Invasion of the Body Snatchers: Psychological Warfare Disguised as a Pandemic Threat

Invasion of the Body Snatchers: Psychological Warfare Disguised as a Pandemic Threat

 

“Look! You fools! You’re in danger! Can’t you see? They’re after you! They’re after all of us! Our wives…our children…they’re here already! You’re next!”
—Dr. Miles Bennell, Invasion of the Body Snatchers (1956)

It’s like Invasion of the Body Snatchers all over again.

The nation is being overtaken by an alien threat that invades bodies, alters minds, and transforms freedom-loving people into a mindless, compliant, conforming mob intolerant of anyone who dares to be different, let alone think for themselves.

However, while Body Snatchers—the chilling 1956 film directed by Don Siegel—blames its woes on seed pods from outerspace, the seismic societal shift taking place in America owes less to biological warfare reliant on the COVID-19 virus than it does to psychological warfare disguised as a pandemic threat.

As science writer David Robson explains:

Fears of contagion lead us to become more conformist and tribalistic, and less accepting of eccentricity. Our moral judgements become harsher and our social attitudes more conservative when considering issues such as immigration or sexual freedom and equality. Daily reminders of disease may even sway our political affiliations… Various experiments have shown that we become more conformist and respectful of convention when we feel the threat of a disease… the evocative images of a pandemic led [participants in an experiment] to value conformity and obedience over eccentricity or rebellion.

This is how you persuade a populace to voluntarily march in lockstep with a police state and police themselves (and each other): by ratcheting up the fear-factor, meted out one carefully calibrated crisis at a time, and teaching them to distrust any who diverge from the norm.

This is not a new experiment in mind control.

The powers-that-be have been pushing our buttons and herding us along like so much cattle since World War II, at least, starting with the Japanese attacks on Pearl Harbor, which not only propelled the U.S. into World War II but also unified the American people in their opposition to a common enemy.

That fear of attack by foreign threats, conveniently torqued by the growing military industrial complex, in turn gave rise to the Cold War era’s “Red Scare.” Promulgated through government propaganda, paranoia and manipulation, anti-Communist sentiments boiled over into a mass hysteria that viewed anyone and everyone as suspect: your friends, the next-door neighbor, even your family members could be a Communist subversive.

This hysteria, which culminated in hearings before the House Un-American Activities Committee, where hundreds of Americans were called before Congress to testify about their so-called Communist affiliations and intimidated into making false confessions, also paved the way for the rise of an all-knowing, all-seeing governmental surveillance state.

The 9/11 attacks followed a similar script: a foreign invasion mounts an attack on an unsuspecting nation, the people unite in solidarity against a common foe, and the government gains greater war-time powers (read: surveillance powers) that, conveniently enough, become permanent once the threat has passed.

The government’s scripted response to the COVID-19 pandemic has been predictably consistent: once again, in order to fight this so-called “foreign” foe, the government insists it needs even greater surveillance powers.

As we’ve seen since 9/11 and more recently with the COVID lockdowns, those in power have always had a penchant for enacting extreme measures to combat perceived threats. However, unlike the modern America police state, the American government circa the 1950s did not have at its disposal the arsenal of invasive technologies that are such an intrinsic part of our modern surveillance state.

Today, we are watched and tracked 24/7; data is collected on us at an alarming rate by governmental and corporate entities; and with the help of powerful computer programs, American domestic intelligence agencies sweep our websites, listen in on our telephone calls and read our text messages at will.

Now with the COVID pandemic and its offshoots such as contact tracing and immunity passports, the governmental landscape is even more invasive.

Yet no matter the threat, the underlying principle remains the same: can we hold onto our basic freedoms and avoid succumbing to the soul-sucking dredge of conformity that threatens our very humanity?

This conundrum is at the heart of the 1956 classic Invasion of the Body Snatchers, which was based on a 1954 science fiction novel by Jack Finney (and later remade into an equally chilling 1978 film by Philip Kaufman).

Body Snatchers not only captured the ideology and politics of its post-war era but remains timely and relevant as it relates to the worries that plague us today. Filmed with only seven days of rehearsal and 23 days of actual shooting, Body Snatchers is considered one of the great science fiction classics.

Body Snatchers is set in a small California town which has been infiltrated by mysterious pods from outer space that replicate and take the place of humans who then become conforming non-individuals. Miles Bennell, the main character, is a local doctor who resists the invaders and their attempts to erase humanity from the face of the earth.

At the very least, the film conveys a double meaning, serving as both a mirror of a particular moment in history and a compass pointing to a growing societal illness. Following World War II with the emerging military empire, the atomic bomb and the Korean War, Americans were confused and neurotically preoccupied with domestic threats, the polio pandemic and international political events, not much different from today’s populace preoccupied with domestic and international political drama, terrorism and the COVID-19 pandemic.

Yet Siegel’s film delves beneath the surface to confront an even more sinister threat: the dehumanization of individuals and the horrifying possibility that humanity could become infused as part of the societal machine.

Central to the film is one key speech delivered by Bennell while hiding from the aliens:

In my practice, I see how people have allowed their humanity to drain away…only it happens slowly instead of all at once. They didn’t seem to mind…. All of us, a little bit. We harden our hearts…grow callous…only when we have to fight to stay human do we realize how precious it is.

As Siegel makes clear, it is not Communists or terrorists or even viral pandemics that threaten our well-being. The real enemy is invasive governmental measures—something we now see happening across the country—and, thus, totalitarian conformity. And resistance must be against all government measures that threaten our civil liberties and against all kinds of conformity, no matter the shape, size or color of the package it comes in.

When all is said and done, however, the real threat to freedom (in the fictional world of Body Snatchers and in our present-day America) is posed by an establishment—be it governmental, corporate or societal—that is hostile to individuality and those who dare to challenge the status quo.

The mob hysteria, sense of paranoia, fascist police and the witch hunt atmosphere of the film mirror the ills of a 1950s America that is frighteningly applicable to present American society.

Acknowledging that Body Snatchers portrayed the conflict between individuals and varied forms of mindless authority, Siegel stated, “I think the world is populated by pods and I wanted to show them.” He explained:

People are pods. Many of my associates are certainly pods. They have no feelings. They exist, breathe, sleep. To be a pod means that you have no passion, no anger, the spark has left you…of course, there’s a very strong case for being a pod. These pods, who get rid of pain, ill-health and mental disturbances are, in a sense, doing good. It happens to leave you in a very dull world but that, by the way, is the world that most of us live in. It’s the same as people who welcome going into the army or prison. There’s regimentation, a lack of having to make up your mind, face decisions…. People are becoming vegetables. I don’t know what the answer is except an awareness of it.

All of the threats to freedom documented in my book Battlefield America: The War on the American People came about because “we the people” stopped thinking for ourselves and relinquished control over our lives and our country to government operatives who care only for money and power.

While the specific game plan for turning things around is complicated by a police state that wants to keep us at a disadvantage, the solution is relatively simple: Don’t be a pod person. Pay attention. Question everything. Dare to be different. Don’t follow the mob. Don’t let yourself become numb to the world around you. Be compassionate. Be humane. Most of all, think for yourself.

 

cover image credit  Cdd20 / pixabay



A Masked Society Is a Slave Society

A Masked Society Is a Slave Society

by Gary D. Barnett, GaryDBarnett.com
December 7, 2020

 

“The timid civilized world has found nothing with which to oppose the onslaught of a sudden revival of barefaced barbarity, other than concessions and smiles.”

~ Aleksandr I. Solzhenitsyn, Anne Applebaum (2007). “The Gulag Archipelago Volume 2: An Experiment in Literary Investigation”, Harper Perennial Modern Classics

It is rather obvious that the wearing of a mask at the demand of the state has become the single signifying behavior that exposes the level of obedience to power that is necessary in order for the ruling class to gain total control. This may seem to be a simplistic analysis, and in many ways it is, but it has served as the most important gauge of the psyche of the average citizen. This gauge has been the basis of many despicable policy decisions made by the rulers and their pawns in government. If the people can be made to obey on command totally ridiculous mandates, orders that are completely illogical on their face, then they can be easily fooled into giving up their freedom. This is done through fear mongering, even in light of the fact that there is nothing to fear. It is all illusion, and therefore it is clear that it is simply a staged ploy meant to gain acquiescence from the masses, so that power can be gained and control solidified.

Just yesterday, the possible new president, Joe Biden, said he would ask all Americans to wear masks for 100 days once elected. This would serve as a federal expansion of the local mask commands to further gauge the public’s obedience level, so as to better understand how far the government could push its agendas. So far, those agendas have advanced almost unimpeded, and at lightening speed, and this is set to continue. With any additional compliance by even more Americans, they would show that they were ripe for even greater and more restrictive tyranny. This sounds almost like a game. Biden told the Communist News Network (CNN) that “he believed there would be a “significant reduction” in Covid-19 cases if every American wore a face covering.” This statement is asinine on its face! He also said he would order masks to be worn in all government buildings. While there is no apparent legal authority for a president to force mask wearing, the consequences of such action as threatened would certainly encourage the useless governors and all other local politicians to expand enforcement. This would serve as a recipe for much additional restriction and regulation.

There is no evidence whatsoever that wearing a mask can protect against any viral agent, and even the evil Fauci stated on 60 Minutes last March that: “There’s no reason to be walking around with a mask. Face masks might make people “feel a little bit better,” but they simply don’t protect people and, instead, bring “unintended consequences.” “When it comes to preventing coronavirus, public health officials have been clear: Healthy people do not need to wear a face mask to protect themselves from COVID-19.” In reality, wearing masks depletes vital oxygen, impedes breathing, increases intake of expelled carbon dioxide, causes extreme stress, harms the immune system, and increases the risk of sickness and the possibility of viral replication in the body. In other words, no healthy person should ever be wearing a mask, especially long term.

Once one has proper and truthful information, it should be abundantly clear that mandated mask wearing is nothing more than a test to determine the weakness and gullibility of the people at large. But this test, insisted on by government agents, and meant only to judge the compliance level of its citizens, does deadly harm. This is and has been known by the government advocates of these policies all along. There is much liability here, and the public should hold these criminals to account. One way to stop tyranny is to reverse the risk by placing it on the perpetrators of this fraud. Many should be jailed!

One way to understand what mask wearing is all about, is to just look around. As I go about my normal business, and travel around the state and country, I see mass acceptance of wearing masks. At times, I am the only one not sporting some sort of face covering. Many have on filthy masks; masks that are very loose, masks worn below the nose and at times even below the mouth. Others have a loose bandana, or one of the wide-open face shields. No one is protected, and in fact is making himself more susceptible to sickness by donning these worthless face diapers. If any actually thought that a contagious and deadly killer virus was evident, they would never leave their house in the first place for fear of death. It is as if most are just trying to fit in, to not rock the boat, and to not have any conflict. They do this with the understanding that there is really nothing to fear, but they take orders anyway because they are terrified to be different. This attitude by the herd is well known to the ruling class, and that is much of the reason that this mask nonsense has been successful.

The next government test to come to gauge compliance will be much more devastating. This publically accepted mask fiasco has given the powerful ammunition to go to the next step. That next step will be the release of a toxic and virulent vaccine. The mask wearing has been very harmful in many ways, but the vaccine will be deadly.

