to have been created by other entities, which is a functionality that is essential to any false flag attack.

We know, for example, that the CIA has already developed the Marble Framework, an anti-forensic tool that “might be used to disguise the CIA’s own hacks to appear as if they were Russian, Chinese, or from specific other countries.” In other words, the CIA has spent time and energy developing a way to pin the blame for its own cyberweapons on its enemies. Although the CIA obviously will not confirm why, how or even if Marble has been deployed in the past, there is no other explanation for its existence: it is a tool for enabling virtual false flag terrorism.

This is important because, exactly as the Patriot Act was already ready and waiting in the wings pre-9/11, so, too, is an “iPatriot Act” ready and waiting in the wings for a “cyber 9/11” to come along and justify its enactment

We do not have to speculate about this. It was confirmed by Harvard Law professor Lawrence Lessig at a conference in 2008. “I had dinner once with Richard Clarke at the table,” he told the audience at Fortune’s Brainstorm Tech conference in Half Moon Bay, California. “And I said, ‘Is there an equivalent to the Patriot Act — an iPatriot Act — just sitting, waiting for some substantial event? Just waiting for them to come have the excuse for radically changing the way the Internet works?’ And he said, ‘Of course there is’ — and I swear this is what he said — ‘and Vint Cerf is not going to like it very much.'”

Keep in mind that the Richard Clarke who told Lessig about the iPatriot Act is the same Richard Clarke who came out after the death of Michael Hastings to note that intelligence agencies have ways to remotely hijack cars, steer people to their deaths and disguise their tracks well enough to “get away with it.” Also keep in mind that Joe Biden likes to brag about having written the [regular] Patriot Act in 1994.

So what kinds of things might be contained in such an iPatriot Act? Once again, we don’t have to speculate. Various government officials have talked about their wish list for an internet clampdown in recent years.

  • In March of 2009, Senator Jay Rockefeller opined during a subcommittee hearing that the internet is proving to be such a threat to America’s national security that it would have been better if it had never existed.
  • In June of 2010, Senator Joe Lieberman stated that he believed the US needed the same ability to shut down the internet as China currently has.
  • Also in 2010, Microsoft Senior Advisor and Bilderberg attendee Craig Mundie called for the creation of a “World Health Organization for the internet” and suggested creating government-issued licenses to authorize internet usage.
  • In 2011, Bill Clinton advocated the idea that the US government create an agency for “fact-checking” websites on the internet.
  • In 2015, the National Institute of Standards and Technology (yes, that NIST) unveiled the “Trusted Identities Group,” part of a national strategy for standardizing online identification systems.

Given all of this, it is not hard to imagine how a cyberterror event may play out: A cataclysmic attack on the internet’s infrastructure massively disrupts people’s online lives for a period of days or weeks. Social media is inaccesible. Online banking and shopping is halted. All news and information during the internet blackout comes from the old, controlled dinosaur media. A shocked and distressed public learn that the Russians (or whatever bogeyman du jour is convenient) are being blamed for the attack. In order to prevent such a thing from reoccurring, emergency legislation is passed in the US (and, coincidentally, in all other Western nations) requiring proof of identity to use any and all internet services.

In one fell swoop, not only would the last vestiges of internet anonymity be eliminated, but a key part of the erection of the social credit control grid would be in place. Now, just like in China, all of your online activity would be tied directly to your social credit score. Lieberman must be wetting his pants in anticipation.

Of course, this is not to say that the internet as we’ve known it would be gone altogether if such a scenario were to play out. In a network that was literally designed to be accessible and usable in the wake of any cataclysm, even nuclear holocaust, there will always be alternative ways of getting online access. There will be pirate internet and mesh networks and dweb sites and peer-to-peer protocols like LBRY that will be accessible to anyone able and willing to put in the effort to learn about such technologies. But the Normie McNormieson we met in the imaginary tale at the beginning of this article would be forever cut off from the free and open internet of old. (Good thing we’re not Normie McNormieson, huh?)

As ever, it is important to know about these false flag possibilities so that when a spectacular cyberterror event takes place we are not railroaded into a phony solution that will serve only to increase the power and control of the real terrorists.  And, in the meantime, it is important to be researching and preparing ourselves for just such an event so that, regardless of whether it happens as predicted or not, we will be less dependent on the systems of control that are increasingly defining the normie internet.



This weekly editorial is part of The Corbett Report Subscriber newsletter.

To support The Corbett Report and to access the full newsletter, sign up to become a member of the website.




Attorney John J. Singleton: Strategies in Non-Compliance & Staying Open for Business During This Fake Pandemic

Attorney John J. Singleton: Strategies in Non-Compliance & Staying Open for Business During This Fake Pandemic

by John Singleton, PrivacyFight.com
November 28, 2020

 

” My message to you — if you’re a business owner, you have a profession, or a brick and mortar location — don’t be afraid. Don’t be afraid. Don’t comply. Be educated. Understand what you’re getting into. Understand that this whole thing is fake. But it’s designed to destroy you specifically. “

 

Original video (under the title “Your Business Avoiding Fake Pan de m ik — Make your Biz a Fortress” is available at John Singleton YouTube channel.

Explaining of how important it is to refuse to comply with these illegal policies as a business owner and the general strategy of how to respond to agencies and which important principles to use.

[As a service to protect truth from censorship & to share widely, mirrored copies of this video are available at Truth Comes to Light BitChute, Brighteon, Lbry/Odysee channels. All credit, along with our sincere thanks, goes to the original source of this video. Please follow links provided to support their work.]



See related by John J. Singleton: (Download PDF) How to Use an Injunction In or Out of Court RE M.a.s.k Wearing

 

Connect with John J. Singleton at PrivacyFight.com




NY Gym Owner Rips Up $15,000 Lockdown Fine On Live TV: “We Will Not Comply”

NY Gym Owner Rips Up $15,000 Lockdown Fine On Live TV: “We Will Not Comply”

by Tyler Durden, ZeroHedge
November 28, 2020

 

Submitted by Rusty Weiss of The Mental Recession,

Robby Dinero, the owner of Athletes Unleashed gym located in Orchard Park, New York, tore up a $15,000 fine from the Erie County Health Department during a live Fox News interview.

Dinero got hit with the extraordinarily hefty fine following a confrontation in which roughly 50 business owners attending a meeting inside the gym refused to allow a pair of sheriffs and a health inspector entry to the building without a warrant.

“They picked a fight with a Marine and a whole bunch of patriots,” the gym owner said in a separate interview with WBEN, before pointing out that “The Constitution protects those rights.”

New York Gym Owner Rips Up His Fine, Says He Will Not Comply

Dinero, speaking with Fox anchor Sandra Smith, reiterated that Governor Andrew Cuomo’s lockdown edicts infringe upon his rights.

The veteran, having pointed out Cuomo’s and Erie County Executive Mark C. Poloncarz six-figure taxpayer-funded salaries, challenged them to look their constituents’ children in the eyes and tell them their parents’ work is not “essential.”

The lockdown rules, he believes, deny citizens their Constitutional right to earn a living.

Dinero then ripped up the fine on camera while supporters behind waved American flags and shouted, “We will not comply.”

Confrontation With Business Owners and Authorities Goes Viral

Last week, Dinero held a meeting with business owners inside his gym. He explained that the meeting was a protest of New York’s regulations that have closed gyms, salons, and other businesses deemed nonessential.

Oddly enough, despite the state’s blind eye to riots under the guise of ‘protests’ over the summer, authorities took issue with this particular peaceful protest. Sheriffs and the health inspector showed up and things escalated as the business owners refused to let them on the property without a proper warrant.

“Get out! Get out!” they repeatedly yelled.

As the authorities leave, one protester can be heard shouting, “Take your Commie s*** elsewhere!”

Cuomo has been regulating everything in his state during the pandemic, from what time New Yorkers can eat in restaurants to what they can eat in restaurants, and on to what people can do in their own home. His constitutional overreach has prompted several sheriffs to refuse to enforce his orders.

Cuomo responded by calling any sheriff who refuses to enforce his edicts a “dictator.” He said that without a hint of irony.




The Strangely Unscientific Masking of America

The Strangely Unscientific Masking of America

by Jenin Younes, American Institute for Economic Research
November 27, 2020

 

I remember vividly the day, at the tail end of March, when facemasks suddenly became synonymous with morality: either one cared about the lives of others and donned a mask, or one was selfish and refused to do so. The shift occurred virtually overnight.

Only a day or two before, I had associated this attire solely with surgeons and people living in heavily polluted regions. Now, my friends’ favorite pastime during our weekly Zoom sessions was excoriating people for running or socializing without masks in Prospect Park. I was mystified by their certitude that bits of cloth were the only thing standing between us and mass death, particularly when mere weeks prior, the message from medical experts contradicted this new doctrine.

On February 29, the U.S. surgeon general infamously tweeted: “Seriously people – STOP BUYING MASKS. . . They are NOT effective in preventing general public from catching #Coronavirus.” Anthony Fauci, the best-known member of the coronavirus task force, advised Americans not to wear masks around this time. Similarly, in the earliest weeks of the pandemic, the CDC maintained that masks should be worn only by individuals who were symptomatic or caring for a sick person, a position that the WHO stood by even longer.

As rapidly as mask use became a matter of ethics, the issue transformed into a political one, exemplified by an article printed on March 27 in the New York Times, entitled “More Americans Should Probably Wear Masks for Protection.” The piece was heavy on fear-mongering and light on evidence.  While acknowledging that “[t]here is very little data showing that flat surgical masks, in particular, have a protective effect for the general public,” the author went on to argue that they “may be better than nothing,” and cited a couple of studies in which surgical masks ostensibly reduced influenza transmission rates.

One report reached its conclusion based on observations of a “dummy head attached to a breathing simulator.”  Another analyzed use of surgical masks on people experiencing at least two symptoms of acute respiratory illness. Incidentally, not one of these studies involved cloth masks or accounted for real-world mask usage (or misusage) among lay people, and none established efficacy of widespread mask-wearing by people not exhibiting symptoms.  There was simply no evidence whatsoever that healthy people ought to wear masks when going about their lives, especially outdoors.  Yet by April, to walk the streets of Brooklyn with one’s nose and mouth exposed evoked the sort of reaction that in February would have been reserved for the appearance of a machine gun.

In short order, the politicization intensified. President Trump refused to wear a mask relatively early on, so resistance to them was equated with support for him. By the same token, Democratic politicians across the board eagerly adopted the garb; accordingly, all good liberals were wearing masks religiously by the beginning of April. Likewise, left-leaning newspapers such as the New York Times and the Washington Post unequivocally promoted mask-wearing after that March 27 article, with no real analysis or consideration of opposing views and evidence.

The speed with which mask-wearing among the general public transitioned from unheard of to a moral necessity struck me as suspicious. After all, if the science was as airtight as those around me claimed, surely masks would have been recommended by January or February, not to mention during prior infectious disease outbreaks such as the 2009 swine flu. It seemed unlikely that the scientific proof became incontrovertible sometime between late February and late March, particularly in the absence of any new evidence surfacing during that time period.

Perhaps none of this is particularly surprising in this hyper-political era. What is shocking is the scientific community’s participation in subverting evidence that does not comport with the consensus. A prime example is the Institute of Health Metrics Evaluation’s (“IHME”) rather astounding claim, published in the journal Nature-Medicine and echoed in countless articles afterward, that the lives of 130,000 people could be saved with a nationwide mask mandate.

As my colleague Phil Magness pointed out in an op-ed in the Wall Street Journal, the IHME model was predicated upon faulty data:  it assumed that 49% of Americans were wearing masks based on a survey conducted between April and June, while claiming that statistic represented the number of Americans wearing masks as of September 21.  In fact, by the summer, around 80% of Americans were regularly wearing them.  (Ironically, had Dr. Fauci and the Surgeon General not bungled the message in March, mask use probably would have reached much higher rates much earlier on).

This called into question the accuracy of the 130,000 figure, since many more people habitually used masks than the study presumed.

Although Magness contacted Nature-Medicine to point out the problem, after stalling for nearly two weeks, the journal declined to address it.  Needless to say, the damage had been done:  newspapers such as the New York Times undoubtedly would fail to correct the error and any retractions certainly would be placed far from the front page, where the initial article touting the IHME figure appeared. Thus, as expected, the unfounded claim that 130,000 lives could be saved with a nationwide mask-mandate continues to be repeated, including by president-elect Joe Biden and National Institutes of Health Director Francis Collins.

That the science behind mask-wearing is questionable at best is further exemplified by a letter to the editor written in response to Magness’s article. Dr. Christopher Murray acknowledged that rates of mask-wearing have steadily increased, but then concluded that masks should be used because they are “our first line of defense against the pandemic” and current IHME modeling indicates that “if 95% of U.S. residents were to wear masks when leaving home, we could prevent the deaths of tens of thousands of Americans” because “masks work,” and “much deeper pain is ahead if we refuse to wear them.”

None of this accounts for the failure of either Nature-Medicine or the IHME modelers to recognize and correct the error.  Moreover, neither the IHME modelers nor Dr. Murray provide any evidence that masks work. They assume masks are extremely effective at preventing spread of the coronavirus, and then claim that the model is correct for that reason. This sort of circular reasoning is all-too typical of those who so vociferously insist that masks are effective without going to the trouble of substantiating that contention – or differentiating what is likely a modest benefit from mask-wearing in specific indoor locations and around high-risk individuals from the media-driven tendency to depict masks as a silver bullet for stopping the virus in all circumstances.

Coverage of a recent mask study conducted in Denmark likewise epitomizes the failure of the scientific community to rigorously engage with results that do not fit the prevailing masks-as-a-panacea narrative. The first randomized and controlled study of its kind (another appeared in May but it pertained to flu and had similar results), it found an absence of empirical evidence that masks provide protection to people wearing them, although it apparently did not assess whether they prevent infection of those who encounter the wearer.  The report was covered in a New York Times article bearing the patronizing headline, “A New Study Questions Whether Masks Protect Wearers. You Need to Wear Them Anyway.”

Noting that the results “conflict with those from a number of other studies,” primarily “laboratory examinations of the particles blocked by materials of various types,” the author remarked that, therefore, this research “is not likely to alter public health recommendations in the United States.” Notably, laboratory examinations, as opposed to the Danish study, do not account for the realities of everyday mask usage by non-medical professionals.

The author then quotes Susan Ellenberg, a biostatistician at the University of Pennsylvania, who claims that the study indicates a trend: “‘in the direction of benefit’ even if the results were not statistically significant. ‘Nothing in this study suggests . . . that it is useless to wear a mask,’” according to Dr. Ellenberg.

Nor does anything in this study suggest that it is useful to wear a mask, a fact that Dr. Ellenberg (and the headline) conveniently ignores. Furthermore, if a result is statistically insignificant, it should not be used to make the case for any proposition — as even I, a layperson, know.

Scientists ought to dispassionately analyze data that contradicts their biases and assumptions, and be open to changing their beliefs accordingly. That the results of the only randomized, controlled study were and continue to be automatically discounted demonstrates that, when it comes to the subject of masks, anything approximating the scientific method has gone out the window. That is all the more evident given the lack of interest that mask proponents have shown in conducting a randomized, controlled study themselves.

An article in the Los Angeles Times went even further: it twisted the findings of the Danish study to argue, incomprehensibly, that the research demonstrated more mask-wearing is warranted.  The author cited, as supposedly compelling evidence that masks work, the low Covid-19 death rates in Singapore, Vietnam, and Taiwan.  Indeed, according to the latest YouGov poll, administered in mid-November, 83% of Americans now wear masks in public, higher rates than Vietnam (77%) and Taiwan (82%).

Furthermore, there are other explanations, apart from widespread mask usage, for the remarkably low death rates in these countries.   Some scientists believe that previous exposure to other coronaviruses in these regions may confer partial or total immunity to SARS-CoV-2. Others have speculated that obesity, environment or genetics could be the reason that Europe and the United States have substantially higher death rates than many Asian and African countries; after all, obesity is one of the most significant risk factors for severe illness.

To conclude on the basis of low death rates in several countries that masks prevent coronavirus transmission is patently absurd, illogical, and unscientific. A casual observer might also note that coronavirus cases (albeit not necessarily deaths) are rising in many parts of the world, regardless of mask mandates or rates of implementation. While not a controlled experiment, this fact at least ought to be addressed when making such sweeping claims.

Ultimately, I do not have the credentials to determine whether or not –or to what extent — masks work. But it is obvious that the issue has become so politicized that mainstream media outlets, politicians, and even scientists seize upon the slightest bit of favorable evidence, dismiss out of hand anything that conflicts with their theory, and most egregiously of all misrepresent the data, to support the conclusion that masks worn by asymptomatic people prevent coronavirus transmission.

And masks are only one part of this story: school closures, lockdowns, and social distancing all have been dogmatically embraced as a means of controlling infection. The substantial evidence that these mechanisms are not effective, particularly beyond their duration, has been automatically rejected for too long. This is not science: it is politics, and those within the profession who have refused to examine their confirmation biases, or manipulated the evidence to score political points, are utterly unqualified for the job.

 



Jenin Younes is a public defender in New York City. She enjoys running, restaurants, and reading in her free time.

Connect with and get notified of new articles from Jenin Younes and AIER



Cashless Society: A Dystopian Sci-Fi Short Film

Cashless Society | Dystopian Sci-Fi Short Film 

by Zachary Denman
November 26, 2020

The Cashless Society was the step before the new world economy called the Global Credit System, which was all part of The Great Reset.

Cashless Society is the sixth part in the Sci-Fi Dystopian Short Film series, you can watch the other parts here:
The Great Reset: https://youtu.be/z2wj_OhZY4w
Police State: https://youtu.be/zSi0dAwYKos
Mandatory Vaccine: https://youtu.be/lP8yTtptW5M
Masked Agenda: https://youtu.be/R3qzxe2zTug
Track and Trace: https://youtu.be/OGGczyk9BL8

Written | Director | Camera | Editor | Music
Zachary Denman
http://www.zacharydenman.co.uk

Kain – Actor
George Bloomfield




Lockdown: The Dark Side of History | The White Coat Experiment of 2020

Lockdown: The Dark Side Of History
The White Coat Experiment of 2020

by Kate Wand, The Very Opinionated Kate Wand Show
November 28, 2020

 

Original video available at The Very Opinionated Kate Wand Show

[As a service to protect truth from censorship & to share widely, mirrored copies of this video are available at Truth Comes to Light BitChute, Brighteon, Lbry/Odysee channels. All credit, along with our sincere thanks, goes to the original source of this video. Please follow links provided to support their work.]

See Show Notes below transcript.