Consider that all the terror inflicted by the claimed ruling ‘elites’ through their pawns in government has been done in steps over a long period of time. Once the general population accepts minor restrictions, more demanding restrictions will always follow. This fake Covid situation began last February in the U.S. with dire predictions. Once fear was more universal, stronger measures were forthcoming. Then a few lockdowns were mandated, and a national emergency was declared. Once this was in place, the state governors began to also declare emergency status, and began to shut down their states. Next, the demand to close small businesses was nationwide. Social distancing mandates began, and schools were closed. As time went by, more demands and restrictions were ordered, and threats of extension of lockdown policies became common. The ‘casedemic’ was then launched in order to create out of thin air another wave of panic. Mandatory mask wearing and testing became rampant, and now the public is ripe for a killer vaccine.

This was all planned for many years, but this “Great Reset” is now getting closer to fruition every day. Once the next mask mandate comes, and acceptance by this pathetic society is evident, the more dangerous plans will be unleashed.

Take off your mask! Do not put it on again. Refuse to be a stooge for the state, and reverse this devastating plot against humanity. When all take off their masks, the state will become impotent, and will be forced to back down. This will happen because it will indicate mass disobedience, and therefore will help nullify all state orders. Those wearing masks will then be in the minority, while the new non-mask wearers will again be the majority, and then they can still be a part of the herd.

Consider masks the sign of things to come. Wearing them means extreme tyranny, and taking them off means freedom. The choice is yours.

“The doctrine of blind obedience and unqualified submission to any human power, whether civil or ecclesiastical, is the doctrine of despotism.”

~ Sarah Grimke, Angelina Grimke (2015). “On Slavery and Abolitionism: Essays and Letters”, p.97, Penguin

Source links:

Here, here, here, here, and here.

The Best of Gary D. Barnett



NYU Professor Under Fire for Mask Comments Files Libel Lawsuit

NYU Professor Under Fire for Mask Comments Files Libel Lawsuit

by Janet Phelan
sourced from Activist Post
December 4, 2020

 

A NYU professor has filed a lawsuit against a number of his academic colleagues, alleging libel after an uproar of official reaction ensued when one of his students called for his firing based on in-class comments he had made on the utility of masks.

The pleadings, filed in the Supreme Court of the state of New York on November 30, 2020, stated that a letter signed by nineteen of Professor Mark Crispin Miller’s academic colleagues included “numerous misstatements of ‘fact’ maliciously intended to portray plaintiff in a negative light” and intended to “diminish, if not destroy, his professional reputation and standing.”

In a modern day rendition of the silencing of Socrates, the furor surrounding Professor Miller began shortly into this semester at New York University. Miller has for many years taught a course on propaganda in the Department of Media, Culture and Communication, in which he discusses current events and historical trends in the light of their propagandist purposes. This semester, he states he had encouraged students to research the scientific utility of masks.

One student took public issue with Miller’s mask comments and launched a Twitter campaign against him, stating that he was “spouting dangerous rhetoric that serves to cultivate fear and confusion during a pandemic” and called for his firing.

I hope @nyuniversity, @nyusteinhardt, and @mccNYU agree that this professor should not be trusted with educating and advising students, and I hope they take immediate steps to relieve him of these duties. 8/

— Julia Jackson (@julia_jacks) September 21, 2020

First, his department chair, Rodney Benson, tweeted his thanks, saying “We as a department have made this a priority, and are discussing next steps.”

At that point, the University disseminated a cautionary email to Miller’s students, which he states was sent out prior to any conference or consultation as to the veracity of Jackson’s claims. According to Miller, Department Chair Benson then pressured him to cancel the propaganda course for next semester.

A month later, the letter from Miller’s colleagues, condemning Miller’s actions, was sent to Dean Jack Knott and to Provost Katherine Fleming.

And Miller became the subject of a review board hearing.

Professor Miller’s political activities and viewpoints have sparked prior attention from NYU. An effort spearheaded by Miller to stop a physical expansion by NYU ended up in court, several years ago. He is also a named plaintiff in a class action suit concerning NYU’s mismanagement of the faculty’s retirement plans.

Earlier this year, Miller was called in to the Office of Equal Opportunity to explain some comments he had made in articles concerning transgender politics, including this one. Miller has unequivocally stated that he bears no animus towards transgender individuals and that his comments reflected concerns that the transgender movement had eugenics implications. He was quickly exonerated by the OEO concerning these statements.

Interestingly, the letter from the NYU colleagues to the University tries to resurrect these concerns and states that Miller has engaged in “direct mockery and ridicule of trans individuals” as well as “discrimination” and that he has created “an unsafe learning environment.” While paradoxically stating their support for academic freedom, the signers of this letter, all of whom are academics “…call on Steinhardt and University leadership to publicly support the NYU community and undertake an expedited review, as per the Faculty Handbook and Title IV, of Professor Miller’s intimidation tactics, abuses of authority, aggressions and microaggressions, and explicit hate speech, none of which are excused by academic freedom and First Amendment protections.” Curiously, the letter gives no concrete examples to support these allegations.

Read more…

 

cover image credit Cdd20 / pixabay

 



Will Face Masks Cause Facial Deformities in Children?

Will Face Masks Cause Facial Deformities in Children?

by John C. A. Manley, MuchAdoAboutCorona.ca
December 3, 2020

 

“When wearing a mask, most of us breathe with our upper chest muscles and with our mouth open,” states Children’s Minnesota on their website. While the hospital admits this can cause “increased stress and anxiety” there are other more long-lasting concerns.

According to a paper, in the peer-reviewed journal General Dentistry, “children’s whose mouth breathing is untreated” may develop the following deformities:

  • long, narrow faces
  • narrow mouths
  • high palatal vaults
  • misalignment between the teeth of the two dental arches
  • gummy smiles

As well as “many other unattractive facial features.”

Yet, how many children are being taught how to breathe while wearing a mask? Instead, many (if not most) are sucking in air through their mouth, as an instinctual reaction to the rise in carbon dioxide. This lowers the position of their tongue, which is key factor in normal facial development.

As the author of the paper, Dr. Yosh Jefferson, DMD, states: “If mouth breathing is treated early, its negative effect on facial and dental development and the medical and social problems associated with it can be reduced or averted.”

Instead, face masks may very well exacerbate the problem leading to a generation of deformed children. Because, it’s not just the mouth breathing. How will a growing face and two developing ears respond to a muzzle stretched around it for hours each day?

And, for what? There is no proof masks are effective at stopping infection. And, even if they were, children are practically immune from COVID-19 (a deadly disease that oddly focuses on old people who were on the verge of dying already).

But don’t worry, kids, if you grow up with an odd looking face all you have to do is… keep wearing your mask. No one will notice.

Facial deformities: Yet another reason to stop the masking madness.

 

John C. A. Manley has spent over a decade ghostwriting for medical doctors, as well as naturopaths, chiropractors and Ayurvedic physicians. He publishes the COVID-19(84) Red Pill Posts – an email-based newsletter dedicated to preventing the governments of the world from using an exaggerated pandemic as an excuse to violate our freedom, health, privacy, livelihood and humanity.  You can visit his website at: MuchAdoAboutCorona.ca



Lockdowns Are Based on Fraud: Open Letter to People Who Want Freedom

Lockdowns Are Based on Fraud: Open Letter to People Who Want Freedom

by Jon Rappoport, No More Fake News
December 3, 2020

 

This article is arranged so you see the fraud in more detail as you read further.

QUICK OVERVIEW

The lockdowns are based on high levels of COVID cases.

“We have so many new cases, we have to lock down.”

This claim is based on the diagnostic PCR test.

The more tests you do, the more positive results come up. A positive result is taken to mean: the person is infected with the virus.

But overwhelmingly, these so-called “infected” people have no symptoms. They are healthy. Nevertheless, each one is called a “COVID case.” This is absurd.

A case should mean the person has clinical symptoms; he is sick.

These people aren’t sick, and there is no indication they will get sick.

So…expand testing, test millions of people, obtain results claiming “infection,” call all these healthy people “cases,” and order lock downs.

This is a straight-out con. The real goal is lockdowns and economic devastation.

IS THE PCR TEST DECEPTIVE?

You need one piece of background here.

The PCR test is run in “cycles.” Each cycle is a quantum leap in amplifying or magnifying the original tiny, tiny piece of material taken from the patient’s swab sample. It’s like blowing up a small photo to an amazing size.

The question is: how many cycles should the PCR test be run at? This is vital issue, because the number of cycles changes the result.

July 16, 2020, podcast, “This Week in Virology” [1]: Tony Fauci makes a point of saying the PCR COVID test is useless and misleading when the test is run at “35 cycles or higher.” A positive result, indicating infection, cannot be accepted or believed.

Here, in techno-speak, is an excerpt from Fauci’s key quote (starting at about the 4-minute mark [1]): “…If you get [perform the test at] a cycle threshold of 35 or more…the chances of it being replication-competent [aka accurate] are miniscule…you almost never can culture virus [detect a true positive result] from a 37 threshold cycle…even 36…”

Too many cycles, and the test will turn up all sorts of irrelevant material that will be wrongly interpreted as relevant.

That’s called a false positive.

What Fauci failed to say on the video is: the FDA, which authorizes the test for public use, recommends the test should be run up to 40 cycles. Not 35.

Therefore, all labs in the US that follow the FDA guideline are knowingly or unknowingly participating in fraud. Fraud on a monstrous level, because…

Millions of Americans are being told they are infected with the virus on the basis of a false positive result, and…

The total number of COVID cases in America—which is based on the test—is a gross falsity.

The lockdowns and other restraining measures are based on these fraudulent case numbers.

Let me back up and run that by you again. Fauci says the test is useless when it’s run at 35 cycles or higher. The FDA says run the test up to 40 cycles, in order to determine whether the virus is there. This is the crime in a nutshell.

If anyone in the White House has a few brain cells to rub together, pick up a giant bullhorn and start revealing the truth to the American people.

“Hello, America, you’ve been tricked, lied to, conned, and taken for a devastating ride. On the basis of fake science, the country was locked down.”

If anyone in the Congress has a few brain cells operating, pull Fauci into a televised hearing and, in ten minutes, make mincemeat out of the fake science that has driven this whole foul, stench-ridden assault on the US economy and its citizens.

All right, here are two chunks of evidence for what I’ve written above. First, we have a CDC quote on the FDA website, in a document titled: “CDC 2019-Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic Panel For Emergency Use Only.” [2] See pdf page 38 (doc page 37). This document is marked, “Effective: 12/01/2020.” That means, even though the virus is being referred to by its older name, the document is still relevant as of Dec 2020. “For Emergency Use Only” refers to the fact that the FDA has certified the PCR test under a traditional category called “Emergency Use Authorization.”

FDA: “…a specimen is considered positive for 2019-nCoV [virus] if all 2019-nCoV marker (N1, N2) cycle threshold growth curves cross the threshold line within 40.00 cycles ([less than] 40.00 Ct).”

Naturally, MANY testing labs reading this guideline would conclude, “Well, to see if the virus is there in a patient, we should run the test all the way to 40 cycles. That’s the official advice.”

A disastrous inference.

Then we have a New York Times article (August 29/updated September 17) headlined: “Your coronavirus test is positive. Maybe it shouldn’t be.” [3] Here are money quotes:

“Most tests set the limit at 40 [cycles]. A few at 37.”

“Set the limit” would usually mean, “We’re going to look all the way to 40 cycles, to see if the virus is there.”

The Times: “This number of amplification cycles needed to find the virus, called the cycle threshold, is never included in the results sent to doctors and coronavirus patients…”

Boom. That’s the capper, the grand finale. Labs don’t or won’t reveal their collusion in this crime.

Get the picture?

IS THE PCR TEST USEFUL AND MEANINGFUL?

Now let’s go to published official literature, and see what it reveals. Spoiler alert: the admitted holes and shortcomings of the test are devastating.

From “CDC 2019-Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic Panel For Emergency Use Only.” [2]:

“Detection of viral RNA may not indicate the presence of infectious virus or that 2019-nCoV is the causative agent for clinical symptoms.” (doc page 40)

Translation: A positive test doesn’t guarantee that the COVID virus is causing infection at all. And, ahem, reading between the lines, maybe the COVID virus might not be in the patient’s body at all, either.

From the World Health Organization (WHO): “Coronavirus disease (COVID-19) technical guidance: Laboratory testing for 2019-nCoV in humans”:

“Several assays that detect the 2019-nCoV have been and are currently under development, both in-house and commercially. Some assays may detect only the novel virus [COVID] and some may also detect other strains (e.g. SARS-CoV) that are genetically similar.”

Translation: Some PCR tests register positive for types of coronavirus that have nothing to do with COVID—including plain old coronas that cause nothing more than a cold.

The WHO document adds this little piece: “Protocol use limitations: Optional clinical specimens for testing has [have] not yet been validated.”

Translation: We’re not sure which tissue samples to take from the patient, in order for the test to have any validity.

From the FDA: “LabCorp COVID-19RT-PCR test EUA Summary: ACCELERATED EMERGENCY USE AUTHORIZATION (EUA) SUMMARYCOVID-19 RT-PCR TEST (LABORATORY CORPORATION OF AMERICA)” [5]:

“…The SARS-CoV-2RNA [COVID virus] is generally detectable in respiratory specimens during the acute phase of infection. Positive results are indicative of the presence of SARS-CoV-2 RNA; clinical correlation with patient history and other diagnostic information is necessary to determine patient infection status…THE AGENT DETECTED MAY NOT BE THE DEFINITE CAUSE OF DISEASE (CAPS are mine). Laboratories within the United States and its territories are required to report all positive results to the appropriate public health authorities.”

Translation: On the one hand, we claim the test can “generally” detect the presence of the COVID virus in a patient. But we admit that “the agent detected” on the test, by which we mean COVID virus, “may not be the definite cause of disease.” We also admit that, unless the patient has an acute infection, we can’t find COVID. Therefore, the idea of “asymptomatic patients” confirmed by the test is nonsense. And even though a positive test for COVID may not indicate the actual cause of disease, all positive tests must be reported—and they will be counted as “COVID cases.” Regardless.

From a manufacturer of PCR test kit elements, Creative Diagnostics, “SARS-CoV-2 Coronavirus Multiplex RT-qPCR Kit” [6]:

“This product is for research use only and is not intended for diagnostic use.”

Translation: Don’t use the test result alone to diagnose infection or disease. Oops.

“non-specific interference of Influenza A Virus (H1N1), Influenza B Virus (Yamagata), Respiratory Syncytial Virus (type B), Respiratory Adenovirus (type 3, type 7), Parainfluenza Virus (type 2), Mycoplasma Pneumoniae, Chlamydia Pneumoniae, etc.”

Translation: Although this company states the test can detect COVID, it also states the test can read FALSELY positive if the patient has one of a number of other irrelevant viruses in his body. What is the test proving, then? Who knows? Flip a coin.

“Application Qualitative”

Translation: This clearly means the test is not suited to detect how much virus is in the patient’s body. That’s another indication that the test is useless for determining whether the patient is ill—since millions and millions of virus must be present, in order to produce illness.

“The detection result of this product is only for clinical reference, and it should not be used as the only evidence for clinical diagnosis and treatment. The clinical management of patients should be considered in combination with their symptoms/signs, history, other laboratory tests and treatment responses. The detection results should not be directly used as the evidence for clinical diagnosis, and are only for the reference of clinicians.”

Translation: Don’t use the test as the exclusive basis for diagnosing a person with COVID. And yet, this is exactly what health authorities are doing all over the world. All positive tests must be reported to government agencies, and they are counted as COVID cases.

Those quotes, from official government and testing sources, torpedo the whole “scientific” basis of the test.

CONCLUSION: The PCR test is useless and deceptive. It provides de facto dictators the opportunity to cite “new case levels” and lock down populations, creating economic and human devastation.

RESIST, REBEL, PROTEST, OPEN UP THE ECONOMY ANY WHICH WAY YOU CAN.

SOURCES:

[1] https://www.youtube.com/watch?v=a_Vy6fgaBPE

[2] https://www.fda.gov/media/134922/download

[3] nytimes.com/2020/08/29/health/coronavirus-testing.html

[4] https://web.archive.org/web/20200301092906/http://www.who.int/emergencies/diseases/novel-coronavirus-2019/technical-guidance/laboratory-guidance (for http://www.who.int/emergencies/diseases/novel-coronavirus-2019/technical-guidance/laboratory-guidance)

[5] https://www.fda.gov/media/136151/download

[6] https://www.creative-diagnostics.com/pdf/CD019RT.pdf



Covert Op: “The Virus” As Cover Story

Covert Op: “The Virus” As Cover Story

by Jon Rappoport, No More Fake News
December 2,  2020

 

For months, I’ve been demonstrating that no one has proved SARS-CoV-2 exists (start here).

Instead, elite planners have been selling A STORY ABOUT A VIRUS.

In covert intelligence operations, this would be called a cover story. It obscures true goals. It justifies crimes that would otherwise be nakedly exposed.

In a really large covert op, the cover story hides a number of goals and justifies a number of crimes.

For example, in my 1988 book, AIDS INC., I showed how the cover story about HIV was used in Africa.

For a very long time, the true causes of illness and death in areas of Africa were: hunger; protein-calorie malnutrition; starvation; poverty; war; good farm land stolen from the people; corporate pollution; toxic medicines and vaccines; toxic pesticides; overcrowding in cities; lack of basic sanitation.

Most if not all of these causes could have been eliminated. But local governments did not want healthy people. Sick and dying people were easier to control.

Colluding with, and paying off, local government leaders, transnational corporations set up shop in these African countries and used the healthier people to work on their giant commercial farms and in their factories.

But in 1984, suddenly, there was a new (cover) story broadcast and sold to the world: what was really decimating Africa was HIV. THIS explained all the illness and dying.

The true causes, listed above, were shoved into the background.

Those true crimes were hidden, were permitted to continue unabated.

Not only that, the HIV cover story paved the way for pharmaceutical companies to rack up profits by selling extremely toxic AIDS drugs (e.g., AZT) to Africa.

The HIV test, which turned out false positives like Niagara Falls, made these drugs seem necessary—as fake case numbers soared.

People dying from the toxic medical treatments were, of course, listed as AIDS deaths.

Sound familiar?

These days, the coronavirus cover story obscures crimes according to the same general pattern.

EVERYONE is considered an agent of potential infection. Therefore, a new Chinese strategy: universal lockdowns.

COVID-19 is essentially an intelligence-agency type covert op.

The short-term goal is wrecking economies. The long-term goal is taking the population into a new world of technocratic control.

Selling this as necessary all comes back to THE VIRUS COVER STORY.

“We’re not forcing technocracy down the throats of the people. Certainly not. We’re simply doing what we must, because of the danger of the virus…”

There is another routine element in covert operations: FALSE TRAILS.

These are embellishments on the basic story, promoted to hide the fact that the cover story is a lie. The aim in 2020 is: get people arguing about the nature and origin and composition of the virus.

Why? Because as long as people are arguing about these issues, they are re-enforcing the idea that the virus exists and is dangerous. Thus, the basic cover story is strengthened.

“Sowing dissension in the ranks” is another aspect of false trails. A classic example is the JFK assassination, and the myriad accusations that have been flung between independent researchers, each of whom has a different explanation for the murder of the president.

This past spring, there was a period when such accusations were breaking out among independent COVID investigators. As a result, there was no unanimity about the tyrannical nature of the lockdowns. Thankfully, that moment of ill-will seems to have passed.

Always identify and return to the cover story. Walk around it. Look at it from all sides. Walk into it from one side and exit from the other. Test it. The vital clues are there.

Another classic example: 2009, La Gloria, Mexico. Smithfield Foods, the largest pork producer in the world, operates a giant pig farm. 950,000 pigs.

The urine and feces from these 950,000 pigs run out into the open air and forms what are called lagoons. They’re so large, you can see them from outer space.

Workers spray the toxic lagoons with a toxic foam. It’s routine.

Workers, and people in the surrounding neighborhood, are getting sick and dying. So new contractors are brought in to spray the lagoons with yet another toxic chemical.

Out of nowhere, guess who shows up? The CDC.

Guess what they conclude? It’s not the urine and feces lagoons or the toxic chemicals causing illness and death. No. Of course not.

It’s a new mysterious virus. H1N1.

And voila, we have a new cover story and a new epidemic, called Swine Flu.

The cover story serves a number of purposes, as time passes. But the most obvious one is: Smithfield Foods is protected. They get away with murder.

And to cap it all off, four years later, in 2013, Smithfield, still protected, sells itself to a Chinese company, Shuanghui International Holdings, for $4.72 billion.

Makes you wonder. I can imagine a few Chinese intelligence professionals sitting in a room in Beijing, in 2013, expressing astonishment. “Can you believe the CDC? They sold a cover story about a virus that was so ridiculous…but it worked. Suppose we followed suit, but on a grand scale? We claim an outbreak is occurring in one of our cities. We invite the CDC and the World Health Organization to come in and help. There is no virus, but we know they’ll ‘find a new one.’ They always do. Then, boom. We do something no one has ever done before. We lock down 50 million people overnight and provide a model to the rest of the world. Other countries line up and lock down their populations, wrecking their economies. Meanwhile, we announce China has ‘recovered,’ we cancel our lockdowns and put everybody back to work. It’s a war with no shots fired, and we win. Do you think we could pull it off? Do you think we could sell it? Maybe we should talk to Bill Gates. He’s a smart guy. He always has interesting ideas…”



To Those Who Are Masking Themselves, Holding Their Breath, Cooperating With Practices That Damage the Brains of Children, Harm Themselves and Break Down Society

To Those Who Are Masking Themselves, Holding Their Breath, Cooperating With Practices That Damage the Brains of Children, Harm Themselves and Break Down Society


Brief Excerpts:

And when you wear masks just to be nice, just to go along like the woman in the video, you’re training everybody, you’re training the next generation. And, therefore, the controllers, the ones that know all of these experiments and understand human nature because it’s been there whole job for 70, 80, a hundred years to study human nature, they will count on you to train the next generation. There won’t even have to be a law or a rule. It’s just what people do. We just wear masks for some reason. We don’t get to see each others faces. We don’t get to breathe healthy air. We stew in our own juices. We compromise our immune system. You see whay they’re not bringing in actual laws about this. They don’t need to. You will train the next generation.