Transcript

 

The year 2020 has been exemplary for those that believe obedience is a high virtue.

The go-along-to-get along sentiment that began as a seemingly innocent response to an unknown viral enemy in late winter, began to take on a new tone by early spring.

Two weeks to flatten the curve in order to give hospitals a chance to organize for what was projected to be an overwhelming number of patients, turned into something more permanent.

Unprecedented lockdowns, heeded by the urgent warnings and pressure from China, were mimicked first in Italy, and then spread, like a plague, to the rest of the western world.

These draconian measures usurped the global population, as we were told that this was for the greater good, and the only way to end the restrictions was to obey the contradiction; to adhere to them at all costs, without exception.

Men of all ages and occupations, educations and backgrounds were recruited into the experiment.

Men in white coats stepped onto the podium, former strangers who did not bother to introduce themselves, but instead began by telling us to be comforted by their presence.

We assumed they were the experts.

We were soon divided into two groups, the teachers and the learners.

The teachers were given clear instructions by the Whitecoats as to what they needed to do next, but not before they were given a small taste of the punishment that those on the other side would receive. They were introduced to a small dose of pain that would stimulate in them the seed of fear, as to what could happen to them if they were to get it “wrong”.

They dutifully followed the instructions of the Whitecoats, and began to adjust to the strange experiment.

(IMAGES of the new normal, masks, etc)

It was hard to tell the teachers apart from the learners at first, since they had no prior reasons not to get along. But gradually, something began to change.

The teachers, like a good pupil, adhered closely to the words of the Whitecoats, and looked to them reassuringly to keep doing what they were doing. They proudly played their part, conforming to the rules and regulations set by the whitecoats.

They adapted to their new positions as educators to their counterparts, and continued to point out, with ever-increasingly painful punishments, when the learners said the wrong things.

The learners began to protest the injustice and the suffering. They wanted out of the experiment. They knew at this point, that there was nothing normal about it. Things had gone too far.

Some of the teachers wanted out too. They never wanted things to go this far, but they didn’t know how to get out of the situation they were in.

Despite knowing that something didn’t sit quite right with them, they still felt compelled to listen to instruction, and carry on obeying, in hopes that it would soon be over.

They deceived themselves into abdicating responsibility to the ones handing down orders. They lost sight of their individual choices in life, instead mindlessly doing as they were told, becoming complicit in the whole affair.

Becoming more emboldened with their unprecedented new reign of authority, and the consent of the majority, the Whitecoats pushed on harder. They kept the narrative going, imposing harsher conditions on all involved in the experiment, and encouraged the teachers to punish the learners if they continued to get it wrong.

At this point, the atrocious results of this experiment were impossible to ignore.

The learners began to protest more loudly, their suffering having become unbearable. They were fighting for their livelihoods, their freedom, their pulse.

But the louder their cries, the more their counterparts turned a blind eye. At this point, they had given up all responsibility for the outcome of their involvement, becoming completely submissive to authority as their fellow man’s cries became inaudible to them.

With the new normal affirmed by the consent of the majority, the Whitecoats successfully created a cognitive dissonance so strong in the population that they could no longer clearly see the difference between right and wrong. With a distorted sense of reality and loss of ownership over ones own identity, it was now easy to suggest that what was true yesterday, was no longer allowed to be remembered today.

With all of the old systems being replaced by the use of masks, social distancing, the new normal, bubbles, online classrooms, isolation and fear, snitching and social unrest, it would leave this traumatized control group reeling from something they did not sign up for.

What was happening to society? What was wrong with these people? How did things completely and inexorably fall apart in such a short amount of time?

Were the teachers evil? Were the learners deserving to be punished? Was there something wrong with either group? Or were they purposefully manipulated like puppets in order to play out a scenario that they were not psychologically prepared to handle?

The momentum of 2020’s psychological experiment combined with what Carl Jung might have referred to as the collective unconscious shadow of contemporary society, bring to mind a quote by Aleksandr Solzehnitzen, Nobel author of The Gulag Archipelago:

“If only there were evil people somewhere insidiously committing evil deeds, and it were necessary only to seperate them from the rest of us and destroy them. But the line dividing good and evil cuts through the heart of every human being, and who is willing to destroy a piece of his own heart?”

Is it possible that a malevolent authority could exist, not only in the history books, but in the very present times? Is it possible that you might not know what was actually going on, that you might have the wool pulled over your eyes, and that perhaps the trust in higher authority you took for granted might be wielded as a weapon against you?

Show Notes:

  • Milgrim Experiment: https://youtu.be/mOUEC5YXV8U
  • Maoist China: https://youtu.be/sXAOTjNheVg
  • Adamson BBQ: https://youtu.be/3wJUjr_Rn0s
    https://youtu.be/PDQzd5_xjiY
  • Pastor Henry’s fines: https://youtu.be/Z6hSisgD12c
  • The new normal back to school: https://youtu.be/HYo0oiHJSCE
  • Event 201: https://youtu.be/AoLw-Q8X174
  • Solzhenitsyn: https://youtu.be/yqpl6srevns
  • Fauci: https://youtu.be/v7am-CtOVB0
  • Tedros: https://youtu.be/1sRxfbzI19k
  • Man on train arrest: https://youtu.be/sfqJis0H4aM 
  • Devilla: https://youtu.be/vN4SEtv78d0
  • Fine: https://youtu.be/-0cuPMAhJEA
  • Violence: https://youtu.be/iXatarwVI7k
  • Drone: https://youtu.be/JbvWniXcNhA
  • Boris: https://youtu.be/3SlRnU2aMmA
  • Snitch: https://youtu.be/e1c8XdjIaM0
  • Humilation: https://youtu.be/AoFPz6GN9Gw
  • Victoria: https://youtu.be/39—Rf-aVA
  • Messa: https://youtu.be/vTe6M2C612Y
  • Shamer: https://youtu.be/TlXoAuU9xAE



What the Hasidim Tell Us About Being Americans

What the Hasidim Tell Us About Being Americans

by Mitchell Heller, MD, American Institute for Econmic Research
November 28, 2020

 

There’s an old joke (I first heard it in the 1960’s) about a Brooklyn Hasid who decides to take a bus trip to Florida. On the way, the bus makes a rest stop at a rural Georgia gas station/grocery store. The Hasid gets off the bus to stretch his legs and notices a group of “good old boys” intently staring at him. After a minute or two of this, the Hasid walks up to the group and says, “Vat’s da matta? You neva saw a Yankee before?”

On November 8, in defiance of New York City and State edicts, the Satmar Hasidim held a wedding attended by thousands of guests standing shoulder to shoulder in an indoor venue. The Hasidim went to unusual lengths to arrange the event without the authorities becoming aware of it. Invitations were by word of mouth only. Community newspapers cooperated by not publishing any advance notices.

After the fact, officials announced that they would levy a $15,000 fine on the wedding’s “organizers.” These “organizers” might well reply to those censorious officials, “What’s the matter? You’ve never seen Americans before?”

America was founded upon principles of human rights and liberty delineated in the Declaration of Independence. These rights include the right to assemble, to freely associate, to conduct commerce, and to practice one’s religion. The United States government was established by the Constitution, which attempts to codify the principles of the Declaration of Independence. Neither document specifies exceptions to human rights and liberty based on “science,” pandemic, or “emergency.”

Of course, we each have the right to be free of unknowing or unwanted exposure to deadly infectious disease carried by another but that does not deprive us of the right to associate with such carriers or potential carriers if we so choose. Nor do we have the right to restrict the rights of anyone who is not known to be a disease carrier, any more than we have the right to arbitrarily restrict the rights of anyone who might be a criminal.

The Hasidic movement was founded in the Ukraine in the 18th century. Hasidim have had more than two centuries of practice defying hateful, overreaching authority – Tsars, Cossacks, kings, emperors, dumas, dictators, and prime ministers. In historical memory they have seen and resisted and survived much worse than Andrew Cuomo and Bill de Blasio. This history of living according to their personal beliefs and civil disobedience in the face of rights-crushing authority is quintessentially American. It is little wonder that Hasidim, who came to America as an endangered species, have thrived and prospered in the U.S.

The Bill of Rights forbids the government to establish a religion. It’s too bad that there is no similar explicit ban on establishment of “science.” For too many Americans, “Science” has taken on the mantle of “established” truth worthy of legal enforcement that religion wore prior to the late 18th century. It is no accident then that “Science” has come to play the evil role, justifying state crimes, that “Religion” played in earlier times.

Indeed, the worst crimes of the 20th century were perpetrated by states in the name of “Science,” specifically “scientific” racism and eugenics. These crimes were committed in the U.S. and, even more horribly, in Europe. The views of today’s Hasidim toward government edicts guided by “Science” are strongly colored by the fact that millions of their ancestors were lawfully murdered in Europe by a government guided by that day’s “Science” of eugenics and racism.

It is no coincidence that today’s Hasidim will have none of it. Nor should they. Nor should we.

The principles of human rights and liberty proclaimed in the Declaration of Independence and (however imperfectly) codified in the Constitution are philosophical and moral principles, not scientific. The truth of human rights and liberty is “self-evident.” The truth of scientific inquiry is contingent, always subject to change based on new evidence. The contingent, empiric truth of science has no power to supersede the enduring, self-evident truth of human rights and liberty.

It is the philosophy of human rights and liberty applied consistently and equally to all that makes America America. If it takes Hasidim, who live according to ancient Biblical and Rabbinic law and 18th century Eastern European customs and fashion, and who may choose to ignore even the best scientific advice, the better to pursue their own happiness, to remind us of this, well, more power to them. L’Haim, to life!

Dr. Mitchell Heller is an Emergency Physician and student of liberty.



Dr. Mitchell Heller is an Emergency Physician and student of liberty.
Get notified of new articles from Mitchell Heller, MD and AIER.




There Is Foretelling of a Dark Winter: The Real Plan Is for a Dark Year, Dark Decade, and a Dark Century

There Is Foretelling of a Dark Winter: The Real Plan Is for a Dark Year, Dark Decade, and a Dark Century

by Gary D. Barnett
November 28, 2020

 

“All political institutions are manifestations and materializations of power; they petrify and decay as soon as the living power of the people ceases to uphold them.”

~ Hannah Arendt (1972). “Crises of the Republic: Lying in Politics; Civil Disobedience; On Violence; Thoughts on Politics and Revolution”, p.150, Houghton Mifflin Harcourt

It is apparent that for a long time plans to achieve a global takeover of humanity have been in the works. To accomplish such a lofty goal, it was necessary that through fear, the psychological takeover of the minds of the public would be pursued. Once such a mass mind control effort could be brought about and sustained against the majority of people, the “Great Reset” plot could go forward without much restriction. That is where we are today, but the agenda for the future is to keep society in the dark not for one winter, but for eternity. The tool being used for this effort is called a deadly ‘virus pandemic,’ but in truth, it is simply astounding propaganda based on a lie, a lie that is totally dependent on a weak, ignorant, and compliant populace.

“Dark Winter” refers to a purposely-staged event propagated by “Johns Hopkins Center for Civilian Biodefense Strategies, in collaboration with the Center for Strategic and International Studies, the Analytic Services Institute for Homeland Security, and the Oklahoma National Memorial Institute for the Prevention of Terrorism.” This was held as a senior-level simulation exercise meant to prepare the American population for planned coming events. Those events have been staged over the past 19 years, but are now actually being played out against all of us. This is no exercise, but reality. As I said in my May 18, 2020 article at Lew Rockwell titled “The Coronavirus ‘Dark Winter’ PSYOP: Question Everything and Do Not Comply With any Government Order:”

“The only real defense that is valid during this exercise in mass tyranny is total refusal to comply with any and all government mandates. We are in the midst of the largest psychological operation (PSYOP) in the history of mankind.”

“The newest term being targeted toward the masses is the coming of the “Dark Winter,” which is nothing more than propaganda based lies meant to prepare the sheep for a planned continuation and escalation of this fake pandemic in order to bring about world domination.”

It has been brutally obvious that this past winter brought much harm in the form of lockdowns, isolation, business closings, job loss, economic destruction, riots and property destruction, and medical martial law. That did not end however, after winter was over, as the political class under orders from their banking and corporate masters, continued on with many mandates, and claimed a second and even third phase would be evident soon. That should have opened the eyes of many to the lie about a ‘dark winter,’ because it was never meant to end. This winter will be but the beginning of continuous dark times, unless mass pushback and mass dissent are forthcoming. Once the American public accepts the plot for a ‘dark winter’ as legitimate, that darkness will be perpetual due to state propaganda and lies.

This is the most dangerous time in our history, as the state and its masters are close to being able to manipulate the people into believing that ‘normal’ is whatever the state claims is normal. Going back to normal ended months ago, and each and every day brings a new meaning to what we consider to be normal life. The people at large should control their own behavior and life choices, not a ruling class, but that notion has been turned upside down since the state ‘Covid’ conspiracy began. Resistance by whatever means necessary is essential if any normalcy is ever to be regained and continued. It could soon be too late to change this course we are on, at least by non-violent means. The longer this tyranny is allowed to expand in scope, the more difficult it will be to rectify.

There will be a ‘dark winter’ because the perpetrators of this fraudulent ‘virus pandemic’ have already made certain that this population has been sickened and weakened by these totalitarian lockdown and isolation measures and mandates. They have knowingly plotted to cause the destruction of the immune systems of the citizenry by their political actions. By forcing people to close their businesses, by ruling that economic activity was responsible for virus spread, thus eliminating millions upon millions of jobs, the stress and poverty created devastated this population, making them susceptible to sickness and death. Now, with another flu season upon us, many if not most of the people in this country are ripe for sickness and infection, and that purposely caused situation will be taken advantage of by the evil ruling and political classes in order to contain and control the entire country.

Once this advances to the next planned stage of this fraud, the ‘dark winter’ will become the dark spring, the dark summer, and then the dark fall; just in time for the next flu season. This is meant to be an ongoing operation, and will not end without great resistance by the people of this country. Never believe one word coming from the mouths of government or mainstream media, as those that control this country have no intention of ever allowing any normalcy again.

The so-call Covid vaccination that will be released very soon will be a deadly nail in the coffin of freedom, as body and mind changes due to any number of biological agents, messenger RNA, nanoparticles delivered through hydro gel injection, and poisonous man-made viruses and adjuvants, will have the ability to alter human health and behavior. Avoid these vaccines at all cost, because in my opinion, these will be meant to solidify control of the general population.

There will be many scare tactics coming in order to get those currently balking at a vaccine to accept it willingly, possibly including the targeted release of bio-weapon grade viruses. Be aware that this could easily be part of the plot against mankind, and do everything in your power to resist and fight back against these government monsters.

Sources: Herehereherehere, and here.

The Best of Gary D. Barnett

 

Connect with Gary D. Barnett at garydbarnett.com




Press for Truth: CTV News Edits Clip on Canada’s Death Count | Find Out What They’re Hiding

Press for Truth: CTV News Edits Clip on Canada’s Death Count | Find Out What They’re Hiding

by Dan Dicks, Press for Truth
November 27, 2020

 

CTV News edits clip to hide the real death count numbers.

Recently CTV News aired a clip that correctly pointed out the number of deaths attributed to Covid-19(84) in long term care facilities, in Canada there has been 10,947 Covid related deaths with an astonishing 10,781 of those deaths coming from old age homes which means only 166 deaths in all of Canada occurred outside of an old age home (with many of those people dying “with” Covid as opposed to “of” Covid.

In this video Dan Dicks of Press For Truth exposes CTV for covering up their Freudian slip as the truth was accidentally revealed in one of their segments than promptly deleted following a PFT expose!

Stay Up To Date With Dan Dicks of Press For Truth HERE ➜ https://pressfortruth.ca/press-for-truth-banned-on-youtube/

DONATE ➜ https://pressfortruth.ca/donate/




RFK, Jr. w/ Catherine Austin Fitts: The Financial Coup D’Etat Hidden Behind the “Covid” Crisis | Who Benefits? | Linking Tech Giants, Big Pharma, Big Banking, Government & the Missing Trillions

RFK, Jr. w/ Catherine Austin Fitts: The Financial Coup D’Etat Hidden Behind the “Covid” Crisis | Who Benefits? | Linking Tech Giants, Big Pharma, Big Banking, Government & the Missing Trillions

 

‘TRUTH’ With RFK, Jr. and Catherine Austin Fitts: How Wall Street Cashes in on Lockdowns

Robert F. Kennedy, Jr. interviews founder and president of the Solari Report, Catherine Austin Fitts, about the tremendous financial costs of the COVID crisis and who’s benefiting.

by Children’s Health Defense Team
November 27, 2020

 

In the latest episode of our second season of “TRUTH” with Robert F. Kennedy, Jr., Kennedy interviewed founder and president of the Solari Report, Catherine Austin Fitts. Fitts also served as assistant secretary of Housing and Federal Housing Commissioner at the U.S. Department of Housing and Urban Development in the first Bush administration. Kennedy and Fitts delved into the tremendous financial costs of the COVID crisis and took a look at who benefits in the current scenario.

Highlights of their conversation include:

Original video is available at Children’s Health Defense YouTube channel.

[As a service to protect truth from censorship & to share widely, mirrored copies of this video are available at Truth Comes to Light BitChute, Brighteon, Lbry/Odysee channels. All credit, along with our sincere thanks, goes to the original source of this video. Please follow links provided to support their work.]

All “Truth” episodes can be found on Children’s Health Defense’s social media, and on Children’s Health Defense’s channel found on Peeps TV, a network on Roku. Roku is accessible from any Smart TV and can be purchased separately for older TVs.




Rebellion Rising; the People Have Had Enough

Rebellion Rising; the People Have Had Enough

by Jon Rappoport, No More Fake News
November 27, 2020

 

Signs of the times—

Large anti-lockdown protests are sweeping across Europe. Denmark, France, Germany, Italy, the UK, Poland. The media are trying to put a lid on coverage of these momentous events.

In Southern California, five sheriffs of populous counties (17 million people) are refusing to enforce Governor Newsom’s new curfew order. A petition to recall the governor is gaining steam.

In New York, members of the Chasidic sect held a wedding attended by several thousand people, sitting closely packed without masks.

In a more intimate setting, up close and powerfully personal, gym members and owners in Buffalo, New York, shouted down cops and a public health officer, who had entered the gym because the gathering exceeded the prescribed limit. The gym personnel drove out the cops and followed them, to make sure they left the property.

In Buffalo, protestors came to the house of Erie County Executive, Mark Poloncarz, to express their anger at new lockdown restrictions. The protest was also aimed at New York Governor Andrew Cuomo.