And you might be saying to yourself “Well, no, no, listen. There is a bad virus and people have a right to be safe from it.” You might be thinking that way in a collectivized, hive mind, mind set. You think to yourself,  “Well, you know, I don’t know. I don’t know what to believe, so better safe than sorry. Plus it’s really just no big deal to me. I’ll just slap on this mask when I run into the store. That way I don’t have to argue with anyone. That way the people who really are scared aren’t scared of me.” … This is what you’re saying to yourself. I know. But what about the people who aren’t scared, the people who know the facts? Don’t we get any shake in this society anymore? Are we going to just change everything we do to please people who are of X, Y, Z? What’s next? What is next? What else will you do for people who are afraid? They’ve already conditioned us for this — through myriad of means…

###

Somehow, we flipped everything on its head… We can’t make all of society change their habits for your weakness. Otherwise, we have to do that for everyone.

This Is Too Important

by Polly St. George, Amazing Polly
November 30, 2020

 



Original video available at Amazing Polly BitChute channel under the title “This is Too Important”

If you want a future for yourself or your children, stop wearing the masks.

I go over the experiments they have run on us vis a vis social conformity and I try to show that even science has been corrupted by the force of “group consensus.”

You have to stand on your own two feet and not cave to the pressure of what everyone else is doing. It’s too important.

Mask studies to get you started: https://pdmj.org/

Asch Experiment: https://www.youtube.com/watch?v=qA-gbpt7Ts8

First Follower: https://www.youtube.com/watch?v=fW8amMCVAJQ&t=42s

Buzzer experiment: https://www.youtube.com/watch?v=o8BkzvP19v4

[As a service to protect truth from censorship & to share widely, mirrored copies of this video are available at Truth Comes to Light BitChute, Brighteon, Lbry/Odysee channels. All credit, along with our sincere thanks, goes to the original source of this video. Please follow links provided to support their work.]

Connect with Polly St. George: https://amazingpolly.net/contact.html

See also:


I Just Had So Much Fun in Mask Land!  


Satire: The Elitists Who Control You

The Elitists Who Control You

by JP Sears, AwakenWithJP
December 1, 2020

 

Meet the elitists who control you.

Ever wonder who controls the media and politicians that control you?

Here they are! Meet the elite face to face!



Lockdown: The Dark Side of History | The White Coat Experiment of 2020

Lockdown: The Dark Side Of History
The White Coat Experiment of 2020

by Kate Wand, The Very Opinionated Kate Wand Show
November 28, 2020

 



Original video available at The Very Opinionated Kate Wand Show

[As a service to protect truth from censorship & to share widely, mirrored copies of this video are available at Truth Comes to Light BitChute, Brighteon, Lbry/Odysee channels. All credit, along with our sincere thanks, goes to the original source of this video. Please follow links provided to support their work.]

See Show Notes below transcript.

Transcript

 

The year 2020 has been exemplary for those that believe obedience is a high virtue.

The go-along-to-get along sentiment that began as a seemingly innocent response to an unknown viral enemy in late winter, began to take on a new tone by early spring.

Two weeks to flatten the curve in order to give hospitals a chance to organize for what was projected to be an overwhelming number of patients, turned into something more permanent.

Unprecedented lockdowns, heeded by the urgent warnings and pressure from China, were mimicked first in Italy, and then spread, like a plague, to the rest of the western world.

These draconian measures usurped the global population, as we were told that this was for the greater good, and the only way to end the restrictions was to obey the contradiction; to adhere to them at all costs, without exception.

Men of all ages and occupations, educations and backgrounds were recruited into the experiment.

Men in white coats stepped onto the podium, former strangers who did not bother to introduce themselves, but instead began by telling us to be comforted by their presence.

We assumed they were the experts.

We were soon divided into two groups, the teachers and the learners.

The teachers were given clear instructions by the Whitecoats as to what they needed to do next, but not before they were given a small taste of the punishment that those on the other side would receive. They were introduced to a small dose of pain that would stimulate in them the seed of fear, as to what could happen to them if they were to get it “wrong”.

They dutifully followed the instructions of the Whitecoats, and began to adjust to the strange experiment.

(IMAGES of the new normal, masks, etc)

It was hard to tell the teachers apart from the learners at first, since they had no prior reasons not to get along. But gradually, something began to change.

The teachers, like a good pupil, adhered closely to the words of the Whitecoats, and looked to them reassuringly to keep doing what they were doing. They proudly played their part, conforming to the rules and regulations set by the whitecoats.

They adapted to their new positions as educators to their counterparts, and continued to point out, with ever-increasingly painful punishments, when the learners said the wrong things.

The learners began to protest the injustice and the suffering. They wanted out of the experiment. They knew at this point, that there was nothing normal about it. Things had gone too far.

Some of the teachers wanted out too. They never wanted things to go this far, but they didn’t know how to get out of the situation they were in.

Despite knowing that something didn’t sit quite right with them, they still felt compelled to listen to instruction, and carry on obeying, in hopes that it would soon be over.

They deceived themselves into abdicating responsibility to the ones handing down orders. They lost sight of their individual choices in life, instead mindlessly doing as they were told, becoming complicit in the whole affair.

Becoming more emboldened with their unprecedented new reign of authority, and the consent of the majority, the Whitecoats pushed on harder. They kept the narrative going, imposing harsher conditions on all involved in the experiment, and encouraged the teachers to punish the learners if they continued to get it wrong.

At this point, the atrocious results of this experiment were impossible to ignore.

The learners began to protest more loudly, their suffering having become unbearable. They were fighting for their livelihoods, their freedom, their pulse.

But the louder their cries, the more their counterparts turned a blind eye. At this point, they had given up all responsibility for the outcome of their involvement, becoming completely submissive to authority as their fellow man’s cries became inaudible to them.

With the new normal affirmed by the consent of the majority, the Whitecoats successfully created a cognitive dissonance so strong in the population that they could no longer clearly see the difference between right and wrong. With a distorted sense of reality and loss of ownership over ones own identity, it was now easy to suggest that what was true yesterday, was no longer allowed to be remembered today.

With all of the old systems being replaced by the use of masks, social distancing, the new normal, bubbles, online classrooms, isolation and fear, snitching and social unrest, it would leave this traumatized control group reeling from something they did not sign up for.

What was happening to society? What was wrong with these people? How did things completely and inexorably fall apart in such a short amount of time?

Were the teachers evil? Were the learners deserving to be punished? Was there something wrong with either group? Or were they purposefully manipulated like puppets in order to play out a scenario that they were not psychologically prepared to handle?

The momentum of 2020’s psychological experiment combined with what Carl Jung might have referred to as the collective unconscious shadow of contemporary society, bring to mind a quote by Aleksandr Solzehnitzen, Nobel author of The Gulag Archipelago:

“If only there were evil people somewhere insidiously committing evil deeds, and it were necessary only to seperate them from the rest of us and destroy them. But the line dividing good and evil cuts through the heart of every human being, and who is willing to destroy a piece of his own heart?”

Is it possible that a malevolent authority could exist, not only in the history books, but in the very present times? Is it possible that you might not know what was actually going on, that you might have the wool pulled over your eyes, and that perhaps the trust in higher authority you took for granted might be wielded as a weapon against you?

Show Notes:

  • Milgrim Experiment: https://youtu.be/mOUEC5YXV8U
  • Maoist China: https://youtu.be/sXAOTjNheVg
  • Adamson BBQ: https://youtu.be/3wJUjr_Rn0s
    https://youtu.be/PDQzd5_xjiY
  • Pastor Henry’s fines: https://youtu.be/Z6hSisgD12c
  • The new normal back to school: https://youtu.be/HYo0oiHJSCE
  • Event 201: https://youtu.be/AoLw-Q8X174
  • Solzhenitsyn: https://youtu.be/yqpl6srevns
  • Fauci: https://youtu.be/v7am-CtOVB0
  • Tedros: https://youtu.be/1sRxfbzI19k
  • Man on train arrest: https://youtu.be/sfqJis0H4aM 
  • Devilla: https://youtu.be/vN4SEtv78d0
  • Fine: https://youtu.be/-0cuPMAhJEA
  • Violence: https://youtu.be/iXatarwVI7k
  • Drone: https://youtu.be/JbvWniXcNhA
  • Boris: https://youtu.be/3SlRnU2aMmA
  • Snitch: https://youtu.be/e1c8XdjIaM0
  • Humilation: https://youtu.be/AoFPz6GN9Gw
  • Victoria: https://youtu.be/39—Rf-aVA
  • Messa: https://youtu.be/vTe6M2C612Y
  • Shamer: https://youtu.be/TlXoAuU9xAE


All Those Supporting Lockdowns and Compliance Have Blood on their Hands

All Those Supporting Lockdowns and Compliance Have Blood on their Hands

by Gary D. Barnett, GaryDBarnett.com
November 25, 2020

 

“Disobedience is the true foundation of liberty. The obedient must be slaves.”
~ Henry David Thoreau (2006). “Thoreau and the Art of Life: Precepts and Principles”, p.23, Heron Dance Press

There is one thing that is perfectly clear about this predicament we are in today concerning the tyrannical takeover of this country and the world by the controlling few. That is that the people of this country are their own worst enemy, and have no claim to the ‘victim’ argument, because all their problems are self-induced. Every order taken has been voluntary, and that idiotic behavior has led to disaster and death. The powerful have not used guns and bombs to gain the submission of the American people; the people simply did as they were instructed, down to destroying their livelihoods, harming their own families, hiding under their beds, wearing deadly masks, and allowing their lives to lose all meaning. Cowardice at this level is so pathetic as to border on insanity. What happened to this society to make the inhabitants act in such a pitiful and sorry manner? Is it simply fear? I think not, as real fear drives people to protect themselves, not voluntarily allow for their own slavery and death.

But there is much more to this mob reaction than meets the eye. Most of the people in this country not only comply with every single draconian mandate, but also demand that others do so as well. This means that most of the citizenry are not only destroying themselves, but also wish to inflict the same result on everyone else, especially those courageous dissenters with brain cells and the ability to see through this deception. This gives new meaning to the idea of the herd choosing ‘equality’ by wanting everyone to be slaves, so that they can continue to wallow and complain about their chosen lot in life while hoping for their rulers to save them by dominating them. What this exposes is that many of your neighbors are your enemy more so than any government. The people themselves are to blame for this travesty.

It is brutally obvious that this general population cannot see past a television screen locked on to CNN or Fox, and since both sides of the political spectrum believe almost identically, what chance is there of any awakening by large numbers of people? It seems that the ruling members of society have carte blanche in their efforts to complete this communistic and technocratic takeover, because not only is there little if any real resistance to autocratic rule, but the sheep are actually helping those that wish to control them. They have become the state, as they promote tyranny against all, and are willing to monitor and surveil their neighbors on behalf of the government. This country has become a breeding ground for state sponsored stooges. The term that “people are basically good” has been turned on its head!

The lockdowns alone are responsible for massive death and destruction, and are now being ramped up around this country and the world in gleeful anticipation of the coming flu season. The upcoming holidays will be used as fodder to blame all those who wish to be with family and friends for causing new outbreaks of a fake virus, this while the state’s favored donors like Walmart, Costco, Amazon, and many other claimed ‘essential’ businesses, will welcome millions into their stores while commoner’s businesses will be closed due to the bogus risk of spreading a fake virus. New orders, mandates, sanctions, and decrees are coming very soon, and any that wish to enjoy the holidays will be cursed for their selfish desires by the state and their neighbors as well.