Sheriffs in Fulton and Erie Counties (New York) are refusing to enforce Thanksgiving lockdowns which limit the number of people in private homes.

In various areas of England, police have warned government officials they’re “sitting on a time bomb,” because lockdown rules make it illegal for two or more families to gather together for Christmas—and law-enforcement personnel are permitted to invade homes where violations are occurring. The time bomb is, of course, huge numbers of outraged citizens.

In Australia, Qantas airline CEO Alan Joyce announced that travelers will be able to fly only after receiving the COVID vaccine, once it is approved. Soon afterwards, Joyce stood at a podium at an event to give a speech, and a grizzled Aussie walked up to him and shoved a pie in his face.

Two women saw New Jersey Governor Phil Murphy eating dinner at a restaurant with his family. He was maskless. “You’re such a dick!” one woman told him. Murphy has just extended his state’s lockdown, the ninth time he has done so since March. At his dinner table, Murphy tried to remain calm. He put on his mask.

Andrew Kudrick, the police chief of Howell Township in New Jersey, says he won’t enforce the governor’s “draconian” limit of 10 people for Thanksgiving dinners.

The CDC has told Americans to stay home for Thanksgiving. Last weekend, two million Americans boarded flights.

In a form of silent protest, 300,000 residents of New York have left the city since pandemic restrictions began.

It should be noted that, among the several hundred thousand (or more) Trump supporters who gathered in Washington DC, at a Stop The Steal rally, few people wore masks, and no one paid attention to social distancing regulations.

Across America, without fanfare, pockets of the economy are wide open—no masks, no distancing, no one is paying attention to government regulations.

The walls of lockdown fascism are cracking, in large ways and small. Actually, there is no small. Every act inspired by the fire of freedom counts.




In the Covid-19(84) Battle for Freedom, Canadian Small Business Invaded by 18 Cops & Owner Arrested

In the Covid-19(84) Battle for Freedom, Canadian Small Business Invaded by 18 Cops & Owner Arrested

by Dan Dicks, Press for Truth
November 26, 2020

 

Breaking: Adam Skelly Arrested, Adamson BBQ Has 50 Cops on Site, Lay 9 Charges, Change Locks!!! 

Adam Skelly, owner of Adamson Barbecue has been arrested after defying the lockdown orders that closed his business to in house dinning, approximately 18 police officers showed up with locksmiths (who changed the locks on his doors) and they led Skelly away in handcuffs in front of a large crowing crowd of supporters.

In this video Dan Dicks of Press For Truth covers the latest breaking news on Skelly’s arrest, what the charges are and also how you can help this brave freedom fighter moving forward.



See previous, related video:

COVID-19(84) Update: Adamson BBQ Defies Orders, Police Back Down and Refuse to Issue Fine!!!

Adam Skelly has the right idea and he needs our support! Skelly is the owner of Adamson Barbecue, a restaurant in Etobicoke Ontario who recently defied the lockdown orders by opening his restaurant to patrons for dinning in. In an Instagram post Adam explained “For those of you who have eyes to see why I’m doing this, thank you guys so much,” he said. “Thank you for letting me know that we have people in our corner….This is a risky move and you guys gave me the gas to do this.”

In this video Dan Dicks of Press For Truth covers the latest Covid-19(84) news as police are keeping a close eye on the now famous BBQ who dared to defy orders while also explaining why Adam Skelly is justified in doing what he’s doing because the numbers simply don’t add up when it comes to COVID-19(84)!

Go Fund Me account to support Adam Skelly

To follow this story, locate all contact links, and more, follow Press for Truth BitChute channel.




David Icke w/ Shaun Attwood: Love & Consciousness | “Love Will Always Do What It Knows to Be Right.” | “Love Does Not Consider Consequences.”

David Icke w/ Shaun Attwood: Love & Consciousness | “Love Will Always Do What It Knows to Be Right.” | “Love Does Not Consider Consequences.”

 

[The video below is a clip from an interview previously recorded and uploaded to Shaun Attwood’s YouTube channel on September 26, 2020.]

Excerpts — David Icke:

“You know what love is today to so many people? It’s anti-hate… Anti-hate is not love. It’s just another version of hate… That’s why the anti-haters have hate in their face when they’re demanding we stop hating.”

###

“That’s what evil is. It’s the absence of love. We need to infuse it back. And part of that love is to not think about consequences for expressing love and speaking the truth, but doing it because it’s right.
“Love will always do what it knows to be right. And love does not consider consequences — because to consider consequences is to consider the very possibility that you will not do what you know to be right because of consequences. Love will never do that. It does what it knows to be right. It speaks its truth and it stands up for what it believes in.
“It doesn’t consider consequences. It considers consequences inconsequential. And the more people do that, the more this world will change.
“And the more people consider consequences, and keep backing down the alleyway to the wall at the end, the more this world will become more extreme than it is now. It’s  our choice.”

The conversation includes a discussion of the deep deception involved in the “war on drugs” and the blocking of true healing, natural substances and information.


Love And Consciousness: David I

by Shaun Attwood
November 25, 2020


Watch the full Shaun Attwood with David Icke interview here:

The Conspiracy Researcher: David I | True Crime Podcast 33


Watch the 2nd interview here:

The Royal Family: David I Part 2 | True Crime Podcast 66


Connect with David Icke at davidicke.com and ickonic.com

Connect with Shaun Attwood at shaunattwood.com

 

Alternate source of Shaun Attwood’s videos —
Shaun Attwood channel at Brand New Tube: https://brandnewtube.com/@ShaunAttwood




The Happy Virus: My Thanksgiving With Hafiz, Walt Whitman & You

The Happy Virus: My Thanksgiving With Hafiz, Walt Whitman & You

by Kathleen Stilwell, Truth Comes to Light
November 26, 2020

 

I caught the happy virus last night
When I was out singing beneath the stars.
It is remarkably contagious –
So kiss me.

~ Hafiz, Persian poet & mystic,
‘The Subject Tonight is Love’, translated by Daniel Ladinsky

 

Today is Thanksgiving Day in America, our special day to gather with others and give thanks for our many blessings. We especially give thanks for our loved ones — our family, our closest friends, our connections throughout our communities.

Today, although you and I have never met, I give thanks for you and I send thanks to you.

Thank you for being here, for pursuing truth and sharing what you know, for choosing courage as you stand for love, and for holding your attention on the vision of freedom.

I wonder how many of us are alone today. And I wonder how many feel completely alone, even if spending the day surrounded by others. This is, indeed, a very strange world that we find ourselves in.

If you are alone, you are in good company. On this Thanksgiving Day I am alone and I’m certain many others who stumble upon this essay will also be alone.

I am 68 years old, a mother and grandmother, and I am alone.

I could be with family, but only if I cater to the fears of those who imagine themselves to be vulnerable. If I join the others, I must comply with social distancing and masking, and I must stay silent about this orchestrated death-wish being programmed into the minds of humanity and, subsequently, forced upon all of creation.

Thus, with silent tears, I had to decline this invitation to be with the ones I love.

I’m 68 years old, but I’m not “one of the vulnerable” as the narrative declares all of us  “seniors” to be. I’m quite strong and I will do whatever I can to protect the freedom of my loved ones (which includes you).

Like many, I’ve gone through times of  serious, mysterious illness (we are bombarded by unimaginable toxins and damaging frequencies). But I continue on, do trial and error experiments with nature’s remedies, and recover one more time.  Some of you know this drill very well.

There is sadness in my heart, but there is also deep peace and happiness. I have a strong knowing that, where “reality” is actually real — on the level of true power, consciousness, creativity and love — all is well, with wonders and miracles unfolding right here and right now.

Although it appears that “full spectrum dominance” is pushing to make this the end game, true love and freedom (which is our source) can never be dominated.

The “powers that be” can huff and puff all they like in this dimension. They can even attempt to kill us all. What they don’t understand is that, for eternal beings, fear of death is utter nonsense because we are part of a love that can never die.

How totally bizarre that billions of people are frozen in fear as they stare at an imaginary virus monster! This larger-than-life, computer-generated, spiked creature marched into our lives like the Stay Puft Marshmallow Man.

Many have yet to discover that this Covid Hoax Creature instantly disappears if we disengage from the devices that keep its image and the evolving, nightmarish fairy tale blasting into our awareness. We’ve always had the power to make it go away by simply refusing to obey its oft-repeated demand that we give it authority over us.

For what ails us today, we don’t need stronger leaders and we don’t need saviors.

When the death-breathing monsters come stomping into our minds, our homes and our towns, we don’t need comfort and protection. We need courage.

Of course, the truly vulnerable must be protected.  But the rest of us must find our comfort in knowing that we stand with truth. If we lose our physical lives, then we “die” knowing we lived well.

Whatever is going on with this covid insanity, a great “unlearning” and a great unveiling of truth is going on at the same time. We are learning that viruses are not living things that invade our bodies (as we were all taught by the “experts”) and we are also learning that contagious disease is just a myth.

What spreads disease is ignorance, toxic behaviors and lack of love. In that sense, disease can spread if we pass on destructive and deadly ideas and behaviors.

But courage is also contagious. Genuine care is contagious. All that resonates with love and freedom is highly contagious, and strengthens the voice of truth that called us to be here.

Either define the moment or the moment will define you.

~ Walt Whitman

On this Thanksgiving Day, let’s define our moments. Let’s write our own contagion stories and make an effort to spread them far and wide. Let’s be there for each other, reminding one another of who we really are and that, if we slip into fear, we are not seeing the complete picture.

Happiness, not in another place but this place…not for another hour, but this hour.

~ Walt Whitman

Let’s stand our ground in freedom and with courage, while we hold the Happy Virus in our hearts — singing and dancing beneath the stars.

How
Did the rose
Ever open its heart
And give to this world
All its
Beauty?

It felt the encouragement of light
Against its
Being,

Otherwise,
We all remain
Too
Frightened

 

~ Hafiz, Persian poet & mystic,
‘The Subject Tonight is Love’, translated by Daniel Ladinsky

 


This article may be freely shared, in full or in part, as long as the text is unaltered and full credit is given to the original author, Kathleen Stilwell.


cover image credit efes / pixabay




All Those Supporting Lockdowns and Compliance Have Blood on their Hands

All Those Supporting Lockdowns and Compliance Have Blood on their Hands

by Gary D. Barnett, GaryDBarnett.com
November 25, 2020

 

“Disobedience is the true foundation of liberty. The obedient must be slaves.”
~ Henry David Thoreau (2006). “Thoreau and the Art of Life: Precepts and Principles”, p.23, Heron Dance Press

There is one thing that is perfectly clear about this predicament we are in today concerning the tyrannical takeover of this country and the world by the controlling few. That is that the people of this country are their own worst enemy, and have no claim to the ‘victim’ argument, because all their problems are self-induced. Every order taken has been voluntary, and that idiotic behavior has led to disaster and death. The powerful have not used guns and bombs to gain the submission of the American people; the people simply did as they were instructed, down to destroying their livelihoods, harming their own families, hiding under their beds, wearing deadly masks, and allowing their lives to lose all meaning. Cowardice at this level is so pathetic as to border on insanity. What happened to this society to make the inhabitants act in such a pitiful and sorry manner? Is it simply fear? I think not, as real fear drives people to protect themselves, not voluntarily allow for their own slavery and death.

But there is much more to this mob reaction than meets the eye. Most of the people in this country not only comply with every single draconian mandate, but also demand that others do so as well. This means that most of the citizenry are not only destroying themselves, but also wish to inflict the same result on everyone else, especially those courageous dissenters with brain cells and the ability to see through this deception. This gives new meaning to the idea of the herd choosing ‘equality’ by wanting everyone to be slaves, so that they can continue to wallow and complain about their chosen lot in life while hoping for their rulers to save them by dominating them. What this exposes is that many of your neighbors are your enemy more so than any government. The people themselves are to blame for this travesty.

It is brutally obvious that this general population cannot see past a television screen locked on to CNN or Fox, and since both sides of the political spectrum believe almost identically, what chance is there of any awakening by large numbers of people? It seems that the ruling members of society have carte blanche in their efforts to complete this communistic and technocratic takeover, because not only is there little if any real resistance to autocratic rule, but the sheep are actually helping those that wish to control them. They have become the state, as they promote tyranny against all, and are willing to monitor and surveil their neighbors on behalf of the government. This country has become a breeding ground for state sponsored stooges. The term that “people are basically good” has been turned on its head!

The lockdowns alone are responsible for massive death and destruction, and are now being ramped up around this country and the world in gleeful anticipation of the coming flu season. The upcoming holidays will be used as fodder to blame all those who wish to be with family and friends for causing new outbreaks of a fake virus, this while the state’s favored donors like Walmart, Costco, Amazon, and many other claimed ‘essential’ businesses, will welcome millions into their stores while commoner’s businesses will be closed due to the bogus risk of spreading a fake virus. New orders, mandates, sanctions, and decrees are coming very soon, and any that wish to enjoy the holidays will be cursed for their selfish desires by the state and their neighbors as well.

The state and every single person supporting the state are fully responsible for all the carnage happening today. Massive poverty is upon us, as purposely-created food shortages are causing great havoc. Loss of income due to shutdowns is literally taking food out of the mouths of children worldwide. Government lockdowns have devastated most of this population, and caused job loss, destruction of livelihoods, and tremendous psychological damage. Suicides are completely out of control, and getting worse every day, all caused by the response to this false flag coup called Covid.

We are living in a time of madness, of murder, of brutality, of indifference, and of the planned destruction of this country and the human spirit. Those involved in this fraud should be held accountable, and this includes not only the self-claimed ‘elite’ controllers, but also the government at every level, and all those that are supporting or calling for lockdowns, mandated vaccines, or any isolation measures whatsoever.  Any defending, justifying, and assisting government in these efforts are promoting the deaths of millions of people around the world. Their blood is on your hands!

I will never forget those that are responsible for this carnage, or any citizen that assists the state in its efforts to destroy humanity. As children starve, as suicide explodes, as poverty consumes the world, as poisons are forcibly injected into the innocent, as economies are purposely decimated, and as millions die, those that are responsible, those that assist and support this travesty, and those that stand silent, are all to blame, and are guilty of allowing murder, genocide, and abomination. The depth of this evil is limitless.

What manner of human is this?


Sources:

What NO ONE is Saying About The Lockdowns by James Corbett

The Best of Gary D. Barnett




Jon Rappoport: Open Letter to Patriots Everywhere | LIVE FREE

Open Letter to Patriots Everywhere | LIVE FREE

by Jon Rappoport, No More Fake News
November 25, 2020

 

In the modern secular church of fakers, they tell us anger is wrong, outrage is wrong, acceptance in hypnotic sleep is what we must aim for.

Always bow to “smooth transitions.” When there is disagreement, swallow your bile, give in, make peace with tyranny. The pain will only last for a little while. Then you will reach a higher understanding.

The authorities and their minions of the press have the final word. Our job is to fit ourselves into their scheme of things.

WE must be flexible. THEY can be inflexible.

If these rules seem backwards and upside down, that is OUR problem, not THEIRS.

This is the position of our would-be masters.

I realize your attention is focused on the election and vote-fraud right now. But I want to comment on the disaster we’re all facing these days:

The COVID restrictions. Lockdowns—de facto in-house arrest. Limits on public gatherings. Economic devastation.

Cutting to the bottom line: There is NO state of emergency that justifies sweeping away Americans’ basic freedoms. No war, natural or manmade disaster.

NO emergency can override the meaning and spirit of the Constitution.

There is a line that can’t be crossed for any reason. Otherwise, an official or legislature or court could, armed with an excuse, cancel the Constitution.

That’s exactly what’s happened. COVID. It’s diabolically clever, because officials will say: “You can’t make a choice about how to live your life, because what you do affects other people. If you carry the virus and live out in the open, you’ll infect those around you. Therefore, you must obey the commands we lay down…”

You must agree to in-house arrest, if a gangster governor deems it necessary. You can’t go to church. Your children can’t go to school. You have to shut down your business. You can’t earn a living. You need to go on the public dole.

The infernal logic of this is inescapable, once you allow the crossing of the Constitutional line. Then, freedom is gone. The United States is gone.

I’ve spent the past nine months proving that COVID is a medical and scientific fraud. There is no emergency or great danger. But even if there were, that bright line from freedom to slavery cannot be breached. Or we all go down.

Instead, we have to rise up. We have to live life, work, move forward. WE HAVE TO OPEN UP THE ECONOMY OURSELVES, every which way we can, regardless of orders from governments—federal, state, or local.

Protests? Yes. But more than that, we go back to work.

All over this country, we stand on our natural and Constitutional freedoms. We don’t give in.

Our government is based on the consent of the governed. WE decide. We aren’t property of the State. We aren’t products shaped by the State. We weren’t born to be medical patients all our lives.

No one said this would be easy. We aren’t living in easy times. It does no good to park ourselves in a swamp of complaining about what should be and spin our wheels.

Again: WE OPEN UP THE ECONOMY EVERY WHICH WAY WE CAN. We FIND a way. We barter and trade, if necessary. I’m told that, during the Depression of the 1930s, local citizens in America created 3000 currencies. Their own forms of money.

It’s an option. There are many options, if people think and plan. Right now (and I receive reports), there are pockets all over the country where the economy is wide open. People are ignoring government mandates. And they’re not wearing masks or distancing.

What about the political Left? They seem to want the COVID restrictions. They want to obey political dictates. They are willing to submit to governors’ edicts. They bow down and believe and accept the statements of public health officials as if they were written in stone.

What was written in stone, with a war just past, was the Constitution. And that law of the land has remained visible, despite all attempts to erase it.

“The summer soldier and the sunshine patriot will, in this crisis, shrink from the service of their country; but he that stands by it now, deserves the love and thanks of man and woman.” Thomas Paine, 1776.

Should we be sidetracked and tricked and bedeviled now, by these politicians and their official experts, we will find ourselves in a new world not of our making; surely not a world matching our desires.

Instead, we will be nothing more than units and numbers, organized to fit into slots, our labor harvested for purposes beyond our control, in a new normal no free human can tolerate.

We are being told to walk on a road that leads to that place.

As strong as the State seems, this is an illusion, because if enough of us refuse—millions of us—we will win. The State and its machinations will be exposed as just another tyranny, in a long line of tyrannies that fell and failed.

Be free. Live free. If there is Rescue From Above, isn’t it possible the Rescue is waiting to see, first, whether we show the courage that signals we will use that help?

Whether you believe the COVID operation was designed to wreak economic destruction, or whether the devastation was an offshoot managed and directed by lunatic politicians, the effect is the same—and the giant X painted across the Constitution is apparent to those who can see. We are living in a post-Constitutional America. That has been the case for a long time, but the violations are so egregious now, no one who is a patriot can look away without betraying his principles.

We are in a tunnel. We are carrying the light. Around us are sheep and doomsayers and hostile actors. They have redefined freedom in Orwellian terms to mean obedience. They now see privation and isolation as consecrations to a new cause: allegiance to a phantom germ.

That America could be brought down in such a preposterous way is evidence of how far this country has traveled from its origins. Its founding ideas.

Our enemies want to destroy those ideas. They attack them from all sides. They say justice never existed here, and they will bring it about now.

But all they know is destruction.

We will outflank them if we have the will.

So let us have the will.

“There is danger from all men. The only maxim of a free government ought to be to trust no man living with power to endanger the public liberty.” John Adams, 1772.

The night appears long, but we can end it.

We are the cure.

This is the war.




Attorney Dr. Reiner Fuellmich: 1st of Many Lawsuits Has Been Filed to Attack Use of PCR Tests Which Are the Cornerstone of “Crimes Against Humanity” Crisis

Attorney Dr. Reiner Fuellmich: 1st of Many Lawsuits Has Been Filed to Attack Use of PCR Tests Which Are the Cornerstone of “Crimes Against Humanity” Crisis

by Dr. Reiner Fuellmich
November 25, 2020
this is an excerpt from Ben Swann’s RT podcast

 

Original video is available at Dr. Reiner Fuellmich YouTube channel.

[As a service to protect truth from censorship & to share widely, mirrored copies of this video are available at Truth Comes to Light BitChute, Brighteon, Lbry/Odysee channels. All credit, along with our sincere thanks, goes to the original source of this video. Please follow links provided to support their work.]




Thousands of Guests Attend Secret New York City Wedding in Defiance of Coronavirus Crackdown

Thousands of Guests Attend Secret New York City Wedding in Defiance of Coronavirus Crackdown

by Adam Dick, Ron Paul Institute
November 24, 2020

 

Some state and local governments in America have, in purported efforts to counter coronavirus, become in significant ways like communist countries suppressing religious activities while promoting certain favored large-scale political demonstrations. New York City has been a prime example of this development with Mayor Bill de Blasio praising select demonstrations in the streets while shutting down religious assemblies.

Thousands of individuals defied the suppression of religious assemblies in New York City on November 8 by attending a wedding. At the wedding held at a synagogue there also appears to have been widespread disregard for government mask wearing and “social distancing” mandates. In a Saturday New York Post article, Susan Edelman tells the fascinating story, reminiscent of brave defiance to government dictates in communist China and the Soviet Union, of how the wedding was arranged and carried out in secret.

The story of the secret wedding is inspiring in its demonstration of people’s commitment to continue to live their lives normally despite government efforts to impose a dystopian “new normal” world. At the same time, the story is depressing in its demonstration of the tyranny that has taken hold in much of America in the name of countering coronavirus that poses little risk of death or serious sickness for most people.

As in communist countries, the disclosure of the forbidden religious assembly has led to condemnation and punishment. New York Post articles detail some of the state and local government actions that have taken place in response to the wedding. On Sunday, New York Governor Andrew Cuomo condemned the wedding as both “disrespectful to the people of New York” and “a blatant disregard of the law.” He also called on New York City to conduct a “robust investigation” of the wedding and for the “full consequences of legal action” to be imposed for law violations. On Monday, de Blasio said a 15,000 dollars fine would be imposed on the synagogue that hosted the wedding and stated “there could be additional consequences quite soon as well.”




Will The Shots Be Mandatory?

Will The Shots Be Mandatory?

by Jefferey Jaxen, The HighWire
November 24, 2020

 

Throughout the coronavirus response, those within ‘official’ positions around the world have chimed in on the idea of a mandatory Covid shot. Their hopes and potential future plans have been all over the board causing apprehension and confusion within the public. Whether you want the eventual shot, being rushed through emergency use authorization, or not, answers have not been clear.

In what has been a growing trend in political, and now health reporting, shadowy anonymous sources have driven headlines and news cycles. Always framed as ‘for their protection,’ yet ignoring accuracy or ability to verify their prognostications, the vaccine narrative hasn’t escaped it.

CNBC is now reporting that “The Food and Drug Administration has asked a group of advisors to set aside three days in early December for potential meetings to discuss Covid-19 vaccines…according to two people familiar with the plans. The advisory group may be asked to weigh in on Pfizer and Moderna’s vaccines, said the people, who asked not to be named because the plans aren’t yet public.”

Biden gave his answers in October during an ABC News Town Hall saying “we should be thinking about making it mandatory.” When asked how he would enforce that, Biden appeared to describe a scenario where he would ask Governors and mayors to execute the mandates.

Anyone paying attention to the last few years of American legislation sweeping across states [originally justified due to a measles outbreak] will easily see how such mandates will roll out. They will take the form of coercion by law, threatening to take away anything from access to school [for children] and daycare all the way to unemployment benefits for adults. Meanwhile, grocery stores, travel, and concert venues have already signaled they are open to denying access unless proof of vaccination is shown.

Frontline workers are being targeted for the first round of the Covid shots. It will be no surprise if hospitals treat their previously celebrated frontline heroes like subhuman rule-violators if they refuse the experimental shot.

Tests cases have already proven themselves in thorough court settings when it came to mandatory flu shots for healthcare workers. The “vaccinate or mask” policy was ruled unreasonable and called “a coercive tool” instead of a protective health policy in a case brought against the Sault Area Hospital in Sault Ste. Marie.

Nevertheless, the medical community, whose aggressively protected dictum of lauding the safety and efficacy of vaccination when doling them out to kids, are now suddenly questioning the coming shots they’ll be coerced into taking. Or through the lens of the mainstream media’s open discriminatory stance, the medical community has turned into ‘anti-vaxxers.’

A Facebook group titled NHS Workers for Choice, No Restrictions for Declining a Vaccine insist they are not an anti-vaccine – but that didn’t stop the media from calling them names. The group was made up of “hundreds of NHS staff” including “a GP, several A&E nurses, healthcare assistants, lab workers, and care home staff” according to the Daily Star hit piece.

Meanwhile, here in the U.S. the Washington Post spins their coverage a little gentler with its piece titled Doctors and nurses want more data before championing vaccines to end the pandemic. WaPo writes of a propaganda push when describing “Large health systems, medical societies and the federal government are launching an effort to persuade front-line health-care providers to take novel vaccines.”

The endless hype surrounding the endpoint data from Pfizer, Moderna and AstraZeneca’s shot is not thorough at this stage, published in peer-reviewed journals or even transparent for the public to access. It’s from simple science by press release public relations statements. In addition, the data being submitted for Emergency Use Authorization to the FDA is often resting on a small number of the total participants involved in the trials.

Speaking to the matter, vaccine safety scientist and infectious diseases physician Rebecca Chandler wrote:

“Perhaps watching a scientific community praise and promote vaccines based on press releases rather than review of data may actually promote vaccine skepticism.”

The hesitancy among doctors and nurses is not the same as the anti-vaccine movement, writes the WaPo who appear to be correct. Traditionally, what the media labels ‘anti-vaxxers’ were parents who were ‘pro-vax’ until experiencing an injury in their child after following recommended schedules put forth by officials. In juxtaposition, the WaPo writes of New Jersey State doctors “Among professionals contacted by the state, “some did not want to be in the first round, so they could wait and see if there are potential side effects,” New Jersey Health Commissioner Judith M. Persichilli said at a Nov. 9 news briefing. Of those who said they would not take the vaccine, many said they would be more than willing to get the vaccine at a later date, when more data is available,” she said.” It appears those doctors are going to wait around and see if the people they inject will show adverse reactions before deciding to take the shot themselves.

A survey of 609 healthcare workers in Los Angeles found respondents reported unwillingness to participate in a coronavirus vaccine trial, with 66.5% intending to delay vaccination.

Over the last month, headlines abound intending to shape the public narrative around the coming Covid shot. Global News Canada asks A coronavirus vaccine is almost ready. But will you take it? Forbes tells you What The Public Thinks About Mandatory Covid-19 Vaccinations. 

Some within government are already taking counter-actions.Florida state Rep. Anthony Sabatini took to Twitter writing:

Florida Gov. DeSantis stated regarding the hyped press releases from Covid vaccine-makers hype, “I do believe that these breakthroughs represent probably the greatest rays of hope that we have seen since the pandemic began,”

Gov. DeSantis stated that Florida residents will not be mandated to take either vaccine.

While states are also now chiming in about how they will handle getting the shot into the arms of their residents. Law.com writes, “The New York State Bar Association on Saturday passed a resolution urging the state to consider making it mandatory for all New Yorkers to undergo COVID-19 vaccination when a vaccine becomes available, even if people object to it for “religious, philosophical or personal reasons.

Regarding the kids, government contractor Dr. Moncef Slaoui said in a recent interview, “the plan is to run trials at an expedited pace over the coming months, first with younger adolescents, then toddlers, and, finally, infants. If that goes well, Slaoui, expects most kids will be able to get vaccinated by the middle of next year.” writes Yahoo news.

The final word is that of Dr. Michael Yeadon, who holds a degree in Biochemistry & Toxicology & a research-based PhD in pharmacology. Dr. Yeadon spent 32 years working in pharmaceutical R&D and was a VP at Pfizer. He posted this letter to Twitter,

Whatever one’s views are about political management of the pandemic in [the] U.K., we believe strongly that mandated or coerced use in the wider population of part-developed vaccines should play no role whatsoever in recovering from it. 

Those at distinctly elevated risk of severe illness & death, of course should be offered it, using fully informed consent. But absolutely not mandated or coerced vaccination. We so argue this, because it’s illegal and unethical. It might be countered that this letter is superfluous because no one is suggesting it. Sadly, that isn’t true. On the contrary, senior figures from governments across the world are proposing exactly this. Leading U.K. politicians have worryingly even said that “our national policy now is to suppress the virus as much as possible until a vaccine becomes available.

Despite any promises of a non-coercive Covid shot, the government’s apparatus for ramming through all sorts of legislation to eliminate any barrier hindering injectable pharmaceutical product lines making their way into your body is well-established over the last few years. Starting with a measles outbreak in 2019, nearly 200 bills suddenly appeared, as if waiting for the right moment. It was clear it wasn’t about measles then, and perhaps in a short time, we may discover there may be more to this new vaccine push than simply attempting to stop a cold virus or save lives – a primary endpoint that the Covid trials weren’t even designed for in the first place.

 

Connect with Jefferey Jaxen at The HighWire




Covid-19 Is a Hoax Leading to the Centralization of Control: “The Great Reset” Is the Real Pandemic

Covid-19 Is a Hoax Leading to the Centralization of Control: “The Great Reset” Is the Real Pandemic

by Gary D. Barnett
November 24, 2020

 

“Every time I hear a political speech or I read those of our leaders, I am horrified at having, for years, heard nothing which sounded human. It is always the same words telling the same lies. And the fact that men accept this, that the people’s anger has not destroyed these hollow clowns, strikes me as proof that men attribute no importance to the way they are governed; that they gamble – yes, gamble – with a whole part of their life and their so called ‘vital’ interests.”
 ~ Albert Camus (1978). “Notebooks, 1935-1942”, Harcourt

Is it any wonder that the entirety of our current predicament rests on the lies of the governing system and its ruling accomplices? American governance, all governance in fact, is and has always been susceptible to seeking power and control by means that prove very harmful to the general population. Conspiracy is always evident, and has led to abuses that have included theft, war, killing, imprisonment, torture, and in many cases genocide. In the U.S. today during this false flag event called a ‘virus pandemic,’ we have already seen massive theft in the form of multi-trillion dollar money printing, imprisonment of much of the country through lockdown and isolation mandates, killing of the old and innocent through criminal medical care or lack of medical care, medical martial law, and torture in that many died horrible deaths due to state regulations and procedures. This is a war, but in this case the war is openly being waged against the American public by the very government that most support. Americans have voluntarily allowed its existence, and this is a travesty.

What is likely unknown to most is that this nightmare is just beginning, while the average citizen is still thinking about or hoping for a return to ‘normal.’ Hope and prayer without action will accomplish nothing, but little if any mass dissent and disobedience are evident at this time. The reinstating and acceleration of the tyrannical measures we have seen to date are just around the corner, and with the ‘perfect storm’ of a very weak and unhealthy society with highly compromised immune systems, during what will probably prove to be an especially severe flu season, the sickness and death will all be blamed on a virus that has never been shown to exist. This is astounding, because this information is readily available for any that choose to see, but mass blindness seems to be a real risk we face today. This public blindness is due to ignorance and indifference, and that combination is a recipe for disaster.

There are many agendas being pursued by the self-claimed elites, but the core element of this takeover of society is based on centralizing all power in the hands of the few so that the masses and the world economy can be controlled from the top. This has always been about power and control, and has never been about any risk due to any virus. The fact that no such thing as ‘Covid-19’ has ever been isolated or identified, is staggering to say the least, but this ruse has been fully accepted by the herd, so much so that their very lives and livelihoods have been purposely destroyed due to voluntary compliance. Most have concentrated on being obedient slaves, while becoming fearful of their own family, friends, and neighbors in order to protect themselves from a ‘deadly virus’ that according to the perpetrators of this fraud has a stated survival rate of over 99.8%. In other words, there is no virus threat.

This conspiracy has but one main goal, and that is securing the centralization of power and control over all people and economies in order to achieve global dominance. It is being labeled as ‘The Great Reset,” as described by the very evil Klaus Schwab who is the founder and Executive Chairman of the World Economic Forum. He is tied to Bill Gates, George Soros, and the rest of these inhuman monsters. His and the ruling class ‘elites’ plans for our future are ominous, and currently being accepting by the bulk of this pathetic society. Here are some of his predictions for 2030, which include the United States surrender to the United Nations:

  1. “You’ll own nothing” — And “you’ll be happy about it.”
  2. “The U.S. won’t be the world’s leading superpower”
  3. “You won’t die waiting for an organ donor” — They will be made by 3D printers
  4. “You’ll eat much less meat” — Meat will be “an occasional treat, not a staple, for the good of the environment and our health.”
  5. “A billion people will be displaced by climate change” – Soros’ Open Borders
  6. “Polluters will have to pay to emit carbon dioxide” – “There will be a global price on carbon. This will help make fossil fuels history”
  7. “You could be preparing to go to Mars” — Scientists “will have worked out how to keep you healthy in space.”
  8. “Western values will have been tested to the breaking point.” – “Checks and balances that underpin our democracies must not be forgotten

He is also a proponent of transhumanism, and has said that nothing will ever return to the ‘broken’ sense of normalcy that prevailed prior to the crisis because the “coronavirus pandemic marks a fundamental inflection point in our global trajectory.” Schwab stated this even though admitting that: “Unlike certain past epidemics, COVID-19 doesn’t pose a new existential threat.” Covid-19 never existed, and never was a threat, but has been the tool used to advance a new world order, or as he calls it, the “Fourth Industrial Revolution.”

Concerning the melding of machines and humans, transhumanism, Schwab spells it out in more detail in Shaping the Future of the Fourth Industrial Revolution:”

Fourth Industrial Revolution technologies will not stop at becoming part of the physical world around us—they will become part of us. Indeed, some of us already feel that our smartphones have become an extension of ourselves. Today’s external devices—from wearable computers to virtual reality headsets—will almost certainly become implantable in our bodies and brains. Exoskeletons and prosthetics will increase our physical power, while advances in neurotechnology enhance our cognitive abilities. We will become better able to manipulate our own genes, and those of our children. These developments raise profound questions: Where do we draw the line between human and machine? What does it mean to be human?

“We the people” are not a part of this agenda, and are not included in this planning of a new society. We are simply the cattle being prodded and used to sustain the masters. The public makes no decisions, as this plot for gaining technocratic control over all of us has been in the works for many years, but is now going forward at an unimaginable pace, all due to the Covid lie. Everything was planned long ago in secret, but now is being completed and telegraphed out in the open for all to see. This is due to the fact that these manipulating rulers have no fear of the people at large, and believe them too lazy and ignorant to grasp the scope of this totalitarian takeover. Schwab admits this when he writes:

“We must re-establish a dialogue among all stakeholders to ensure mutual understanding that further builds a culture of trust among regulators, non-governmental organizations, professionals and scientists. The public must also be considered, because it must participate in the democratic shaping of biotechnological developments that affect society, individuals and cultures.”

This fake pandemic has supplied what the ruling class calls an opportunity for a reset of society. When the chosen masters call what they claim to be a deadly risk to all mankind an opportunity, one should stand up and take notice, and should immediately understand that we are all the victims of a terrible coup meant to enslave humanity.

Lockdowns, isolation, masks, economic destruction, digitized monetary restructuring, deadly vaccines, gene-controlling technology, transhuman experimentation, total surveillance, and a totalitarian police state are what the masters you have chosen want for all Americans. They are blatantly claiming that this is the new normal they have chosen for you, but you have a choice. Accept all you are being told and become a slave, or realize that the only pandemic is this claimed “Great Reset” that is being used to eradicate you. Acceptance can only lead to hell in a world consumed by evil.

Source links:

https://www.lewrockwell.com/2020/10/jon-rappoport/the-smoking-gun-where-is-the-coronavirus-the-cdc-says-it-isnt-available/

https://www.armstrongeconomics.com/world-news/conspiracy/klaus-schwab-says-you-will-own-nothing-in-10-years/

https://off-guardian.org/2020/10/12/klaus-schwab-his-great-fascist-reset/

https://thenewamerican.com/world-economic-forum-founder-claims-world-will-never-return-to-normal/

The Best of Gary D. Barnett

 

Connect with Gary D. Barnett




Mainstream Media Silent on Denmark’s “Nine Day Pots and Pans Protest”

Mainstream Media Silent on Denmark’s “Nine Day Pots and Pans Protest”

by Anne Dachel, Age of Austism
November 20, 2020

 

This is a good example of the power of the people and also the power of the media because I haven’t heard anything about this, not through the unusual news channels or even the alternative news channels.

At this moment there is literally nothing about what’s just happened in Denmark:

The government in Denmark had proposed a new epidemic law which was not going to be temporary.

Just to give a brief summary, this new law, it included:

ONE, people infected can be forcibly given medical examination, hospitalized, treated and placed on isolation.

TWO, government would be able to define groups of people who must be vaccinated.

THREE, people who refused the above can be coerced through physical detainment.

Yes, this was the new law that they were proposing to bring in, but Denmark had been protesting for the last nine days because of this law.

And after nine days of the protest, this law has now been abandoned. Apparently Denmark had been protesting en masse with pots and pans outside their parliament.