The state and every single person supporting the state are fully responsible for all the carnage happening today. Massive poverty is upon us, as purposely-created food shortages are causing great havoc. Loss of income due to shutdowns is literally taking food out of the mouths of children worldwide. Government lockdowns have devastated most of this population, and caused job loss, destruction of livelihoods, and tremendous psychological damage. Suicides are completely out of control, and getting worse every day, all caused by the response to this false flag coup called Covid.

We are living in a time of madness, of murder, of brutality, of indifference, and of the planned destruction of this country and the human spirit. Those involved in this fraud should be held accountable, and this includes not only the self-claimed ‘elite’ controllers, but also the government at every level, and all those that are supporting or calling for lockdowns, mandated vaccines, or any isolation measures whatsoever.  Any defending, justifying, and assisting government in these efforts are promoting the deaths of millions of people around the world. Their blood is on your hands!

I will never forget those that are responsible for this carnage, or any citizen that assists the state in its efforts to destroy humanity. As children starve, as suicide explodes, as poverty consumes the world, as poisons are forcibly injected into the innocent, as economies are purposely decimated, and as millions die, those that are responsible, those that assist and support this travesty, and those that stand silent, are all to blame, and are guilty of allowing murder, genocide, and abomination. The depth of this evil is limitless.

What manner of human is this?

Sources:

What NO ONE is Saying About The Lockdowns by James Corbett

The Best of Gary D. Barnett



Covid-19 Is a Hoax Leading to the Centralization of Control: “The Great Reset” Is the Real Pandemic

Covid-19 Is a Hoax Leading to the Centralization of Control: “The Great Reset” Is the Real Pandemic

by Gary D. Barnett
November 24, 2020

 

“Every time I hear a political speech or I read those of our leaders, I am horrified at having, for years, heard nothing which sounded human. It is always the same words telling the same lies. And the fact that men accept this, that the people’s anger has not destroyed these hollow clowns, strikes me as proof that men attribute no importance to the way they are governed; that they gamble – yes, gamble – with a whole part of their life and their so called ‘vital’ interests.”
 ~ Albert Camus (1978). “Notebooks, 1935-1942”, Harcourt

Is it any wonder that the entirety of our current predicament rests on the lies of the governing system and its ruling accomplices? American governance, all governance in fact, is and has always been susceptible to seeking power and control by means that prove very harmful to the general population. Conspiracy is always evident, and has led to abuses that have included theft, war, killing, imprisonment, torture, and in many cases genocide. In the U.S. today during this false flag event called a ‘virus pandemic,’ we have already seen massive theft in the form of multi-trillion dollar money printing, imprisonment of much of the country through lockdown and isolation mandates, killing of the old and innocent through criminal medical care or lack of medical care, medical martial law, and torture in that many died horrible deaths due to state regulations and procedures. This is a war, but in this case the war is openly being waged against the American public by the very government that most support. Americans have voluntarily allowed its existence, and this is a travesty.

What is likely unknown to most is that this nightmare is just beginning, while the average citizen is still thinking about or hoping for a return to ‘normal.’ Hope and prayer without action will accomplish nothing, but little if any mass dissent and disobedience are evident at this time. The reinstating and acceleration of the tyrannical measures we have seen to date are just around the corner, and with the ‘perfect storm’ of a very weak and unhealthy society with highly compromised immune systems, during what will probably prove to be an especially severe flu season, the sickness and death will all be blamed on a virus that has never been shown to exist. This is astounding, because this information is readily available for any that choose to see, but mass blindness seems to be a real risk we face today. This public blindness is due to ignorance and indifference, and that combination is a recipe for disaster.

There are many agendas being pursued by the self-claimed elites, but the core element of this takeover of society is based on centralizing all power in the hands of the few so that the masses and the world economy can be controlled from the top. This has always been about power and control, and has never been about any risk due to any virus. The fact that no such thing as ‘Covid-19’ has ever been isolated or identified, is staggering to say the least, but this ruse has been fully accepted by the herd, so much so that their very lives and livelihoods have been purposely destroyed due to voluntary compliance. Most have concentrated on being obedient slaves, while becoming fearful of their own family, friends, and neighbors in order to protect themselves from a ‘deadly virus’ that according to the perpetrators of this fraud has a stated survival rate of over 99.8%. In other words, there is no virus threat.

This conspiracy has but one main goal, and that is securing the centralization of power and control over all people and economies in order to achieve global dominance. It is being labeled as ‘The Great Reset,” as described by the very evil Klaus Schwab who is the founder and Executive Chairman of the World Economic Forum. He is tied to Bill Gates, George Soros, and the rest of these inhuman monsters. His and the ruling class ‘elites’ plans for our future are ominous, and currently being accepting by the bulk of this pathetic society. Here are some of his predictions for 2030, which include the United States surrender to the United Nations:

  1. “You’ll own nothing” — And “you’ll be happy about it.”
  2. “The U.S. won’t be the world’s leading superpower”
  3. “You won’t die waiting for an organ donor” — They will be made by 3D printers
  4. “You’ll eat much less meat” — Meat will be “an occasional treat, not a staple, for the good of the environment and our health.”
  5. “A billion people will be displaced by climate change” – Soros’ Open Borders
  6. “Polluters will have to pay to emit carbon dioxide” – “There will be a global price on carbon. This will help make fossil fuels history”
  7. “You could be preparing to go to Mars” — Scientists “will have worked out how to keep you healthy in space.”
  8. “Western values will have been tested to the breaking point.” – “Checks and balances that underpin our democracies must not be forgotten”

He is also a proponent of transhumanism, and has said that nothing will ever return to the ‘broken’ sense of normalcy that prevailed prior to the crisis because the “coronavirus pandemic marks a fundamental inflection point in our global trajectory.” Schwab stated this even though admitting that: “Unlike certain past epidemics, COVID-19 doesn’t pose a new existential threat.” Covid-19 never existed, and never was a threat, but has been the tool used to advance a new world order, or as he calls it, the “Fourth Industrial Revolution.”

Concerning the melding of machines and humans, transhumanism, Schwab spells it out in more detail in “Shaping the Future of the Fourth Industrial Revolution:”

Fourth Industrial Revolution technologies will not stop at becoming part of the physical world around us—they will become part of us. Indeed, some of us already feel that our smartphones have become an extension of ourselves. Today’s external devices—from wearable computers to virtual reality headsets—will almost certainly become implantable in our bodies and brains. Exoskeletons and prosthetics will increase our physical power, while advances in neurotechnology enhance our cognitive abilities. We will become better able to manipulate our own genes, and those of our children. These developments raise profound questions: Where do we draw the line between human and machine? What does it mean to be human?

“We the people” are not a part of this agenda, and are not included in this planning of a new society. We are simply the cattle being prodded and used to sustain the masters. The public makes no decisions, as this plot for gaining technocratic control over all of us has been in the works for many years, but is now going forward at an unimaginable pace, all due to the Covid lie. Everything was planned long ago in secret, but now is being completed and telegraphed out in the open for all to see. This is due to the fact that these manipulating rulers have no fear of the people at large, and believe them too lazy and ignorant to grasp the scope of this totalitarian takeover. Schwab admits this when he writes:

“We must re-establish a dialogue among all stakeholders to ensure mutual understanding that further builds a culture of trust among regulators, non-governmental organizations, professionals and scientists. The public must also be considered, because it must participate in the democratic shaping of biotechnological developments that affect society, individuals and cultures.”

This fake pandemic has supplied what the ruling class calls an opportunity for a reset of society. When the chosen masters call what they claim to be a deadly risk to all mankind an opportunity, one should stand up and take notice, and should immediately understand that we are all the victims of a terrible coup meant to enslave humanity.

Lockdowns, isolation, masks, economic destruction, digitized monetary restructuring, deadly vaccines, gene-controlling technology, transhuman experimentation, total surveillance, and a totalitarian police state are what the masters you have chosen want for all Americans. They are blatantly claiming that this is the new normal they have chosen for you, but you have a choice. Accept all you are being told and become a slave, or realize that the only pandemic is this claimed “Great Reset” that is being used to eradicate you. Acceptance can only lead to hell in a world consumed by evil.

Source links:

https://www.lewrockwell.com/2020/10/jon-rappoport/the-smoking-gun-where-is-the-coronavirus-the-cdc-says-it-isnt-available/

https://www.armstrongeconomics.com/world-news/conspiracy/klaus-schwab-says-you-will-own-nothing-in-10-years/

https://off-guardian.org/2020/10/12/klaus-schwab-his-great-fascist-reset/

https://thenewamerican.com/world-economic-forum-founder-claims-world-will-never-return-to-normal/

The Best of Gary D. Barnett

 

Connect with Gary D. Barnett



The Boiling Frog Effect

The Boiling Frog Effect

by Dave Cullen, Computing Forever
November 23, 2020

 



Available at Computing Forever YouTube and BitChute channels.

 

Truth Comes to Light editor’s note: Below you will find a transcript of this powerful video by Dave Cullen.  The notes in brackets are my description of clips that were not transcribed. Images are screenshots of Dave’s artwork from the video.~ Kathleen

As we’ve previously discussed, you can never appease narcissists. And there’s no amount of appeasement or acquiescing to covid mandates that will satisfy the bully-boy elites in charge of your country.

If you keep playing along with their demands, you can expect more demands. It all comes to a halt when you refuse to comply.

Many people believe that, after the vaccine, life will just return to normal. I’ve been saying for quite a while now, normality was never supposed to return and that an entirely new dystopian normal was being created –through fear, coercion and the slow boiling frog effect — where people are gradually acclimatized over time, through prolonged exposure and adaptation, to a new way of living.

People actually believed that if they did what they were told by the government and the media like good little children then one day they wouldn’t have to wear face masks and do social distancing anymore.

[Here you’ll see a video clip of Fauci interview.]

So there you have it. Social distancing and masks are supposed to continue forever apparently. How did humanity ever exist prior to the implementation of these stringent and totally unnatural and anti-human public health measures?

Now, recently Professor Luke O’Neal spoke to a group of school children.

[Video clip of Professor O’Neal speaking gobbledygook to young captive audience.]

So was that clear? Kind of? Even if you’re vaccinated, you probably will have to wear your mask and social distance for six months until some “r” number thing comes down, but you still might have to wear masks in shops every winter. Okay? Yeah, that was that was clear. Right? Sure.

[More drivel from Professor O’Neal.]

Unbelievable. So he talks about the health passport app to prove that you’re vaccinated, which is basically “show me your papers, please”. And he talked about a wristband alternative. A wristband that can’t come off. And then he makes some remark about how people will complain about their civil liberties. No shit! — considering a person’s right to free movement will be infringed upon. Because if they refuse to take an unnecessary and experimental vaccine, I would imagine there will be quite a few people complaining about their fundamental human rights.

It’s unbelievable but I have been talking about this crap for months now and it seems that some of our worst concerns with respect to rising authoritarianism are actually on the horizon here.

Luke O’Neil also says that students may not be able to go to their debs (for those of you in America that’s the prom here in Ireland) if they aren’t vaccinated.

[More of the same video with innocent children being subjected to the authoritative stupidity of Luke O’Neill.]

So there you have it. You thought your life was going back to normal if you just surrendered all your rights, freedoms and bodily sovereignty for however long the lying government demanded it. Well it depends what you mean by normal. If by normal we mean the mandates and control measures will largely remain in place and everyone has to be vaccinated every year, then yeah, I guess it’s normal. Right?

[Luke O’Neil, ad nauseum.]

Whatever happened to the human immune system? Seriously. Did it just stop working in 2020 or something? What did we do before the pharmaceutical industry came along?

[World Economic Forum’s Klaus Schwab rambles some sort of nonsense.]

Let’s move on. This article is from the Daily Mail — Britons who test negative for Covid twice in a week are set to receive a freedom pass under government scheme that will allow them to live a normal life.

So, if you have to get a freedom pass, it means that you’re not free. And they’re admitting that you’re currently not free. Okay? So, that’s not a free society.

A hall pass for life basically. A hall pass to live your life. It is hoped the scheme could allow Britons to go back to a relatively normal life. Relatively meaning not normal. To earn a freedom pass people will need to get a negative test twice a week.

How far away are we from the hunger games at this stage?

Pass will allow you to mix with friends and family without distancing or masks. Again, this has been made possible by the fact that the general public were so utterly terrified, traumatized and bamboozled by fear-mongering for so many months that they actually started to believe that their rights and freedoms come from the government — when, in fact, they don’t.  They are inalienable.

So, the government takes everyone’s fundamental rights away and then, in order to get the public to comply with the new abnormal, they tease them by offering to give them back tiny little bits of scraps of their freedom.

You know, they’re kind of bribing them. And the public, being so desperate for a reprieve from all of these oppressive measures, might actually see such freedom passes as a way out.

You can see where this is leading people. They are slowly being conditioned to accept having to negotiate for the right to do things that they previously understood to be indisputable freedoms that the government couldn’t touch. They just took them for granted. Now they’re basically being told to ask the government for permission to just spend time with their friends and family, or being allowed to just forgo social distancing, or masks for a little while.

The general adult population, globally at this stage, appears to have been reduced to an infantilized state — like children having to ask if it’s okay for them to hug their grandkids or visit their neighbor. Perfectly healthy people are being told that they’re sick due to a highly questionable PCR test, all the while actual sick people who are in need of hospital care are being denied that care. They’re being denied their necessary treatments.

“COVID-19, the virus so deadly you have to be tested to know you have it,” as the meme goes.

And this argument, that asymptomatic carriers (which is to say healthy people) could get someone sick, is the most outrageous premise because it’s basically a recipe for permanent lockdowns and restrictions. If the government, with their so-called expert scientists, can simply call a pandemic at any time, and then claim that people who feel healthy are potentially sick (with a deadly virus that could get some vulnerable person killed somewhere) then it’s essentially the perfect excuse to rob everyone of their rights and freedoms — at any time and forever.

The reality is, this is not how a society that values individual civil liberties functions because the burden of proof must fall on the person making the claim about the deadly virus and they must prove that the health recommendations are proportionate to the level of the danger. Even then, I would only accept any health measures as recommendations, as advisory and not mandatory, even in a serious outbreak.

And I know some of you disagree with me on that, but you got to understand that the price of freedom is simply too high.

And you can’t just trust that, even after a genuine pandemic, that your government is going to just give your rights back to you. That’s very naive. And that’s what people have done in this case.

Now, under the spanish flu, when people were living in an actual pandemic, there was evidence all around them of this sickness. Everybody knew someone who died from it or at least had been sick from it, you know. You could see examples of sickness in the streets. Not so much with covid. Right?

The article continues:

“To earn the freedom pass people will need to be tested regularly and ,provided the results come back negative, they will then be given a letter card or document they can show to people as they move around.”

Oh boy.

“The certificate would be stored on a phone…”

I just want to point out, I said this stuff months ago. I was called a conspiracy theorist. It’s happening, so you know…

“The certificate would be stored on a phone, according to sources, and will allow people to live a relatively normal life until the government’s vaccination program gets up to speed.”

So there you go. Next up, the vaccine.

“It would even allow Britons to get away without wearing a mask, it is thought, and visit family and friends without the need to socially distance.”

Freedoms and rights we previously took for granted now coming with qualifiers and conditions. Even in your own home. Right?

It’s like the public are all prisoners being temporarily released under bail conditions.

“A source told the Telegraph: ‘They will allow someone to wander down the streets, and if someone else asks why they are not wearing a mask, they can show the card letter or an App.’

I preferred life before, when you could just walk around freely and you didn’t have to show anything to anybody. In other words, people have to show their papers. Right?

“Show me your papers, please!”

This is leading to mass medication of the populace by state coercion.

What could possibly go wrong?

This same strategy will be used for the vaccine. It almost makes you wonder why they’re pushing the vaccine so much. I wonder what’s in it?

The government will not concede any liberties to you until you conform to their medical tyranny. The governments of this world are merely puppets of the globalist interests in the World Economic Forum, The United Nations, Big Pharma — and they are at war with humanity.

This Fox News article talks about Greece. Coronavirus lockdown in Greece requires people to text authorities before leaving home.

“Under a second nationwide coronavirus lockdown in Greece, people will need to text authorities if they want to leave their homes.

“The lockdown will start at daybreak Saturday and last until the end of the month. With infections surging across the country, Prime Minister…

— let me see if i can pronounce this —

“Kyriakos Mitsotakis…

— probably not pronouncing that correctly–

“said he acted before patients overwhelm hospitals.”

Where have we heard that before?

Oh yeah, for the last eight months. All the time.

“We must stop this wave,” he said Thursday. I chose once again to take drastic measures sooner rather than later.

“As part of the lockdown, all retail stores except those selling essential items such as food, medication, and fuel will be closed.

“Travel inside the country will be severely restricted.

“People will only be allowed to leave their homes for work, physical exercise or medical reasons, and only after sending a text message to authorities.

“In the texts to the five-digit number, people will have to provide their name, address and the reason why they need to leave their home.

Unreal.

Where is the outrage?

Honestly. Like, what is wrong with…

Does anybody value freedom anymore? Except, you know, a handful of us at this point.

Moving on. Dan Price tweeted the following:

Indeed.

And that’s essentially what The Great Reset is all about.

Now imagine if Ireland’s Leo Varadkar… had given a speech to the people that went a little something like this:

“Listen guys, I’m afraid you’re gonna have to shut down your businesses forever. And there’s a virus. And it’s going to be here for ages. And the whole world is going to be thrown into one crisis after another.

“Uh, nothing we can do, guys. The rest of your life is just going to be unending misery and upheaval. Uh, new normal on the way. Sorry about that.

“Uh say goodbye to your livelihoods and social lives, the SME sector [Small Enterprise in Ireland with fewer than 50 employees] is finished.  Prepare for mandatory face masks forever in order to be able to just go into the shops or go on public transport.

“Also there’s this thing called social distancing where people treat each other like pariahs. Basically, it’s the presumption of being an asymptomatic carrier of a deadly contagious disease.

“So stay apart. And also we’re going to be essentially undermining your property rights and right to the sanctity of your homes by, uh, being able to enact legislation on how many people are permitted in your home.

“We’re gonna cancel religious services and holidays. And in the long run, uh, there’s gonna be mandatory vaccinations, guys, with, uh, digital immunity passports (which is an app on your phone that shows if you’re vaccinated) or otherwise you won’t be able to go about your life or leave your home.

“Big corporations are going to make a fortune. And more power and wealth will be transferred from you plebs to the one percent of the one percent.

“Uh, small businesses are finished.

“Shut them down. That’s an order.

“Uh, don’t make us send in the guards.”

But, you see, you can never be quite so honest with people in the beginning, when you’re trying to alter human behavior. It takes time. And the conditioning is very gradual, very subtle.

If small business owners, for example, were told in the beginning that they would have to shut down forever, there would have obviously been huge backlash and people would have twigged that something was very seriously wrong.

They would want proof that they were living in an actual pandemic, beyond some scary graphs on a television.

So Varadkar, like any other political puppet, has to follow a similar plan that’s been given to him. The public and small businesses weren’t initially told that the virus was going to be a problem for a very long time. They were told that it was just a few weeks to flatten the curve — in order to avoid the terrible grim reality of a worst case scenario of 85,000 deaths in Ireland by covid.

That’s what he suggested back in March. It seems absurd to read this headline again now in November.

Anyway, the frog in the pot has to be boiled slowly or otherwise it won’t have time to adapt to the increase in temperature and it will jump out of the water.

So to keep people under control they have to be gradually primed for the new abnormal world, with promises about how it’s all going to eventually end and go back to normal — in just a few weeks. The behavior modification narrative has to, ever so slightly, be tweaked periodically so as to be almost imperceptible by the general public.

“Two weeks to flatten the curve” becomes “it’s just a few more weeks to stop the hospitals from being overrun”.

Then it’s “the next two weeks are crucial”.

And then it’s “we have to get the ‘r’ number down”.

And then it’s “experts are concerned about worrying spikes” or something.

And then it’s “just a few more months”.

And then it’s “just until we get a vaccine”.

Eventually, it’ll be “it’s just until the next vaccine”, and then the next one after that, and so on and so on .

Mandatory masks and social distancing signs and stickers were initially suggested as being only temporary until, of course, a sufficient amount of time has passed — and the general public have been so utterly broken and demoralized that they adapt to these things as part of their daily routine. Then they become the new normal.

From the government’s perspective, there’s no need to definitively come out and say when these policies will ever go away because, if the public are so compliant, why would the government surrender their new powers?

The increased draconian airport security measures after 9/11 weren’t temporary, though many people thought they were at the time.

So, why should any government relinquish these new covid control measures?

What I couldn’t get through to people back in March and April is that, when people surrender some of their rights, governments don’t voluntarily give them back. And that has been a clear thing. That’s been a clear pattern throughout history.

Freedoms are trampled on and our lives are slowly changed bit by bit. They rob the people of their liberties, a piece at a time and all, of course, under the guise of public safety.

So, anyway, a few months go by and, sure enough, the hoodwinked, compliant public — who’ve consumed constant fear propaganda from every conceivable angle — they’re now wearing their masks like slaves of the past. They’re even wearing them walking down the street and they haven’t been told to do that.

They know to stand on the circles, follow the arrows, queue outside the supermarket, wear the masks, use the hand sanitizer, and keep their distance .

The Pavlovian dog training is complete. They’ve now been placed into a state of such brainless docility that they are ready for more arbitrary instructions.

The globalists knew that they had to get SMEs out of the way in order to create their wealth transfer to big businesses. So small business owners were told to hang in there. And eventually they were fed scraps of hope.

A new reopening plan was unveiled where restaurants, shops, hair salons, gyms and pubs, etc. would remodel and reorganize their premises and means of operating to comply with social distancing guidance. No doubt they were desperate to comply. Limits were placed on the number of people permitted into the premises. Plexiglas screens were installed. Face coverings or visors became commonplace. Time limits were put in place. Bookings and names and numbers had to be taken by pubs in order to comply with contact tracing.

All of these things were nothing more than a charade — obstacles to be put in place to obstruct and damage the businesses — part of the slow boil process. Make small businesses think that the government wants them to survive and that there’s light at the end of the tunnel.