Now this is not mentioned anywhere.

I found just two clips from all of this to show you, and it doesn’t surprise me that the media are trying to block this out because it just doesn’t follow their narrative.

It shows that if you collectively say no, then you can get them to change their minds, to get them to step back.

And there being absolutely no mention of this anywhere in the mainstream media in any country as far as I can see, nothing about the nine day pots and pans protest and nothing on the back down .

For anyone who still thinks there is nothing strange going on, don’t you think this deafening silence is unusual? …

Gript News: Forced Vaccination Law in Denmark Reportedly Dropped After Widespread Protests   (SEE VIDEOS)

Nov 19, 2020, Epoch Times: Denmark Citizens Refuse Law Mandating Forced COVID-19 Vaccine

https://www.theepochtimes.com/denmark-citizens-refuse-law-mandating-forced-covid-19-vaccine_3585260.html

With a COVID-19 vaccine possibly rolling out to the public by December or early next year, some governments are pushing for a mandatory vaccine program, as in Denmark where it was met with protests.

The national government in Denmark had to abandon a new law that would require a mandatory COVID-19 vaccine after Danish citizens took to the streets to protest by banging on pots and pans against an updated Epidemic Act (pdf) that gave the government an unprecedented amount of power to implement rules and extreme measures to fight against the CCP (Chinese Communist Party) virus pandemic.

The new Epidemic Act would replace the temporary amended law (pdf) that was unanimously and quickly passed back on March 12 in response to the pandemic. At that time, one of the major revisions made involved transferring all the authority from the five regional Epidemic Commissions around the country to the Danish Minister of Health to allow for a quicker response to COVID-19.

But this gave a lot of power to the minister of health who is able to “access a person’s home with the police assistance without prior court order,” and “use police assistance to isolate, examine or treat a person who is infected or believed to be infected with one of the communicable diseases listed in the appendix to the Act,” according to a blog by Janne Rothmar Herrmann a professor of the University of Copenhagen.

The minister of health through a Ministerial Order was also able to limit the gathering of more than 10 people at indoor or outdoor public spaces except for “political meetings/protests, supermarkets, and places of work, etc.”

The new Act would continue keeping the centralized powers with the Danish Minister of Health that was passed in March, with the addition of allowing forced COVID-19 vaccinations as the Danish Health Authority can define “who must be vaccinated to contain and eliminate a dangerous disease.” Compliance with these orders can be achieved with police assistance.

Both the Danish Medical Association and the Danish College of General Practitioners spoke out against the new law saying “mandatory vaccination should be an ‘absolute last resort’” and that it gave too much power to the government, particularly the minister of health, over people’s healthcare, according to The Local.

The nine consecutive days of protest to the new law—broke away from the high level of trust Nordic countries are known to have with their government—resulted in the Danish government scrapping the law.

As the protest was just beginning in Denmark, the New York State Bar Association (NYSBA) approved a resolution (pdf) on Nov. 7, asking the state to consider making a COVID-19 vaccine mandatory for all New Yorkers except those medically exempted “once a scientific consensus emerges that it is safe, effective, and necessary,” but only after voluntary vaccinations failed to illicit a sufficient level of herd immunity to keep the public safe….

In Israel, the Health Minister is considering a mandatory COVID-19 vaccine law to address a percentage of Israelis unwilling to vaccinate, although the country has one of the highest immunization rates, according to The Jerusalem Post….

With claims of their trials being over 90 percent effective against the CCP virus by Moderna and Pfizer, and after an emergency authorization usage is granted by the U.S. Food and Drug Association’s (FDA) for the public, it will be a matter of time before more states and businesses may mandate Americans to get a vaccine.

“With polls showing that about half of Americans either do not want to get a new COVID-19 vaccine or have reservations about getting vaccinated, there will be those who want societal sanctions to be levied against those who refuse to take it,” Barbara Loe Fisher, Co-Founder and President of the National Vaccine Information Center, told The Epoch Times in an email.

Fisher is one of the original group of parents who worked with Congress on the 1986 National Childhood Vaccine Injury Act, which has been amended so much that it no longer serves its original purpose: to allow parents of vaccine-injured children to easily file a claim for compensation as an alternative to the civil courts.

Instead, the vaccine injury act now mainly protects manufacturers of mandated vaccines from lawsuits, especially after the Supreme Court declared that vaccines were “unavoidably unsafe” in a 2011 decision (pdf).

Fisher says the “public-private business partnerships” between the governments and pharmaceuticals for more than 35 years has been a “powerful lobby for forced vaccination” in the United States and around the world.

“That lobby has been putting pressure on U.S. lawmakers to mandate all federally recommended vaccines and eliminate informed consent protections in public health laws,” Fisher says.

Every state has a mandatory vaccine schedule for students to attend school, with around 50 vaccine doses given from birth to 18 years old according to Kids Health. People working in the healthcare industry are also mandated to take flu vaccines annually.

“The draconian COVID-19 vaccination law enacted in Denmark last spring that threatened to imprison people for refusing to comply is a warning of what could happen here. Americans must rise up and resist this kind of tyranny in great numbers like the people of Denmark have done this week,” Fisher says.




James Corbett: What NO ONE Is Saying About the Lockdowns | “If You Are Advocating for Lockdowns…You Are Complicit in Murder”

What NO ONE Is Saying About the Lockdowns

by James Corbett, The Corbett Report
November 24, 2020

 

Watch on Archive / BitChute / LBRY / Minds / YouTube

If you are advocating for lockdowns, you are complicit in tearing families apart. You are complicit in inflicting untold suffering on millions of people around the world. You are complicit in casting the poorest and most vulnerable in our societies into even further grinding poverty. You are complicit in murder.

TRANSCRIPT

This is James Corbett of corbettreport.com.

In 2006, a 15-year-old high school student from Albuquerque, New Mexico won third place in the Intel science and engineering fair for her project on slowing the spread of an infectious pathogen during a pandemic emergency. Using a computer simulation that she developed with the help of her father, she argued that in order to slow the spread of the disease, governments should implement school shutdowns, keep kids at home and enforce social distancing.

Incredibly, that third place high school science fair project can be tied directly to the lockdown policies being implemented by governments around the world today. You see, that father that she developed her computer simulation with was no average doting dad, but a senior researcher at Sandia National Laboratories who at that time was working on pandemic emergency response plans for the US Department of Homeland Security. His proposal to implement school shutdowns and, if need be, workplace shutdowns in the event of a pandemic emergency was developed at least in part in response to his daughter’s high school project.

Now those advocating for lockdowns have seen the destruction and death that those policies have wrought this year and we are living through that right now. Not only are people being deprived of their livelihoods and forced into grinding poverty as a direct result of these shutdowns, but now the undeniable truth is that if you are advocating for lockdowns, you are advocating for some portion of the population to be consigned to death.

This is no longer debatable. It is even openly admitted—although months too late by the World Health Organization.

DAVID NABARRO: I want to say it again: we in the World Health Organization do not advocate lockdowns as a primary means of control of this virus. [. . .] We may well have a doubling of world poverty by early next year. We may well have at least a doubling of child malnutrition because children are not getting meals at school and their parents and poor families are not able to afford it.

This is a terrible, ghastly global catastrophe, actually. And so we really do appeal to all world leaders: stop using lockdown as your primary control method. Develop better systems for doing it. Work together and learn from each other. But remember, lockdowns just have one consequence that you must never, ever belittle, and that is making poor people an awful lot poorer.

SOURCE: The Week in 60 Minutes #6

This is the point at which, no doubt, I’ll be expected to produce the data to back up the non-controversial observation that lockdowns kill, even though that data will do precisely nothing to penetrate the consciousness of those who have already decided that they occupy the moral high ground for advocating locking billions of people around the globe as prisoners inside their own homes. But persevere I will.

I’ll point, for example, to the letter signed by hundreds of doctors calling the lockdowns themselves a “mass casualty incident” and exhorting politicians to end the shutdowns.

I’ll point to the research that shows that thousands of people will die because of delays to cancer surgery treatments as a result of the medical shutdowns.

I’ll point to the research of the Well-Being Trust showing that 75,000 Americans are expected to die deaths of despair—including alcohol and drug misuse and suicide—this year alone as a result of the lockdowns.

I will point to the research of The Lancet showing that 265 million people are expected to be thrown into severe food insecurity as a result of these lockdowns.

I will even point to the research showing 125,000 children are expected to die from malnutrition as a result of these lockdowns.

But, as I say, none of these deaths will matter to those who have already decided that they are right and virtuous for advocating locking vast swathes of the human population inside their own homes to starve to death in the name of slowing the spread of a disease that even the epidemiologists who have been wrong about everything this year tell us will kill less than one percent of the infected.

Yes, slowing the spread, not stopping the spread. This was never about stopping a pandemic. Even the lockdown advocates never advocated that. But somehow that has been forgotten and “15 days to flatten the curve” has turned into a never-ending carte blanche for the biosecurity state to implement any number of draconian policies on its population, any number of policies on the checklist of the would-be dictator. Not only locking people inside their own homes, but constant surveillance of the population through the contact tracing and tracking apps that are increasingly being implemented around the globe, and, inevitably, the proposals for mandating the experimental vaccines which agents of the state will forcibly inject into people against their will.

This is not acceptable.

We cannot allow this to stand.

If we forsake this, our most basic right—the right to step foot outside of our own homes—then we forsake our humanity itself. An important part of what makes us human is being taken away from us in the name of stopping the spread of COVID-19.

But there is good news for those who have managed to retain their sanity in the time of insanity. We do not need a complicated plan in order to subvert this agenda. We do not need special deputization or to ask permission from the government. We do not need to join any particular political party or even any particular protest movement.

All we have to do is disobey these unlawful “orders.”

CASSIE ZERVOS: The persistent anti-lockdown protesters said they will not forget Melbourne’s strict 112 day measures as they took to the steps of Parliament. They carried signs saying “Don’t trust the government” and chanted for police to join them in their rally.

SOURCE: Melbourne anti-COVID lockdown protest turns ugly outside Parliament House

BUSINESS OWNER: I’ve lost friends who’ve killed themselves. I’ve seen clients die because they’ve lost their livelihood.

HEALTH INSPECTOR: I’m sorry to hear that.

BUSINESS OWNER: I know you are and i’m just a—I’m asking for you to guys have some compassion.

SOURCE: Buffalo, New York Business Owners Stand Up to Cuomo Lockdown Orders

ASHLEY DRIEMEYER: Can he arrest us all? Because, from what I am gathering, in this area we are all banding together and going against our governor.

SOURCE: Illinois restaurant owner will defy new state restrictions

[CROWD BANGS POTS AND PANS DURING PROTEST]

SOURCE: Protests in Denmark – Epidemic law and mandatory vaccines – EPIDEMILOV

BUSINESS OWNERS: Get out! Get out! Get out! Get out! Get out!

SOURCE: Buffalo, New York Business Owners Stand Up to Cuomo Lockdown Orders

If you have managed to retain your sanity during this time of widespread insanity, I applaud you and wish to assure you that you are not alone. Many, many people all around the world are defying orders. They are protesting against these lockdowns. They are standing up. They are disobeying.

But of course the corporate controlled press don’t want you to know that disobedience is an option on the table and they will not report on this. But disobedience is an option. Open your business. Leave your home. Do not ask for permission. Disobey.

To those who are still advocating for lockdowns, I encourage you to do so to the face of those parents who have lost their teenage children due to suicide as a direct result of the shutdowns and tell them that their child’s death doesn’t matter because it wasn’t listed as being due to COVID-19. Or do so to the face of the tens of thousands of others who have already lost loved ones as a direct result of these shutdown or the hundreds of thousands more who will die as long as these lockdowns endure.

If you are advocating for lockdowns, you are complicit in tearing families apart. You are complicit in inflicting untold suffering on millions of people around the world. You are complicit in casting the poorest and most vulnerable in our societies into even further grinding poverty. You are complicit in murder.

A line is being crossed right now. Which side of history are you on? Make your decision now and make it wisely, because your actions during these times will not be forgotten.

You have been warned.




The Boiling Frog Effect

The Boiling Frog Effect

by Dave Cullen, Computing Forever
November 23, 2020

 

Available at Computing Forever YouTube and BitChute channels.

 


Truth Comes to Light editor’s note: Below you will find a transcript of this powerful video by Dave Cullen.  The notes in brackets are my description of clips that were not transcribed. Images are screenshots of Dave’s artwork from the video.~ Kathleen



As we’ve previously discussed, you can never appease narcissists. And there’s no amount of appeasement or acquiescing to covid mandates that will satisfy the bully-boy elites in charge of your country.

If you keep playing along with their demands, you can expect more demands. It all comes to a halt when you refuse to comply.

Many people believe that, after the vaccine, life will just return to normal. I’ve been saying for quite a while now, normality was never supposed to return and that an entirely new dystopian normal was being created –through fear, coercion and the slow boiling frog effect — where people are gradually acclimatized over time, through prolonged exposure and adaptation, to a new way of living.

People actually believed that if they did what they were told by the government and the media like good little children then one day they wouldn’t have to wear face masks and do social distancing anymore.

[Here you’ll see a video clip of Fauci interview.]

So there you have it. Social distancing and masks are supposed to continue forever apparently. How did humanity ever exist prior to the implementation of these stringent and totally unnatural and anti-human public health measures?

Now, recently Professor Luke O’Neal spoke to a group of school children.

[Video clip of Professor O’Neal speaking gobbledygook to young captive audience.]

So was that clear? Kind of? Even if you’re vaccinated, you probably will have to wear your mask and social distance for six months until some “r” number thing comes down, but you still might have to wear masks in shops every winter. Okay? Yeah, that was that was clear. Right? Sure.

[More drivel from Professor O’Neal.]

Unbelievable. So he talks about the health passport app to prove that you’re vaccinated, which is basically “show me your papers, please”. And he talked about a wristband alternative. A wristband that can’t come off. And then he makes some remark about how people will complain about their civil liberties. No shit! — considering a person’s right to free movement will be infringed upon. Because if they refuse to take an unnecessary and experimental vaccine, I would imagine there will be quite a few people complaining about their fundamental human rights.

It’s unbelievable but I have been talking about this crap for months now and it seems that some of our worst concerns with respect to rising authoritarianism are actually on the horizon here.

Luke O’Neil also says that students may not be able to go to their debs (for those of you in America that’s the prom here in Ireland) if they aren’t vaccinated.

[More of the same video with innocent children being subjected to the authoritative stupidity of Luke O’Neill.]

So there you have it. You thought your life was going back to normal if you just surrendered all your rights, freedoms and bodily sovereignty for however long the lying government demanded it. Well it depends what you mean by normal. If by normal we mean the mandates and control measures will largely remain in place and everyone has to be vaccinated every year, then yeah, I guess it’s normal. Right?

[Luke O’Neil, ad nauseum.]

Whatever happened to the human immune system? Seriously. Did it just stop working in 2020 or something? What did we do before the pharmaceutical industry came along?

[World Economic Forum’s Klaus Schwab rambles some sort of nonsense.]

Let’s move on. This article is from the Daily Mail — Britons who test negative for Covid twice in a week are set to receive a freedom pass under government scheme that will allow them to live a normal life.

So, if you have to get a freedom pass, it means that you’re not free. And they’re admitting that you’re currently not free. Okay? So, that’s not a free society.

A hall pass for life basically. A hall pass to live your life. It is hoped the scheme could allow Britons to go back to a relatively normal life. Relatively meaning not normal. To earn a freedom pass people will need to get a negative test twice a week.

How far away are we from the hunger games at this stage?

Pass will allow you to mix with friends and family without distancing or masks. Again, this has been made possible by the fact that the general public were so utterly terrified, traumatized and bamboozled by fear-mongering for so many months that they actually started to believe that their rights and freedoms come from the government — when, in fact, they don’t.  They are inalienable.

So, the government takes everyone’s fundamental rights away and then, in order to get the public to comply with the new abnormal, they tease them by offering to give them back tiny little bits of scraps of their freedom.

You know, they’re kind of bribing them. And the public, being so desperate for a reprieve from all of these oppressive measures, might actually see such freedom passes as a way out.

You can see where this is leading people. They are slowly being conditioned to accept having to negotiate for the right to do things that they previously understood to be indisputable freedoms that the government couldn’t touch. They just took them for granted. Now they’re basically being told to ask the government for permission to just spend time with their friends and family, or being allowed to just forgo social distancing, or masks for a little while.

The general adult population, globally at this stage, appears to have been reduced to an infantilized state — like children having to ask if it’s okay for them to hug their grandkids or visit their neighbor. Perfectly healthy people are being told that they’re sick due to a highly questionable PCR test, all the while actual sick people who are in need of hospital care are being denied that care. They’re being denied their necessary treatments.

“COVID-19, the virus so deadly you have to be tested to know you have it,” as the meme goes.

And this argument, that asymptomatic carriers (which is to say healthy people) could get someone sick, is the most outrageous premise because it’s basically a recipe for permanent lockdowns and restrictions. If the government, with their so-called expert scientists, can simply call a pandemic at any time, and then claim that people who feel healthy are potentially sick (with a deadly virus that could get some vulnerable person killed somewhere) then it’s essentially the perfect excuse to rob everyone of their rights and freedoms — at any time and forever.

The reality is, this is not how a society that values individual civil liberties functions because the burden of proof must fall on the person making the claim about the deadly virus and they must prove that the health recommendations are proportionate to the level of the danger. Even then, I would only accept any health measures as recommendations, as advisory and not mandatory, even in a serious outbreak.

And I know some of you disagree with me on that, but you got to understand that the price of freedom is simply too high.

And you can’t just trust that, even after a genuine pandemic, that your government is going to just give your rights back to you. That’s very naive. And that’s what people have done in this case.

Now, under the spanish flu, when people were living in an actual pandemic, there was evidence all around them of this sickness. Everybody knew someone who died from it or at least had been sick from it, you know. You could see examples of sickness in the streets. Not so much with covid. Right?

The article continues:

“To earn the freedom pass people will need to be tested regularly and ,provided the results come back negative, they will then be given a letter card or document they can show to people as they move around.”

Oh boy.

“The certificate would be stored on a phone…”

I just want to point out, I said this stuff months ago. I was called a conspiracy theorist. It’s happening, so you know…

“The certificate would be stored on a phone, according to sources, and will allow people to live a relatively normal life until the government’s vaccination program gets up to speed.”

So there you go. Next up, the vaccine.

“It would even allow Britons to get away without wearing a mask, it is thought, and visit family and friends without the need to socially distance.”

Freedoms and rights we previously took for granted now coming with qualifiers and conditions. Even in your own home. Right?