And the SMEs fell for it, hook line and sinker. The daft regulations that were meant to undermine their business models and reduce their profitability and slowly make them unworkable, the powers-that-be knew that if they didn’t offer SMEs this false dawn of hope that they would likely become fed up and revolt against the summer lockdown.

The summer reopening was, therefore, simply all part of the narcissistic strategy of “love bombing” after an abandonment phase. It was about trying to keep the SMEs sweet.

False hopes of returning to normal would later be dashed by another second lockdown, designed to finish off the SMEs and put them out of business for good.

You cannot appease your oppressor.

Complying with one mandate will inevitably lead to another and then another and another until your life is nothing like it was before — until your life is unrecognizable and you’ve lost all your freedoms, and everything that meant anything to you.

One of the biggest challenges we face in waking people up is their flat refusal to believe in the concept of evil, and that evil is very much at work in the world right now.

But just like a viral transmission, evil needs a host to survive. Its power comes by spreading through fear and intimidation among a compliant public.

If you refuse to comply, the power of evil disappears.

Please stop complying.



COVID 19: Mounting Evidence of International Fraud

COVID 19: Mounting Evidence of International Fraud

by Iain Davis, In This Together
November 16, 2020

 

COVID 19, and the subsequent governmental responses, appear to be part of an international conspiracy to commit fraud. It seems there is no evidence that a virus called SARS-CoV-2 causes a disease called COVID 19.

Sometimes you have to go with your gut. I am not an expert in genetics and, as ever, stand to be corrected. However my attention was drawn to some research published by the Spanish medical journal D-Salud-Discovery.  Their advisory board of eminently qualified physicians and scientists lends further credibility to their research. Their claim is astounding.

The genetic primers and probes used in RT-PCR tests to identify SARS-CoV-2 do not target anything specific. I followed the search techniques outlined in this English translation of their report and can corroborate the accuracy of their claims about the nucleotide sequences listed in the World Health Organisations protocols. You can do the same.

D-Salud-Discovery state there are no tests capable of identifying SARS-CoV-2. Consequently all claims about the alleged impact of COVID 19 on population health are groundless.

The entire official COVID 19 narrative is a deception. Ostensibly, there is no scientific foundation for any part of it.

If these claims are accurate we can state that there is no evidence of a pandemic, merely the illusion of one. We have suffered incalculable loss for no evident reason, other than the ambitions of unscrupulous despots who wish to transform the global economy and our society to suit their purposes.

In doing so this “parasite class” have potentially committed countless crimes. These crimes can and should be investigated and prosecuted in a court of law.

Identification of What Exactly?

The World Health Organisation (WHO) classified COVID-19 (COronaVIrus Disease 2019). They declared a global COVID 19 pandemic on March 11th 2020.

The WHO’s Laboratory testing guidance states:

“The etiologic agent [causation for the disease] responsible for the cluster of pneumonia cases in Wuhan has been identified as a novel betacoronavirus, (in the same family as SARS-CoV and MERS-CoV) via next generation sequencing (NGS) from cultured virus or directly from samples received from several pneumonia patients.”

The WHO’s claim is that the SARS-CoV-2 virus causes the disease COVID-19. They also allege this virus has been clearly identified by researchers in Wuhan.

In the WHO’s Novel Coronavirus 2019-nCov Situation Report 1, they state:

“The Chinese authorities identified a new type of coronavirus, which was isolated on 7 January 2020……On 12 January 2020, China shared the genetic sequence of the novel coronavirus for countries to use in developing specific diagnostic kits.”

These two statements from the WHO clearly suggest the SARS-CoV-2 virus was isolated (meaning purified for study) and then genetic sequences were identified from the isolated sample. From this, diagnostic kits were developed and distributed globally to test for the virus in towns, cities and communities around the world. According to the WHO and Chinese researchers, these tests will find the virus that causes COVID 19.

Yet the WHO also state:

“Working directly from sequence information, the team developed a series of genetic amplification (PCR) assays used by laboratories.”

The Wuhan scientists developed their genetic amplification assays from “sequence information” because there was no isolated, purified sample of the so called SARS-CoV-2 virus. They also showed electron microscope images of the newly discovered virions (the spiky protein ball containing the viral RNA.)

However, such protein structures are not unique. They look just like other round vesicles, such as endocytic vesicles and exosomes.

Virologists claim that it is not possible to “isolate” a virus because they only replicate inside host cells. They add that Koch’s postulates do not apply because they relate to bacteria (which are living organisms). Instead, virologists observe the virus’ cytopathogenic effects (CPE), causing cell mutation and degradation, in cell cultures.

When Chinese researchers first sequenced the full SARS-CoV-2 genome they observed CPE in Vero E6 and Huh7 cells. Vero E6 are an immortalised monkey cell line and Huh7 are immortalised cancer (tumorigenic) cells. Meaning they have been maintained in vitro (in petri dish cultures) for many years.

Central to the official SARS-CoV-2 story is the idea that it is a zoonotic virus, capable of bridging the species gap from animals to humans. When scientists from the U.S. CDC “infected” various cells with the novel virus they noted the following:

“We examined the capacity of SARS-CoV-2 to infect and replicate in several common primate and human cell lines, including human adenocarcinoma cells (A549) [lung celles], human liver cells (HUH7.0), and human embryonic kidney cells (HEK-293T), in addition to Vero E6 and Vero CCL81 [monkey cells]……No cytopathic effect was observed in any of the cell lines except in Vero cells [monkey cells]…….HUH7.0 and 293T cells showed only modest viral replication and A549 cells [human lung tissue cells] were incompatible with SARS-CoV-2 infection.”

The CDC did not observe any CPE in human cells. They saw no evidence that this alleged virus caused any human illness. Nor did this supposed human virus show any notable replication in human cells, suggesting human to human infection would be impossible.

Noting this problem, a team of Polish scientists introduced this sequenced “virus” to human epithethelium (airway) cells. They observed the effects on these HAE cultures for 5 days. They noted much greater replication than the CDC scientists but ultimately stated:

“We did not observe any release of the virus from the basolateral side of the HAE culture.”

Meaning they did not see any evidence of the supposed virions breaching the cell wall membrane. Again suggesting this so called virus isn’t infectious in human beings.

It is not clear that SARS-CoV-2 is a human virus capable of causing illness. It may not even physically exist. Is it nothing more than a concept based upon predictive genetic sequences?

Voyage Of Discovery

The Wuhan Center for Disease Control and Prevention and the Shanghai Public Health Clinical Centre published the first full SARS-CoV-2 genome (MN908947.1 ). This has been updated many times. However, MN908947.1 was the first genetic sequence describing the alleged COVID 19 etiologic agent (SARS-CoV-2).

All subsequent claims, tests, treatments, statistics, vaccine development and resultant policies are based upon this sequence. If the tests for this novel virus don’t identify anything capable of causing illness in human beings, the whole COVID 19 narrative is nothing but a charade.

The WUHAN researchers stated that they had effectively pieced the SARS-CoV-2 genetic sequence together by matching fragments found in samples with other, previously discovered, genetic sequences. From the gathered material they found an 87.1% match with SARS coronavirus (SARS-Cov). They used de novo assembly and targeted PCR and found 29,891-base-pair which shared a 79.6% sequence match to SARS-CoV.

They had to use de novo assembly because they had no priori knowledge of the correct sequence or order of those fragments. Quite simply, the WHO’s statement that Chinese researchers isolated the virus on the 7th January is false.

The Wuhan team used 40 rounds of RT-qPCR amplification to match fragments of cDNA (complimentary DNA constructed from sampled RNA fragments) with the published SARS coronavirus genome (SARS-CoV). Unfortunately it isn’t clear how accurate the original SARS-CoV genome is either.

In 2003 a team of researchers from from Hong Kong studied 50 patients with severe acute respiratory syndrome (SARS). They took samples from 2 of these patients and developed a culture in fetal monkey liver cells.

They created 30 clones of the genetic material they found. Unable to find evidence of any other known virus, in just one of these cloned samples they found genetic sequences of “unkown origin.”

CHART: E Gene target sequence

Examining these unknown RNA sequences they found 57% match to bovine coronavirus and murine hepatitis virus and deduced it was of the family Coronaviridae. Considering these sequences to suggest a newly discovered SARS-CoV virus (new discoveries being ambrosia for scientists), they designed RT-PCR primers to test for this novel virus. The researchers stated:

“Primers for detecting the new virus were designed for RT-PCR detection of this human pneumonia-associated coronavirus genome in clinical samples. Of the 44 nasopharyngeal samples available from the 50 SARS patients, 22 had evidence of human pneumonia-associated coronavirus RNA.”

Half of the tested patients, who all had the same symptoms, tested positive for this new alleged virus. No one knows why the other half tested negative for this novel SARS-CoV virus. The question wasn’t asked.

This supposed virus had just a 57% sequence match to allegedly known coronavirus. The other 43% was just “there.” Sequenced data was produced and recorded as a new genome as GenBank Accession No. AY274119.

The Wuhan researchers subsequently found an 79.6% sequence match to AY274119 and therefore called it a novel strain of SARS-CoV (2019-nCoV – eventually renamed SARS-CoV-2). No one, at any stage of this process, had produced any isolated, purified sample of any virus. All they had were percentage sequence matches to other percentage sequence matches.

Isolate Nothing

Scientists are very annoyed because they keep saying the virus has been isolated but no one believes them. This is because, as yet, no one has provided a single purified sample of the SARS-CoV-2 virus. What we have instead is a completed genome and, as we are about to discover, it isn’t particularly convincing.

Investigative journalists Torsten Engelbrecht and Konstantin Demeter asked some of the scientists who said they had images of SARS-C0V-2 virions to confirm these were images of an isolated, purified, virus. None of them could.

In Australia scientists from the Doherty Institute, announced that they had isolated the SARS-CoV-2 virus. When asked to clarify the scientists said:

“We have short (RNA) sequences from the diagnostic test that can be used in the diagnostic tests”

This explains why the Australian government state:

“The reliability of COVID-19 tests is uncertain due to the limited evidence base…There is limited evidence available to assess the accuracy and clinical utility of available COVID-19 tests.”

In The UK, in July, a group of concerned academics wrote a letter to the UK Prime Minister Boris Johnson in which they asked him to:

“Produce independently peer reviewed scientific evidence proving that the Covid-19 virus has been isolated.”

To date they have not received a reply.

Similarly, UK researcher Andrew Johnson made a Freedom of Information Request to Public Health England (PHE). He asked them to provide him with their records describing the isolation of a SARS-COV-2 virus. To which they responded:

“PHE can confirm it does not hold information in the way suggested by your request.”

Canadian researcher Christine Massey made a similar freedom of information request, asking the Canadian government the same. To which the Canadian government replied:

“Having completed a thorough search, we regret to inform you that we were unable to locate any records responsive to your request.”

In the U.S. the Centre For Disease Control (CDC) RT-PCR Diagnostic Panel state:

“…No quantified virus isolates of the 2019-nCoV are currently available……..Detection of viral RNA may not indicate the presence of infectious virus or that 2019-nCoV is the causative agent for clinical symptoms.”

Last updated on 13th July 2020, the CDC are yet to obtain any pure viral sample from any patient said to have the disease of COVID-19. They openly admit their tests don’t necessarily show if SARS-CoV-2 is either present or causes COVID 19.