It’s like the public are all prisoners being temporarily released under bail conditions.

“A source told the Telegraph: ‘They will allow someone to wander down the streets, and if someone else asks why they are not wearing a mask, they can show the card letter or an App.’

I preferred life before, when you could just walk around freely and you didn’t have to show anything to anybody. In other words, people have to show their papers. Right?

“Show me your papers, please!”

This is leading to mass medication of the populace by state coercion.

What could possibly go wrong?

This same strategy will be used for the vaccine. It almost makes you wonder why they’re pushing the vaccine so much. I wonder what’s in it?

The government will not concede any liberties to you until you conform to their medical tyranny. The governments of this world are merely puppets of the globalist interests in the World Economic Forum, The United Nations, Big Pharma — and they are at war with humanity.

This Fox News article talks about Greece. Coronavirus lockdown in Greece requires people to text authorities before leaving home.

“Under a second nationwide coronavirus lockdown in Greece, people will need to text authorities if they want to leave their homes.

“The lockdown will start at daybreak Saturday and last until the end of the month. With infections surging across the country, Prime Minister…

— let me see if i can pronounce this —

“Kyriakos Mitsotakis…

— probably not pronouncing that correctly–

“said he acted before patients overwhelm hospitals.”

Where have we heard that before?

Oh yeah, for the last eight months. All the time.

“We must stop this wave,” he said Thursday. I chose once again to take drastic measures sooner rather than later.

“As part of the lockdown, all retail stores except those selling essential items such as food, medication, and fuel will be closed.

“Travel inside the country will be severely restricted.

“People will only be allowed to leave their homes for work, physical exercise or medical reasons, and only after sending a text message to authorities.

“In the texts to the five-digit number, people will have to provide their name, address and the reason why they need to leave their home.

Unreal.

Where is the outrage?

Honestly. Like, what is wrong with…

Does anybody value freedom anymore? Except, you know, a handful of us at this point.

Moving on. Dan Price tweeted the following:

Indeed.

And that’s essentially what The Great Reset is all about.

Now imagine if Ireland’s Leo Varadkar… had given a speech to the people that went a little something like this:

“Listen guys, I’m afraid you’re gonna have to shut down your businesses forever. And there’s a virus. And it’s going to be here for ages. And the whole world is going to be thrown into one crisis after another.

“Uh, nothing we can do, guys. The rest of your life is just going to be unending misery and upheaval. Uh, new normal on the way. Sorry about that.

“Uh say goodbye to your livelihoods and social lives, the SME sector [Small Enterprise in Ireland with fewer than 50 employees] is finished.  Prepare for mandatory face masks forever in order to be able to just go into the shops or go on public transport.

“Also there’s this thing called social distancing where people treat each other like pariahs. Basically, it’s the presumption of being an asymptomatic carrier of a deadly contagious disease.

“So stay apart. And also we’re going to be essentially undermining your property rights and right to the sanctity of your homes by, uh, being able to enact legislation on how many people are permitted in your home.

“We’re gonna cancel religious services and holidays. And in the long run, uh, there’s gonna be mandatory vaccinations, guys, with, uh, digital immunity passports (which is an app on your phone that shows if you’re vaccinated) or otherwise you won’t be able to go about your life or leave your home.

“Big corporations are going to make a fortune. And more power and wealth will be transferred from you plebs to the one percent of the one percent.

“Uh, small businesses are finished.

“Shut them down. That’s an order.

“Uh, don’t make us send in the guards.”

But, you see, you can never be quite so honest with people in the beginning, when you’re trying to alter human behavior. It takes time. And the conditioning is very gradual, very subtle.

If small business owners, for example, were told in the beginning that they would have to shut down forever, there would have obviously been huge backlash and people would have twigged that something was very seriously wrong.

They would want proof that they were living in an actual pandemic, beyond some scary graphs on a television.

So Varadkar, like any other political puppet, has to follow a similar plan that’s been given to him. The public and small businesses weren’t initially told that the virus was going to be a problem for a very long time. They were told that it was just a few weeks to flatten the curve — in order to avoid the terrible grim reality of a worst case scenario of 85,000 deaths in Ireland by covid.

That’s what he suggested back in March. It seems absurd to read this headline again now in November.

Anyway, the frog in the pot has to be boiled slowly or otherwise it won’t have time to adapt to the increase in temperature and it will jump out of the water.

So to keep people under control they have to be gradually primed for the new abnormal world, with promises about how it’s all going to eventually end and go back to normal — in just a few weeks. The behavior modification narrative has to, ever so slightly, be tweaked periodically so as to be almost imperceptible by the general public.

“Two weeks to flatten the curve” becomes “it’s just a few more weeks to stop the hospitals from being overrun”.

Then it’s “the next two weeks are crucial”.

And then it’s “we have to get the ‘r’ number down”.

And then it’s “experts are concerned about worrying spikes” or something.

And then it’s “just a few more months”.

And then it’s “just until we get a vaccine”.

Eventually, it’ll be “it’s just until the next vaccine”, and then the next one after that, and so on and so on .

Mandatory masks and social distancing signs and stickers were initially suggested as being only temporary until, of course, a sufficient amount of time has passed — and the general public have been so utterly broken and demoralized that they adapt to these things as part of their daily routine. Then they become the new normal.

From the government’s perspective, there’s no need to definitively come out and say when these policies will ever go away because, if the public are so compliant, why would the government surrender their new powers?

The increased draconian airport security measures after 9/11 weren’t temporary, though many people thought they were at the time.

So, why should any government relinquish these new covid control measures?

What I couldn’t get through to people back in March and April is that, when people surrender some of their rights, governments don’t voluntarily give them back. And that has been a clear thing. That’s been a clear pattern throughout history.

Freedoms are trampled on and our lives are slowly changed bit by bit. They rob the people of their liberties, a piece at a time and all, of course, under the guise of public safety.

So, anyway, a few months go by and, sure enough, the hoodwinked, compliant public — who’ve consumed constant fear propaganda from every conceivable angle — they’re now wearing their masks like slaves of the past. They’re even wearing them walking down the street and they haven’t been told to do that.

They know to stand on the circles, follow the arrows, queue outside the supermarket, wear the masks, use the hand sanitizer, and keep their distance .

The Pavlovian dog training is complete. They’ve now been placed into a state of such brainless docility that they are ready for more arbitrary instructions.

The globalists knew that they had to get SMEs out of the way in order to create their wealth transfer to big businesses. So small business owners were told to hang in there. And eventually they were fed scraps of hope.

A new reopening plan was unveiled where restaurants, shops, hair salons, gyms and pubs, etc. would remodel and reorganize their premises and means of operating to comply with social distancing guidance. No doubt they were desperate to comply. Limits were placed on the number of people permitted into the premises. Plexiglas screens were installed. Face coverings or visors became commonplace. Time limits were put in place. Bookings and names and numbers had to be taken by pubs in order to comply with contact tracing.

All of these things were nothing more than a charade — obstacles to be put in place to obstruct and damage the businesses — part of the slow boil process. Make small businesses think that the government wants them to survive and that there’s light at the end of the tunnel.

And the SMEs fell for it, hook line and sinker. The daft regulations that were meant to undermine their business models and reduce their profitability and slowly make them unworkable, the powers-that-be knew that if they didn’t offer SMEs this false dawn of hope that they would likely become fed up and revolt against the summer lockdown.

The summer reopening was, therefore, simply all part of the narcissistic strategy of “love bombing” after an abandonment phase. It was about trying to keep the SMEs sweet.

False hopes of returning to normal would later be dashed by another second lockdown, designed to finish off the SMEs and put them out of business for good.

You cannot appease your oppressor.

Complying with one mandate will inevitably lead to another and then another and another until your life is nothing like it was before — until your life is unrecognizable and you’ve lost all your freedoms, and everything that meant anything to you.

One of the biggest challenges we face in waking people up is their flat refusal to believe in the concept of evil, and that evil is very much at work in the world right now.

But just like a viral transmission, evil needs a host to survive. Its power comes by spreading through fear and intimidation among a compliant public.

If you refuse to comply, the power of evil disappears.

Please stop complying.




The A-Z of Covid19

The A-Z of Covid19
Your handy guide for navigating the current crisis

by Mark Chapman, OffGuardian
November 22, 2020

 

In these troubling times it can be hard to find a clear path through the maze of disinformation and covid-denial. Print the following out and keep it with you at all times. Refer to it when confronted with a Covidiot or any suggesting you try thinking for yourself.

A

ANTI-VAXXER (Sic) Criminal lunatic who is intent on denying everyone the opportunity of ever being vaccinated against anything by means of unsubstantiated neo-religious ravings. Candidate for funny-farms and medical experimentation.

B

BREXIT: Fantasy utopian state believed in by ANTI-VAXXERS and CONSPIRACY THEORISTS.

C

CONSPIRACY THEORIST: Criminally insane individual dedicated to the annihilation of humanity by allowing everyone to die of COVID-19 by alleging that it may not be as deadly as we all know it is. Other characteristics include denying climate change, voting for BREXIT and non-readership of the GUARDIAN.

COVID-19: Unstoppable and totally lethal plague carried by any living organism with 100% mortality rate that can be caught by any living being on the earth. Symptoms include a) being alive and b) living on planet Earth.

D

DEATH: Preventable non-living condition arising from contracting COVID-19. Otherwise represented as falsely arising from conspiracy-theorist-alleged conditions e.g. “cancer”, “heart disease”, “accident”, “being shot,” etc .

DEMOCRACY: Fantasy utopia believed in by ANTI-VAXXERS and CONSPIRACY THEORISTS. Characterised by BREXIT and TRUMP.

E

EPIDEMIOLOGY: Fake science to spread MISINFORMATION about COVID-19.

EXPONENTIAL: Default speed of COVID-19 spread.

F

FACE MASK/COVERING: Essential Personal Protective Equipment for living organisms. ANTI-VAXXERS and CONSPIRACY THEORISTS do not wear them and this renders them easily identifiable.

FACT-CHECKERS: For reference please read Orwell, G,1984 ref: Ministry of Truth.

FREEDOM: Mythical condition believed in by CONSPIRACY THEORISTS and ANTI-VAXXERS (see above). Cited by the aforementioned as something preferable to protection from DEATH (see above) by COVID-19.

G

GATES, BILL: Philanthropist dedicated to saving the world from COVID-19.

GREAT BARRINGTON DECLARATION, THE: Pseudoscientific mumbo-jumbo written by a bunch of QUACKs including “Dr. Johnny Bananas” in order to spread MISINFORMATION about COVID-19.

GREAT RESET: THE: Mythical blueprint for post COVID-19 society. Referred to by ANTI-VAXXERS and CONSPIRACY THEORISTS.

GUARDIAN, THE: Source of reliable and truthful information regarding COVID-19. Required reading. Non-biased, humanist publication written by the most gifted journalists now living.

H

HANCOCK: MATT: Hero of the people dedicated to saving everyone from COVID-19.

HEALTH: Condition of existence characterised by non-infection by COVID-19. Misrepresented by ANTI-VAXXERS and CONSPIRACY THEORISTS as normal, non-pathological state.

I

IMMUNOLOGY: Fake science intended to mislead the public regarding COVID-19.

J

JOHNSON, BORIS: Prime Minister of England. Very funny chap.

K

KOONTZ, DEAN: Author who predicted COVID-19 in one of his novels.

L

LIFE: Pathological delusion believed in by CONSPIRACY THEORISTS.

LOCKDOWN: Utopian state that will free humanity for ever.

M

MISINFORMATION: Act of suggesting mistaken beliefs not permitted by the STATE: eg. 2+2=4 without reference to FACT CHECKERS.

N

NHS: Pre-2020 organisation, now defunct, providing placebo medication for now-debunked conditions such as “cancer”, “heart disease,” “diabetes” etc.

NORMAL; NEW: Post-2020 Age of Enlightenment: for further information see Zamyatin,, Y, We. Huxley, A, Brave New World.

O

OXFORD: UNIVERSITY OF: Developmental research station for COVID-19.

P

PANDEMIC: The current state of existence characterising life on Planet Earth.

PARLIAMENT: Pre-2020 institution, now defunct, dedicated to squabbling on television for the benefit of the masses over decisions that had already been taken by the STATE.

PLANDEMIC: Criminally insane publication written by CONSPIRACY THEORISTS.

POLICE: Pre-2020 organisation, now defunct, created to enact entertaining drama for the masses, e.g by driving around in fast cars and running about in city centres trying to catch “baddies” and “crooks.” Especially effective at reducing traffic congestion in December and January. Ref: Z-Cars, The Bill, Dixon of Dock Green.

PRISON: Institutions created to house ANTI-VAXXERS and CONSPIRACY THEORISTS.

Q

QUACK: Signatory of the GREAT BARRINGTON DECLARATION with fake Ph.D.

R

R NUMBER: Statistical integer for illustrating spread of COVID-19. Non-referenced.

S

SAFE: Condition of total atrophy. See DEATH.

SCIENTIST: Individual responsible for issuing warnings justifying lockdowns.

SKY NEWS: Unbiased source of information regarding COVID-19. To be broadcast in all pubs and places of entertainment.

SOCIAL DISTANCING: Introduced 2020. The natural form of communication for human beings requiring a respectful personal space. Let’s face it, how many years have you gone around putting up with bad breath, BO and fag smoke?

STATE, THE: Benefactor and source of all blessings.

SWEDEN: Rogue state of COVID-19 deniers.

T

T-CELL: Mythical component of IMMUNOLOGY used to mislead the public regarding COVID-19.

TRUMP, DONALD : Former president of the United States. Believer in debunked fantasy of DEMOCRACY.

U

UNITED KINGDOM, THE, Isolated control population for COVID-19 VACCINE. Characterised by inhabitants with zero capacity for rebelliousness.

V

VACCINE: Panacea for COVID-19. To be injected into population of entire planet. Declared safe by QUACKs. Said population expendable in drive to halt “climate change.”

VIROLOGY: Fake science intended to mislead the public regarding COVID-19.

VIRUS: Integral component of COVID-19. Non-referenced.

W

WE: (1924, Zamyatin, Y.) Blueprint for post-COVID-19 society.

WORLD HEALTH ORGANISATION: Bunch of nice chaps who like sitting around talking about COVID-19.

WORLD ECONOMIC FORUM: Bunch of nice chaps who like sitting around talking about money.

Z

ZAMYATIN, Y: Author of “WE”, (soon to be banned)

 




COVID 19: Mounting Evidence of International Fraud

COVID 19: Mounting Evidence of International Fraud

by Iain Davis, In This Together
November 16, 2020

 

COVID 19, and the subsequent governmental responses, appear to be part of an international conspiracy to commit fraud. It seems there is no evidence that a virus called SARS-CoV-2 causes a disease called COVID 19.

Sometimes you have to go with your gut. I am not an expert in genetics and, as ever, stand to be corrected. However my attention was drawn to some research published by the Spanish medical journal D-Salud-Discovery.  Their advisory board of eminently qualified physicians and scientists lends further credibility to their research. Their claim is astounding.

The genetic primers and probes used in RT-PCR tests to identify SARS-CoV-2 do not target anything specific. I followed the search techniques outlined in this English translation of their report and can corroborate the accuracy of their claims about the nucleotide sequences listed in the World Health Organisations protocols. You can do the same.

D-Salud-Discovery state there are no tests capable of identifying SARS-CoV-2. Consequently all claims about the alleged impact of COVID 19 on population health are groundless.

The entire official COVID 19 narrative is a deception. Ostensibly, there is no scientific foundation for any part of it.

If these claims are accurate we can state that there is no evidence of a pandemic, merely the illusion of one. We have suffered incalculable loss for no evident reason, other than the ambitions of unscrupulous despots who wish to transform the global economy and our society to suit their purposes.

In doing so this “parasite class” have potentially committed countless crimes. These crimes can and should be investigated and prosecuted in a court of law.

Identification of What Exactly?

The World Health Organisation (WHO) classified COVID-19 (COronaVIrus Disease 2019). They declared a global COVID 19 pandemic on March 11th 2020.

The WHO’s Laboratory testing guidance states:

“The etiologic agent [causation for the disease] responsible for the cluster of pneumonia cases in Wuhan has been identified as a novel betacoronavirus, (in the same family as SARS-CoV and MERS-CoV) via next generation sequencing (NGS) from cultured virus or directly from samples received from several pneumonia patients.”

The WHO’s claim is that the SARS-CoV-2 virus causes the disease COVID-19. They also allege this virus has been clearly identified by researchers in Wuhan.

In the WHO’s Novel Coronavirus 2019-nCov Situation Report 1, they state:

“The Chinese authorities identified a new type of coronavirus, which was isolated on 7 January 2020……On 12 January 2020, China shared the genetic sequence of the novel coronavirus for countries to use in developing specific diagnostic kits.”

These two statements from the WHO clearly suggest the SARS-CoV-2 virus was isolated (meaning purified for study) and then genetic sequences were identified from the isolated sample. From this, diagnostic kits were developed and distributed globally to test for the virus in towns, cities and communities around the world. According to the WHO and Chinese researchers, these tests will find the virus that causes COVID 19.

Yet the WHO also state:

“Working directly from sequence information, the team developed a series of genetic amplification (PCR) assays used by laboratories.”

The Wuhan scientists developed their genetic amplification assays from “sequence information” because there was no isolated, purified sample of the so called SARS-CoV-2 virus. They also showed electron microscope images of the newly discovered virions (the spiky protein ball containing the viral RNA.)

However, such protein structures are not unique. They look just like other round vesicles, such as endocytic vesicles and exosomes.

Virologists claim that it is not possible to “isolate” a virus because they only replicate inside host cells. They add that Koch’s postulates do not apply because they relate to bacteria (which are living organisms). Instead, virologists observe the virus’ cytopathogenic effects (CPE), causing cell mutation and degradation, in cell cultures.

When Chinese researchers first sequenced the full SARS-CoV-2 genome they observed CPE in Vero E6 and Huh7 cells. Vero E6 are an immortalised monkey cell line and Huh7 are immortalised cancer (tumorigenic) cells. Meaning they have been maintained in vitro (in petri dish cultures) for many years.

Central to the official SARS-CoV-2 story is the idea that it is a zoonotic virus, capable of bridging the species gap from animals to humans. When scientists from the U.S. CDC “infected” various cells with the novel virus they noted the following:

“We examined the capacity of SARS-CoV-2 to infect and replicate in several common primate and human cell lines, including human adenocarcinoma cells (A549) [lung celles], human liver cells (HUH7.0), and human embryonic kidney cells (HEK-293T), in addition to Vero E6 and Vero CCL81 [monkey cells]……No cytopathic effect was observed in any of the cell lines except in Vero cells [monkey cells]…….HUH7.0 and 293T cells showed only modest viral replication and A549 cells [human lung tissue cells] were incompatible with SARS-CoV-2 infection.”

The CDC did not observe any CPE in human cells. They saw no evidence that this alleged virus caused any human illness. Nor did this supposed human virus show any notable replication in human cells, suggesting human to human infection would be impossible.

Noting this problem, a team of Polish scientists introduced this sequenced “virus” to human epithethelium (airway) cells. They observed the effects on these HAE cultures for 5 days. They noted much greater replication than the CDC scientists but ultimately stated:

“We did not observe any release of the virus from the basolateral side of the HAE culture.”

Meaning they did not see any evidence of the supposed virions breaching the cell wall membrane. Again suggesting this so called virus isn’t infectious in human beings.

It is not clear that SARS-CoV-2 is a human virus capable of causing illness. It may not even physically exist. Is it nothing more than a concept based upon predictive genetic sequences?

Voyage Of Discovery

The Wuhan Center for Disease Control and Prevention and the Shanghai Public Health Clinical Centre published the first full SARS-CoV-2 genome (MN908947.1 ). This has been updated many times. However, MN908947.1 was the first genetic sequence describing the alleged COVID 19 etiologic agent (SARS-CoV-2).

All subsequent claims, tests, treatments, statistics, vaccine development and resultant policies are based upon this sequence. If the tests for this novel virus don’t identify anything capable of causing illness in human beings, the whole COVID 19 narrative is nothing but a charade.

The WUHAN researchers stated that they had effectively pieced the SARS-CoV-2 genetic sequence together by matching fragments found in samples with other, previously discovered, genetic sequences. From the gathered material they found an 87.1% match with SARS coronavirus (SARS-Cov). They used de novo assembly and targeted PCR and found 29,891-base-pair which shared a 79.6% sequence match to SARS-CoV.

They had to use de novo assembly because they had no priori knowledge of the correct sequence or order of those fragments. Quite simply, the WHO’s statement that Chinese researchers isolated the virus on the 7th January is false.

The Wuhan team used 40 rounds of RT-qPCR amplification to match fragments of cDNA (complimentary DNA constructed from sampled RNA fragments) with the published SARS coronavirus genome (SARS-CoV). Unfortunately it isn’t clear how accurate the original SARS-CoV genome is either.

In 2003 a team of researchers from from Hong Kong studied 50 patients with severe acute respiratory syndrome (SARS). They took samples from 2 of these patients and developed a culture in fetal monkey liver cells.

They created 30 clones of the genetic material they found. Unable to find evidence of any other known virus, in just one of these cloned samples they found genetic sequences of “unkown origin.”

CHART: E Gene target sequence

Examining these unknown RNA sequences they found 57% match to bovine coronavirus and murine hepatitis virus and deduced it was of the family Coronaviridae. Considering these sequences to suggest a newly discovered SARS-CoV virus (new discoveries being ambrosia for scientists), they designed RT-PCR primers to test for this novel virus. The researchers stated:

“Primers for detecting the new virus were designed for RT-PCR detection of this human pneumonia-associated coronavirus genome in clinical samples. Of the 44 nasopharyngeal samples available from the 50 SARS patients, 22 had evidence of human pneumonia-associated coronavirus RNA.”

Half of the tested patients, who all had the same symptoms, tested positive for this new alleged virus. No one knows why the other half tested negative for this novel SARS-CoV virus. The question wasn’t asked.

This supposed virus had just a 57% sequence match to allegedly known coronavirus. The other 43% was just “there.” Sequenced data was produced and recorded as a new genome as GenBank Accession No. AY274119.

The Wuhan researchers subsequently found an 79.6% sequence match to AY274119 and therefore called it a novel strain of SARS-CoV (2019-nCoV – eventually renamed SARS-CoV-2). No one, at any stage of this process, had produced any isolated, purified sample of any virus. All they had were percentage sequence matches to other percentage sequence matches.

Isolate Nothing

Scientists are very annoyed because they keep saying the virus has been isolated but no one believes them. This is because, as yet, no one has provided a single purified sample of the SARS-CoV-2 virus. What we have instead is a completed genome and, as we are about to discover, it isn’t particularly convincing.

Investigative journalists Torsten Engelbrecht and Konstantin Demeter asked some of the scientists who said they had images of SARS-C0V-2 virions to confirm these were images of an isolated, purified, virus. None of them could.

In Australia scientists from the Doherty Institute, announced that they had isolated the SARS-CoV-2 virus. When asked to clarify the scientists said:

“We have short (RNA) sequences from the diagnostic test that can be used in the diagnostic tests”

This explains why the Australian government state:

“The reliability of COVID-19 tests is uncertain due to the limited evidence base…There is limited evidence available to assess the accuracy and clinical utility of available COVID-19 tests.”

In The UK, in July, a group of concerned academics wrote a letter to the UK Prime Minister Boris Johnson in which they asked him to:

“Produce independently peer reviewed scientific evidence proving that the Covid-19 virus has been isolated.”

To date they have not received a reply.

Similarly, UK researcher Andrew Johnson made a Freedom of Information Request to Public Health England (PHE). He asked them to provide him with their records describing the isolation of a SARS-COV-2 virus. To which they responded:

“PHE can confirm it does not hold information in the way suggested by your request.”

Canadian researcher Christine Massey made a similar freedom of information request, asking the Canadian government the same. To which the Canadian government replied:

“Having completed a thorough search, we regret to inform you that we were unable to locate any records responsive to your request.”

In the U.S. the Centre For Disease Control (CDC) RT-PCR Diagnostic Panel state:

“…No quantified virus isolates of the 2019-nCoV are currently available……..Detection of viral RNA may not indicate the presence of infectious virus or that 2019-nCoV is the causative agent for clinical symptoms.”

Last updated on 13th July 2020, the CDC are yet to obtain any pure viral sample from any patient said to have the disease of COVID-19. They openly admit their tests don’t necessarily show if SARS-CoV-2 is either present or causes COVID 19.

We are told that none of this matters. That we are ignorant and just don’t understand virology. Therefore, we must except pictures of things we know could be something else and genetic sequences (which could be anything else) as conclusive proof that this virus, and the disease it is supposed to cause, are real.


Testing For Nothing

The WHO, and every government, think tank, policy steering committee, government scientific advisor, supranational institutions and others who promote the official COVID 19 narrative, assert that SARS-CoV-2 causes COVID 19. While no one has ever produced a sample of this supposed virus, the alleged SARS-CoV-2 genome has been published. It is in the public domain.

Key genetic sequences, in the SARS-CoV-2 genome, are said to have specific functions. These are the target proteins that scientists test for to identify the presence of the “virus”. These include:

  • RNA-polymerase (Rd-Rp) gene – This enables the SARS-CoV-2 RNA to replicate inside the cytoplasm of COVID 19 diseased epithelial cells.
  • S gene (Orf2) – this glycoprotein forms the spike on the SARS-CoV-2 virion surface which supposedly facilitates SARS-CoV-2 binding to the ACE2 receptors on cells, allowing the RNA inside the virion protein shell (capsid) to pass into the now infected cell.
  • E gene (Orf1ab) – small membrane protein used in viral assembly
  • N gene (Orf9a) – the nucleocapsid gene which binds the RNA in capsid formation

The WHO maintain a publicly available record of the RT-PCR primers and probes used to test for SARS-CoV-2. The primers are specific nucleotide sequences that bind (anneal) to the antisense and sense strands of the synthesised cDNA (called forward and reverse primers respectively.)

The cDNA strands separate when heated and reform when cooled. Prior to cooling, nucleotide sequences called probes are introduced to anneal to specific target regions of the suspected viral genome. During amplification, as the regions between primers elongate, when a primer strikes a probe, the probe decays releasing a fluorescent or dye which can then be read by researchers.

It is the identification of these markers which scientists claim to prove the presence of SARS-CoV-2 in a sample.

Something else which is publicly available is the Basic Local Alignment Search Tool (BLAST). This allows anyone to compare published nucleotide sequences with all those stored by the U.S. National Institutes of Health (NIH) genetic database called GenBank. Therefore we can BLAST the claimed SARS-CoV-2 primers, probes and target gene sequences.

The WHO’s forward, reverse primers and probe protocols, for the alleged SARS-CoV-2 viral genome, are based upon RdRp, Orf1, N and E gene profiles. Anyone can run them through BLAST to see what we find.

The vital RdRP nucleotide sequence, used as a forward primer is – ATGAGCTTAGTCCTGTTG. If we run a nucleotide BLAST this is recorded as a complete SARS-CoV-2 isolate with a 100% matched sequence identity. Similarly the reverse E gene primer sequence – ATATTGCAGCAGTACGCACACA – reveals the presence of the Orf1ab sequence which also identifies SARS-CoV-2.

However, BLAST also enables us to search the nucleotide sequences of the microbial and human genomes. If we search for the RdRp SARS-CoV-2 sequence it reveals 99 human chromosome with a 100% sequence identity match. The Orf1ab (E gene) returns 90 with a 100% sequence identity match to human chromosomes.

Doing the same for these sequences with a microbial search finds 92 microbes with a 100% match to the SARS-CoV-2 E gene and 100 matched microbes, with a 100% sequence identity, to the vital SARS-CoV-2 RdRp gene.

Whenever we check the so called unique genetic markers for SARS-CoV-2, recorded in the WHO protocols, we find complete or high percentage matches with various fragments of the human genome. This suggests that the genetic sequences, which are supposed to identify SARS-CoV-2, are not unique. They could be anything from microbial sequences to fragments of human chromosomes.

So called fact checkers, like Reuters’ Health Feedback project, have been quick to dismiss the claims of those who have noticed the apparent lack of specificity in the supposed SARS-CoV-2 genome. Using a slew of strawman arguments like, “this claim suggests every test should be positive,” (which it doesn’t) their debunking attempt runs something like this:

Primers are designed to bind to specific nucleotide sequences that are unique to the virus. The forward primer may bind to a particular chromosome but the reverse primer doesn’t bind to the same chromosome and so the chromosome is not present in the SARS-CoV-2 virus. Moreover because the forward and perverse primers envelop the sequence to be amplified the cDMA sequence between primers is unique to the virus.

This seems to deliberately misrepresent the significance of these findings by forwarding an argument that no one, other than the fact checkers themselves, are making. BLAST searches show that these target sequences are not unique to SARS-CoV-2. Nor do all targets need to be found for a result to be deemed positive.

Moroccan researchers investigated the epidemiology of Moroccan alleged cases of SARS-CoV-2. Nine percent were positive for three genes, eighteen percent were positive for two genes and seventy three percent for just one. As we have just discussed, many may have been positive for none.

This is entirely in keeping with WHO’s test guidelines. They state:

“An optimal diagnosis consists of a NAAT [nucleic acid amplification test] with at least two genome-independent targets of the SARS-CoV-2; however, in areas where transmission is widespread, a simple single-target algorithm can be used……One or more negative results do not necessarily rule out the SARS-CoV-2 infection.”

Regardless of the spurious arguments of well funded fact checkers, if the forward and reverse primers identify junk, perhaps one being the fragment of a chromosome and the other a microbial sequence, then the amplified region between them is probably junk too.

The argument that RT-PCR only finds RNA is specious. Natural transcription (the separation of DNA strands) occurs during gene expression. No one is saying whole chromosomes or microbes are sequenced in the alleged SARS-CoV-2 genome. Though they may, for all we know. They are saying the alleged markers, used to test for this supposed virus, are not fit for purpose.

RT-PCR tests do not sequence the entire genome. They look for incidents of specific probe florescence to indicate the presence of sequences said to exist. These sequences are defined by MN908947.1 and the subsequent updates. These primers and probes could reveal nothing but RNA matches extracted from non-coding, sometimes called “junk,” DNA (cDNA.)

For example the SARS-CoV-2 S gene is meant to be highly specific to the SARS-CoV-2 virus genome. The target sequence is – TTGGCAAAATTCAAGACTCACTTTC. A microbial BLAST search returns 97 microbial matches with 100% identity sequence match. The lowest identity percentage match, within the top 100, is 95%. A human genome BLAST also finds a 100% sequence match to 86 human chromosome fragments.

No matter where you look in the supposed genome of SARS-CoV-2, there is nothing in the WHO’s test protocols that clearly identifies what it is. The whole genome could be false. The tests do not prove the existence of SARS-CoV-2. All they reveal is a soup of unspecified genetic material.

If so, as there are no isolates or purified samples of the virus, without a viable test, there is no evidence that SARS-CoV-2 exists. Therefore, nor is there any evidence that a disease called COVID 19 exists.

This infers that there is no scientific basis for any claims about COVID 19 case numbers, hospital admissions or mortality figures. All measures taken to combat this deadly virus are quite possibly founded upon nothing.

Conclusive Fraud

Fraud is a criminal act. The legal definition of fraud is:

“Some deceitful practice or willful device, resorted to with intent to deprive another of his right, or in some manner to do him an injury.”

The Legal definition of a conspiracy is:

“A combination or confederacy between two or more persons formed for the purpose of committing, by their joint efforts, some unlawful or criminal act”

It seems, those who claim we face a pandemic have not provided any evidence to show that a virus called SARS-CoV-2 causes a disease called COVID 19. All of the information strongly suggesting this possibility is readily available in the public domain. Anyone can read it.

For there to be a fraud the deceit must be wilful. The intention must be to deliberately deprive others of their rights or injure them in some other way. If there is evidence of collusion between individuals ad/or organisations to commit fraud, then this is a conspiracy (in Common Law jurisdictions) or a Joint Criminal Enterprise (JCE) under International Law.

It seems COVID 19 has been deliberately used as a casus belli to wage war on humanity. We have been imprisoned in our own homes, our freedom to roam restricted, freedom of speech and expression eroded, rights to protest curtailed, separated from loved ones, our businesses destroyed, psychologically bombarded, muzzled and terrorised.

Worse still, while there is no evidence of unprecedented all cause mortality, there were unseasonable spikes in deaths. These correlate precisely with Lockdown measures which saw the withdrawal of the health services we pay for and a reorientation of public health services to treat one alleged disease at the exclusion of all others.

Further, it is proposed by those who have forwarded the COVID 19 story, that this alleged disease provides justification for the complete restructuring of the global economy, our political systems, societies, cultures and humanity itself.

To be allowed to participate in their so called “new normal,” which is the wholesale transformation of our entire society without our consent, they insist we submit to their conditions.

These include, but aren’t limited to, bio-metric surveillance of everyone, the centralised control and monitoring of all of our transactions, oppressive business and social restrictions and an effective demand that we have no right to sovereignty over our own bodies. This constitutes the condition of slavery.

There is no doubt that we have been deprived of our rights and injured. In Common Law jurisdictions innocence is presumed, but the evidence that harm has been deliberately caused by an international conspiracy is overwhelming. Destructive policies, enacted by governments across the world, clearly originated among globalist think tanks and supranational institutions long before the emergence of this non existent pandemic.

In Napoleonic Code jurisdictions, guilt is presumed. In order for the accused conspirators to prove their innocent they must show that, despite their immeasurable resources, they have collectively been unable to access or understand any of the freely available evidence suggesting COVID 19 is a myth.

Those responsible for the crime of conspiracy to commit global fraud should be tried. If found guilty they should be imprisoned while the rest of us get on with trying to repair the damage they have already inflicted.



Author Iain Davis is an independent researcher and short filmmaker and the author of the new book, A Dangerous Ideology. See more of Iain’s work at his blog site In This Together and follow him at Twitter & Steemit & MINDS

 

Connect with Iain Davis at In This Together

 

 




The Germans Are Back!

It functions like a cult, totalitarianism. It creeps up on you, little by little, little lie by little lie, accommodation by accommodation, rationalization by rationalization … until one day you find yourself taking orders from some twisted little narcissistic nihilist on a mission to remake the entire world. You don’t surrender to it all at once. You do it over the course of weeks and months.

Imperceptibly, it becomes your reality. You do not recognize that you are in it, because everything you see is part of it, and everyone you know is in it … except for the others, who are not part of it. The “deniers.” The “deviants.” The “foreigners.” The “strangers.” The “Covidiots.” The “virus spreaders.”

 

The Germans Are Back!

by CJ Hopkins, Consent Factory, Inc.
November 22, 2020

 

Break out the Wagner, folks … the Germans are back! No, not the warm, fuzzy, pussified, peace-loving, post-war Germans … the Germans! You know the ones I mean. The “I didn’t know where the trains were going” Germans. The “I was just following orders” Germans. The other Germans.

Yeah … those Germans.

In case you missed it, on November 18, the German parliament passed a law, the so-called “Infection Protection Act” (“Das Infektionsschutzgesetz” in German) formally granting the government the authority to issue whatever edicts it wants under the guise of protecting the public health. The government has been doing this anyway — ordering lockdowns, curfews, travel bans, banning demonstrations, raiding homes and businesses, ordering everyone to wear medical masks, harassing and arresting dissidents, etc. — but now it has been “legitimized” by the Bundestag, enshrined into law, and presumably stamped with one of those intricate official stamps that German bureaucrats like to stamp things with.

Now, this “Infection Protection Act,” which was rushed through the parliament, is not in any way comparable to the “Enabling Act of 1933,” which formally granted the government the authority to issue whatever edicts it wanted under the guise of remedying the distress of the people. Yes, I realize that sounds quite similar, but, according to the government and the German media, there is no absolutely equivalence whatsoever, and anyone who suggests there is is “a far-right AfD extremist,” “a neo-Nazi conspiracy theorist,” or “an anti-vax esotericist,” or whatever.

As the Protection Act was being legitimized (i.e., the current one, not the one in 1933), tens of thousands of anti-totalitarian protesters gathered in the streets, many of them carrying copies of the Grundgesetz (i.e., the constitution of the Federal Republic of Germany), which the parliament had just abrogated. They were met by thousands of riot police, who declared the demonstration “illegal” (because many of the protesters were not wearing masks), beat up and arrested hundreds of them, and then hosed down the rest with water cannons.

The German media — which are totally objective, and not at all like Goebbels’ Ministry of Propaganda in the Nazi era — dutifully reminded the German public that these protesters were all “Corona Deniers,” “far-right extremists,” “conspiracy theorists,” “anti-vaxxers,” “neo-Nazis,” and so on, so they probably got what they deserved. Also, a spokesperson for the Berlin police (who bear absolutely no resemblance to the Gestapo, or the Stasi, or any other notorious official-ideology-enforcing goons) pointed out that their water cannons were only being used to “irrigate” the protesters (i.e., not being aimed directly at them) because there were so many “Corona Denier” children in their ranks.

According to the government, the German media, the intelligentsia, and, basically, anyone in public life who wants to remain there, these “Corona Deniers” are becoming a problem. They are spreading baseless “conspiracy theories” that are threatening the public health and causing distress to the German people (e.g., that the vast majority of those infected suffer only mild to moderate flu symptoms or, more commonly, no symptoms at all, and that over 99.7% survive). They are walking around without medical-looking masks, which is making a mockery of the government and media’s efforts to convince the public that they are under attack by an apocalyptic plague. They are posting scientific facts on the Internet. They are staging these protests and otherwise challenging the government’s right to declare a “health emergency,” suspend the German constitution indefinitely, and rule society by decree and force.

Despite the German government and media’s efforts to demonize anyone not obediently parroting the official “New Normal” narrative as a “dangerous neo-Nazi Corona Denier,” the “Corona Denialism” movement is growing, not just in Germany, but all throughout Europe. Clearly, the time is coming for Germany to take stronger measures against this threat. The health of the Vater … uh, the nation, is at stake! Fortunately, this “Infection Protection Act” will provide the government with the authority it needs to conceive and carry out some kind of … well, you know, solution. Allowing these degenerate anti-social deviants to run around challenging the German government’s absolute power is not an option, not in a time of national health emergency! These “Nazi-sympathizing Corona Deniers” must be rooted out and dealt with, mercilessly!

I’m not privy to the details, of course, but, it being Germany, I imagine some sort of Special Task Force has been set up to efficiently deal with the “Corona Denier Problem.” Steps are clearly already being taken. Alternative media outlets are being deplatformed (because, according the media, they are “Querfront magazines”). In April, a well-known dissident lawyer was forcibly committed to a psychiatric ward (but the authorities and the media assured us that it had nothing to do with her dissident views, or with the lawsuits she was filing against the government; she just coincidentally became completely paranoid). Heavily-armed police are arresting YouTubers (although it isn’t clear exactly what for, as the authorities have released no details and the mainstream media is not reporting it).

In the run-up to the 29 August demonstration, at which the government granted some neo-Nazis de-facto permission to “storm the Reichstag,” so that the media could film it and discredit the real protest, one German politician went so far as to call for “Corona Deniers” to be deported … presumably on trains, somewhere to the east.

But seriously, I don’t mean to pick on the Germans. I love the Germans. I live in Germany. And they’re hardly the only ones implementing the new pathologized totalitarianism. It’s just that, given their not-too-distant history, it is rather depressing, and more than a little frightening, to watch as Germany is once again transformed into a totalitarian state, where the police are hunting down the mask-less on the streets, raiding restaurants, bars, and people’s homes, where goose-stepping little Good German citizens are peering into the windows of Yoga studios to see if they are violating “social distancing rules,” where I can’t take a walk or shop for groceries without being surrounded by hostile, glaring, sometimes verbally-abusive Germans, who are infuriated that I’m not wearing a mask, and otherwise mindlessly following orders, and who robotically remind me, “Es ist Pflicht! Es ist Pflicht!”

Yes, I am fully aware that it is “Pflicht.” If I had any doubt as to whether it was “Pflicht,” the Berlin Senat cleared that up when they commissioned and ran this charming advert instructing me to fuck myself if I don’t want to follow their “Corona orders” and profess my belief in their new Big Lie.

And OK, before the Literalist Society starts flooding me with outraged emails, no, I’m not calling these Germans “Nazis.” I am calling them “totalitarians.” Which, at this point, given everything we know, if you’re still pretending that this coronavirus in any way warrants the increasingly ridiculous “emergency measures” we are being subjected to, I’m sorry, but that is what you are.

You may not believe that is what you are … totalitarians never do, not until it is far too late.

It functions like a cult, totalitarianism. It creeps up on you, little by little, little lie by little lie, accommodation by accommodation, rationalization by rationalization … until one day you find yourself taking orders from some twisted little narcissistic nihilist on a mission to remake the entire world. You don’t surrender to it all at once. You do it over the course of weeks and months. Imperceptibly, it becomes your reality. You do not recognize that you are in it, because everything you see is part of it, and everyone you know is in it … except for the others, who are not part of it. The “deniers.” The “deviants.” The “foreigners.” The “strangers.” The “Covidiots.” The “virus spreaders.”

See, although the narratives and symbols may change, totalitarianism is totalitarianism. It doesn’t really matter which uniform it wears, or which language it speaks … it is the same abomination. It is an idol, a simulacrum of the hubris of man, formed from the clay of the minds of the masses by megalomaniacal spiritual cripples who want to exterminate what they cannot control. And what they want to control is always everything. Everything that reminds them of their weakness and their shame. You. Me. Society. The world. Laughter. Love. Honor. Faith. The past. The future. Life. Death. Everything that will not obey them.

Unfortunately, once this kind of thing gets started, and reaches the stage we are currently experiencing, more often than not, it does not stop, not until cities lie in ruins or fields are littered with human skulls. It might take us ten or twelve years to get there, but, make no mistake, that’s where we’re headed, where totalitarianism is always headed … if you don’t believe me, just ask the Germans.

 

Support the work of CJ Hopkins
Connect with CJ Hopkins at Consent Factory, Inc.


cover image credit WikiImages / pixabay




James Corbett Explains The Great Reset on The Highwire

James Corbett Explains The Great Reset on The Highwire

by James Corbett, The Corbett Report
November 23, 2020

 

via The Highwire:

HighWire goes to a place we’ve never gone before.

Is there something more behind the global coronavirus response?

Why are so many leaders using the same language when talking about the future of their countries and the world?

What is the Great Reset?

Journalist James Corbett joins Del to separate facts from fiction.

Watch on Archive / BitChute / LBRY / Minds / YouTube or Download the mp4

SHOW NOTES:

The Highwire with Del Bigtree

Your Guide to The Great Reset

The Great Reset book

The Great Reset | Launch session 3 June 2020

Yuval Noah Harari: the world after coronavirus | Free to read

COVID-19 Transformation Map

You Won’t Believe What They’re Planning To Do With “Vaccines”

Grover on The Great Reset podcast

Solutions on The Corbett Report




Ron Paul: On Coronavirus, We Must Not Allow Politics to Dictate Science

On Coronavirus, We Must Not Allow Politics to Dictate Science

by Ron Paul, Ron Paul Institute
November 23, 2020

 

In these past couple of weeks, two important studies have been published that could dramatically increase our understanding of the Covid-19 disease. Adding to the science of how we understand and treat this disease is something that should be welcomed, because properly understood it can save lives.

The only problem is that because the results from these two studies challenge what the media has established as conventional wisdom about the disease, the reports are at best being ignored and at worst being openly distorted by the mainstream media.

This is in my view a dangerous and foolish subjugation of science to politics and it may well end up causing many more unnecessary deaths.

First is the Danish mask study, which was completed several months ago but was only recently published in a peer-reviewed journal. The study took two groups and gave the first group masks to wear with instruction on how they should be used. The other group was the mask-free control group.

The study found that coronavirus spread within the statistical margin of error in each group. In other words, wearing the mask did little if anything to control the spread of the virus.

As the wearing of masks is still being mandated across the country and the globe, this study should be reported as an important piece of counter-evidence. At the very least it might be expected to invite a rush of similar studies to refute or confirm the results.

However, while mostly ignored by the media, when it was covered the spin on the study was so strange that the conclusion presented was opposite to the findings. For example, the Los Angeles Times published an article with the headline, “Face mask trial didn’t stop coronavirus spread, but it shows why more mask-wearing is needed.”

Similarly, a massive new study conducted in Wuhan, China, and published in the respected scientific journal Nature, reports that asymptomatic persons who have tested positive for Covid-19 do not pass on the infection to others. Considering that mask mandates and lockdowns are all based on the theory that asymptomatic “positive cases” can still pass on the sickness, this is potentially an important piece of information to help plan a more effective response to the virus.

At the least, again, it should stimulate additional, far-reaching studies to either confirm or deny the Wuhan study.

We do know, based on information from widely-accepted sources as the CDC and World Health Organization, that lockdowns can have a very serious negative effect on society. On July 14th, CDC Director Robert Redfield told a seminar that lockdowns are causing more deaths than Covid.

So if there is a way to continue fighting Covid and protecting those most at risk while drastically reducing deaths related to lockdowns, isn’t this worth some consideration? Isn’t this worth at least some further research?

Well, not  according to the mainstream media. They have established their narrative and they are not about to budge. The two studies are fatally flawed, they report. Of course that might be the case, but isn’t that an argument to attempt to replicate the studies to prove it?

That would be the scientific approach. Sadly, “trust the science” has come to mean “trust the narrative I support.” That is a very dangerous way of thinking and can prove to be deadly.




How to Celebrate Thanksgiving in the Midst of Toxic Politics and COVID-19 Lockdowns

How to Celebrate Thanksgiving in the Midst of Toxic Politics and COVID-19 Lockdowns

by John W. Whitehead, The Rutherford Institute
November 23, 2020

 

“War is over. If you want it.”—John Lennon

If ever there were a year filled with an abundance of bad news and a shortage of good news, 2020 would take the prize. Between the toxic political theater, pandemic scares, nationwide lockdowns that smack of martial law, a rollercoaster economy, and the ever-present menace of the police state, it’s been a hard, heart-wrenching, stomach-churning kind of year overrun with too much hate and too little tolerance.

It’s been a year in which tyranny took a few more steps forward, freedom got knocked down a few more notches, and politics and profit margins took precedence over decency, compassion and human-kindness.

Now we find ourselves at this present moment, overwhelmed by all that is wrong in the world and missing the fellowship of family and friends kept apart by COVID-19 restrictions and concerns.

No wonder this Thanksgiving finds so many struggling to reflect and give thanks for what is good. After all, how do you give thanks for freedoms that are constantly being eroded? How do you express gratitude for one’s safety when the perils posed by the American police state grow more treacherous by the day? How do you come together as a nation in thanksgiving when the powers-that-be continue to polarize and divide us into warring factions?

Here’s what I’ve learned from living in a small community (population 1500) for the past year: you don’t have to agree on politics, or subscribe to the same religious beliefs, or have the same demographic makeup in order to live peaceably with one another.

These small-town people don’t have a preponderance of fancy cars or advanced degrees or six-figure salaries or committees aimed at discussing problems to death, and yet they have mastered the art of getting along. They make no secret about their views on politics and religion and anything else on their minds, and yet they remain friendly—neighborly—respectful of those with opposing views, even when they wholeheartedly disagree.

Yes, America, there is life beyond politics and it can be wonderful if you just give it a chance.

Here’s what I suggest: this Thanksgiving, do yourselves a favor and turn off the talking heads, tune out the politicians, and take a deep breath. Then try this exercise in gratitude: find something to be thankful for about the things and people in your community for which you might have the least tolerance or appreciation. Instead of just rattling off a list of things you’re thankful for that sound good, dig a little deeper and acknowledge the good in those you may have underappreciated or feared.

When it comes time to giving thanks for your good fortune, put your gratitude into action: pay your blessings forward with deeds that spread a little kindness, lighten someone’s burden, and brighten some dark corner.

Engage in acts of kindness. Smile more. Fight less. Build bridges. Refuse to let toxic politics define your relationships. Focus on the things that unite instead of that which divides.

Do your part to push back against the meanness of our culture with conscious compassion and humanity. Moods are contagious, the good and the bad. They can be passed from person to person. So can the actions associated with those moods, the good and the bad.

Even with COVID-19 restrictions in place throughout the country, there is still so much good that can be done to help those in need.

Be a hero, whether or not anyone ever notices.

Acts of benevolence, no matter how inconsequential they might seem, can spark a movement.

Each of us has an inner hero we can draw upon in an emergency,” concludes psychologist Philip Zimbardo. “If you think there is even a possibility that someone needs help, act on it. You may save a life. You are the modern version of the Good Samaritan that makes the world a better place for all of us.”

All it takes is one person breaking away from the fold to change the dynamics of a situation. “Once any one helps, then in seconds others will join in because a new social norm emerges,” notes Zimbardo.

This is what Zimbardo refers to as “the power of one.”

“If you find yourself in an ambiguous situation, resist the urge to look to others and go with your gut instinct,” advises Melissa Burkley in Psychology Today. “If you think there is even a possibility that someone is in need, act on it. At worst, you will embarrass yourself for a few minutes, but at best, you will save a life.”

In other words, don’t turn away from suffering. Even smiling at a stranger in these fearful times can be a revolutionary act.

All it takes is one person to start a chain reaction.

For instance, a few years ago in Florida, a family of six—four adults and two young boys—were swept out to sea by a powerful rip current in Panama City Beach. There was no lifeguard on duty. The police were standing by, waiting for a rescue boat. And the few people who had tried to help ended up stranded, as well.

Those on shore grouped together and formed a human chain. What started with five volunteers grew to 15, then 80 people, some of whom couldn’t swim.

One by one, they linked hands and stretched as far as their chain would go. The strongest of the volunteers swam out beyond the chain and began passing the stranded victims of the rip current down the chain.

One by one, they rescued those in trouble and pulled each other in.

There’s a moral here for what needs to happen in this country if we only can band together and prevail against the riptides that threaten to overwhelm us.

As I make clear in my book Battlefield America: The War on the American People, there may not be much we can do to avoid the dismal reality of the police state in the long term—not so long as the powers-that-be continue to call the shots and allow profit margins to take precedence over the needs of people—but in the short term, there are things we can all do right now to make this world (or at least our small corners of it) a little bit kinder, a lot less hostile and more just.

It’s never too late to start making things right in the world.

 

cover image credit Gaertringen /pixabay




“Burn That Mask! Burn That Mask!” – Huntington Beach Protesters March In Defiance Of California’s New Curfew

“Burn That Mask! Burn That Mask!” – Huntington Beach Protesters March In Defiance Of California’s New Curfew

by Tyler Durden, ZeroHedge
November 22, 2020

 

In Huntington Beach, southern California, Protesters took to the streets Saturday night, minutes after California’s new curfew went into effect, to speak out against Gov. Gavin Newsom’s latest coronavirus curfew.

According to CBS Los Angeles, non-essential work and all social gatherings must stop at 2200 hours to 0500 hours. The demonstration billed as “Curfew Breakers” began at 2201 hours, precisely one minute after the new curfew went into effect on the beachside community. The curfew was also imposed on 41 of California’s 58 counties to mitigate the spread of COVID-19.

Video on Twitter surfaced late Saturday – showing hundreds of demonstrators – many with American and Trump 2020 flags – lining the streets of Hunting Beach to denounce the new curfew.

Judging by videos on Twitter, the demonstration seemed more like a New Year’s Eve-style celebration.

Despite the protest’s modest size, RT News said it began “trending on Twitter, as both supporters and critics weighed in on the small act of civil disobedience.”

Lee Greenwood’s patriotic song, “God Bless the USA,” could be heard playing in one video as patriotic flags were waved.

Demonstrators also burned coronavirus masks as a crowd was heard chanting: “Burn that mask! Burn that mask!” Folks at the rally must have read the latest study from Denmark, outlining how masks do very little to stop COVID-19.

CBS Los Angeles said Orange County sheriffs and other Southern California law enforcement officials did not enforce the curfew.

The demonstration comes as the state – like many others across the US – has recorded a rapid surge of virus cases, hospitalizations, and deaths.

More protests, not just in California, but in other parts of the country, are expected in the weeks ahead as state and local governments enforce more draconian measures to mitigate the virus spread.

With anti-curfew/lockdown protesters out in the streets on both sides of the Atlantic as the pandemic ravages the Western world and could result in a double-dip recession – the socio-economic implosion, along with the public health crisis, is expected to continue through early 2021.

 

Follow Tyler Durden at ZeroHedge




Canadian MPP Randy Hillier at Cornwall March for Freedom, November 21. 2020: Our Future Is Determined by Us, Not by a Virus or Government

“Where are we going? The future is unknown. We don’t know what the future holds.  But we do know that we are the authors of our own future. It is not predetermined by others. It is not predetermined by a virus or our government. It is us. ” ~ Randy Hillier

 

Randy Hillier Cornwall Freedom March November 21 2020

Cornwall March for Freedom: “When tyranny becomes law, resistance becomes duty.”


Questions: Proof or Propaganda?

by Randy Hillier
November 17, 2020

After the Toronto Sun published how many COVID patients are taking up UHN hospital beds in Toronto, I asked the Deputy Premier if she could provide or verify the Sun’s numbers. I am not sure if she couldn’t hear me across the aisle, but I didn’t hear a single number, just propaganda.

It appears the Premier, his Caucus, and Public Health are content with spreading alarm and fear about a second wave based upon faulty projection models and trumped up case numbers. Like the Liberals in Ottawa, our government can’t even read simple numbers.

https://torontosun.com/opinion/columnists/lilley-ontario-doing-well-on-covid-despite-what-some-experts-say

If you agree that the alarm is exaggerated, contact the Premier, your MPP, local representatives, and public health unit. Let them know you are not buying Ford’s propaganda and you want to see an end to all lockdowns.

Premier: doug.ford@pc.ola.org or premier@ontario.ca
or 416-325-1941
Find Your MPP: https://www.ola.org/en/members

Connect with Randy Hillier at RandyHillierMPP.com

Randy Hillier currently represents the riding of Lanark-Frontenac-Kingston as an Independent member of the legislature.




Buffalo, NY Business Owners Chase Out Health & Sheriff Departments: “We Do Not Comply!”, “Get Out!”

Buffalo, NY Business Owners Chase Out Health & Sheriff Departments: “We Do Not Comply!”, “Get Out!”

by RealTimWalton YouTube channel
November 20, 2020

 

Original video available at RealTimWalton YouTube channel.

Buffalo, New York Business Owners Stand Up to Cuomo Lockdown Orders; Chase Out Sheriff & Health Dept

Buffalo New York Business Owners Stand Up to Cuomo Lockdown Orders; Chase Out Sheriff & Health Dept who tried to shutdown meeting of owners trying to survive.

[As a service to protect truth from censorship & to share widely, mirrored copies of this video are available at Truth Comes to Light BitChute, Brighteon, Lbry/Odysee channels. All credit, along with our sincere thanks, goes to the original source of this video. Please follow links provided to support their work.]




They Think You’re Stupid

They Think You’re Stupid

by Paul Joseph Watson, Summit News
November 22, 2020

 

Available at Paul Joseph Watson BitChute or YouTube channels.

Subscribe to SUMMIT NEWS: http://summit.news/newsletter

cover image credit dimitrisvetsikas1969 / pixabay