We are told that none of this matters. That we are ignorant and just don’t understand virology. Therefore, we must except pictures of things we know could be something else and genetic sequences (which could be anything else) as conclusive proof that this virus, and the disease it is supposed to cause, are real.


Testing For Nothing

The WHO, and every government, think tank, policy steering committee, government scientific advisor, supranational institutions and others who promote the official COVID 19 narrative, assert that SARS-CoV-2 causes COVID 19. While no one has ever produced a sample of this supposed virus, the alleged SARS-CoV-2 genome has been published. It is in the public domain.

Key genetic sequences, in the SARS-CoV-2 genome, are said to have specific functions. These are the target proteins that scientists test for to identify the presence of the “virus”. These include:

  • RNA-polymerase (Rd-Rp) gene – This enables the SARS-CoV-2 RNA to replicate inside the cytoplasm of COVID 19 diseased epithelial cells.
  • S gene (Orf2) – this glycoprotein forms the spike on the SARS-CoV-2 virion surface which supposedly facilitates SARS-CoV-2 binding to the ACE2 receptors on cells, allowing the RNA inside the virion protein shell (capsid) to pass into the now infected cell.
  • E gene (Orf1ab) – small membrane protein used in viral assembly
  • N gene (Orf9a) – the nucleocapsid gene which binds the RNA in capsid formation

The WHO maintain a publicly available record of the RT-PCR primers and probes used to test for SARS-CoV-2. The primers are specific nucleotide sequences that bind (anneal) to the antisense and sense strands of the synthesised cDNA (called forward and reverse primers respectively.)

The cDNA strands separate when heated and reform when cooled. Prior to cooling, nucleotide sequences called probes are introduced to anneal to specific target regions of the suspected viral genome. During amplification, as the regions between primers elongate, when a primer strikes a probe, the probe decays releasing a fluorescent or dye which can then be read by researchers.

It is the identification of these markers which scientists claim to prove the presence of SARS-CoV-2 in a sample.

Something else which is publicly available is the Basic Local Alignment Search Tool (BLAST). This allows anyone to compare published nucleotide sequences with all those stored by the U.S. National Institutes of Health (NIH) genetic database called GenBank. Therefore we can BLAST the claimed SARS-CoV-2 primers, probes and target gene sequences.

The WHO’s forward, reverse primers and probe protocols, for the alleged SARS-CoV-2 viral genome, are based upon RdRp, Orf1, N and E gene profiles. Anyone can run them through BLAST to see what we find.

The vital RdRP nucleotide sequence, used as a forward primer is – ATGAGCTTAGTCCTGTTG. If we run a nucleotide BLAST this is recorded as a complete SARS-CoV-2 isolate with a 100% matched sequence identity. Similarly the reverse E gene primer sequence – ATATTGCAGCAGTACGCACACA – reveals the presence of the Orf1ab sequence which also identifies SARS-CoV-2.

However, BLAST also enables us to search the nucleotide sequences of the microbial and human genomes. If we search for the RdRp SARS-CoV-2 sequence it reveals 99 human chromosome with a 100% sequence identity match. The Orf1ab (E gene) returns 90 with a 100% sequence identity match to human chromosomes.

Doing the same for these sequences with a microbial search finds 92 microbes with a 100% match to the SARS-CoV-2 E gene and 100 matched microbes, with a 100% sequence identity, to the vital SARS-CoV-2 RdRp gene.

Whenever we check the so called unique genetic markers for SARS-CoV-2, recorded in the WHO protocols, we find complete or high percentage matches with various fragments of the human genome. This suggests that the genetic sequences, which are supposed to identify SARS-CoV-2, are not unique. They could be anything from microbial sequences to fragments of human chromosomes.

So called fact checkers, like Reuters’ Health Feedback project, have been quick to dismiss the claims of those who have noticed the apparent lack of specificity in the supposed SARS-CoV-2 genome. Using a slew of strawman arguments like, “this claim suggests every test should be positive,” (which it doesn’t) their debunking attempt runs something like this:

Primers are designed to bind to specific nucleotide sequences that are unique to the virus. The forward primer may bind to a particular chromosome but the reverse primer doesn’t bind to the same chromosome and so the chromosome is not present in the SARS-CoV-2 virus. Moreover because the forward and perverse primers envelop the sequence to be amplified the cDMA sequence between primers is unique to the virus.

This seems to deliberately misrepresent the significance of these findings by forwarding an argument that no one, other than the fact checkers themselves, are making. BLAST searches show that these target sequences are not unique to SARS-CoV-2. Nor do all targets need to be found for a result to be deemed positive.

Moroccan researchers investigated the epidemiology of Moroccan alleged cases of SARS-CoV-2. Nine percent were positive for three genes, eighteen percent were positive for two genes and seventy three percent for just one. As we have just discussed, many may have been positive for none.

This is entirely in keeping with WHO’s test guidelines. They state:

“An optimal diagnosis consists of a NAAT [nucleic acid amplification test] with at least two genome-independent targets of the SARS-CoV-2; however, in areas where transmission is widespread, a simple single-target algorithm can be used……One or more negative results do not necessarily rule out the SARS-CoV-2 infection.”

Regardless of the spurious arguments of well funded fact checkers, if the forward and reverse primers identify junk, perhaps one being the fragment of a chromosome and the other a microbial sequence, then the amplified region between them is probably junk too.

The argument that RT-PCR only finds RNA is specious. Natural transcription (the separation of DNA strands) occurs during gene expression. No one is saying whole chromosomes or microbes are sequenced in the alleged SARS-CoV-2 genome. Though they may, for all we know. They are saying the alleged markers, used to test for this supposed virus, are not fit for purpose.

RT-PCR tests do not sequence the entire genome. They look for incidents of specific probe florescence to indicate the presence of sequences said to exist. These sequences are defined by MN908947.1 and the subsequent updates. These primers and probes could reveal nothing but RNA matches extracted from non-coding, sometimes called “junk,” DNA (cDNA.)

For example the SARS-CoV-2 S gene is meant to be highly specific to the SARS-CoV-2 virus genome. The target sequence is – TTGGCAAAATTCAAGACTCACTTTC. A microbial BLAST search returns 97 microbial matches with 100% identity sequence match. The lowest identity percentage match, within the top 100, is 95%. A human genome BLAST also finds a 100% sequence match to 86 human chromosome fragments.

No matter where you look in the supposed genome of SARS-CoV-2, there is nothing in the WHO’s test protocols that clearly identifies what it is. The whole genome could be false. The tests do not prove the existence of SARS-CoV-2. All they reveal is a soup of unspecified genetic material.

If so, as there are no isolates or purified samples of the virus, without a viable test, there is no evidence that SARS-CoV-2 exists. Therefore, nor is there any evidence that a disease called COVID 19 exists.

This infers that there is no scientific basis for any claims about COVID 19 case numbers, hospital admissions or mortality figures. All measures taken to combat this deadly virus are quite possibly founded upon nothing.

Conclusive Fraud

Fraud is a criminal act. The legal definition of fraud is:

“Some deceitful practice or willful device, resorted to with intent to deprive another of his right, or in some manner to do him an injury.”

The Legal definition of a conspiracy is:

“A combination or confederacy between two or more persons formed for the purpose of committing, by their joint efforts, some unlawful or criminal act”

It seems, those who claim we face a pandemic have not provided any evidence to show that a virus called SARS-CoV-2 causes a disease called COVID 19. All of the information strongly suggesting this possibility is readily available in the public domain. Anyone can read it.

For there to be a fraud the deceit must be wilful. The intention must be to deliberately deprive others of their rights or injure them in some other way. If there is evidence of collusion between individuals ad/or organisations to commit fraud, then this is a conspiracy (in Common Law jurisdictions) or a Joint Criminal Enterprise (JCE) under International Law.

It seems COVID 19 has been deliberately used as a casus belli to wage war on humanity. We have been imprisoned in our own homes, our freedom to roam restricted, freedom of speech and expression eroded, rights to protest curtailed, separated from loved ones, our businesses destroyed, psychologically bombarded, muzzled and terrorised.

Worse still, while there is no evidence of unprecedented all cause mortality, there were unseasonable spikes in deaths. These correlate precisely with Lockdown measures which saw the withdrawal of the health services we pay for and a reorientation of public health services to treat one alleged disease at the exclusion of all others.

Further, it is proposed by those who have forwarded the COVID 19 story, that this alleged disease provides justification for the complete restructuring of the global economy, our political systems, societies, cultures and humanity itself.

To be allowed to participate in their so called “new normal,” which is the wholesale transformation of our entire society without our consent, they insist we submit to their conditions.

These include, but aren’t limited to, bio-metric surveillance of everyone, the centralised control and monitoring of all of our transactions, oppressive business and social restrictions and an effective demand that we have no right to sovereignty over our own bodies. This constitutes the condition of slavery.

There is no doubt that we have been deprived of our rights and injured. In Common Law jurisdictions innocence is presumed, but the evidence that harm has been deliberately caused by an international conspiracy is overwhelming. Destructive policies, enacted by governments across the world, clearly originated among globalist think tanks and supranational institutions long before the emergence of this non existent pandemic.

In Napoleonic Code jurisdictions, guilt is presumed. In order for the accused conspirators to prove their innocent they must show that, despite their immeasurable resources, they have collectively been unable to access or understand any of the freely available evidence suggesting COVID 19 is a myth.

Those responsible for the crime of conspiracy to commit global fraud should be tried. If found guilty they should be imprisoned while the rest of us get on with trying to repair the damage they have already inflicted.

Author Iain Davis is an independent researcher and short filmmaker and the author of the new book, A Dangerous Ideology. See more of Iain’s work at his blog site In This Together and follow him at Twitter & Steemit & MINDS. 

 

Connect with Iain Davis at In This Together

 

 



The Germans Are Back!

It functions like a cult, totalitarianism. It creeps up on you, little by little, little lie by little lie, accommodation by accommodation, rationalization by rationalization … until one day you find yourself taking orders from some twisted little narcissistic nihilist on a mission to remake the entire world. You don’t surrender to it all at once. You do it over the course of weeks and months.

Imperceptibly, it becomes your reality. You do not recognize that you are in it, because everything you see is part of it, and everyone you know is in it … except for the others, who are not part of it. The “deniers.” The “deviants.” The “foreigners.” The “strangers.” The “Covidiots.” The “virus spreaders.”

 

The Germans Are Back!

by CJ Hopkins, Consent Factory, Inc.
November 22, 2020

 

Break out the Wagner, folks … the Germans are back! No, not the warm, fuzzy, pussified, peace-loving, post-war Germans … the Germans! You know the ones I mean. The “I didn’t know where the trains were going” Germans. The “I was just following orders” Germans. The other Germans.

Yeah … those Germans.

In case you missed it, on November 18, the German parliament passed a law, the so-called “Infection Protection Act” (“Das Infektionsschutzgesetz” in German) formally granting the government the authority to issue whatever edicts it wants under the guise of protecting the public health. The government has been doing this anyway — ordering lockdowns, curfews, travel bans, banning demonstrations, raiding homes and businesses, ordering everyone to wear medical masks, harassing and arresting dissidents, etc. — but now it has been “legitimized” by the Bundestag, enshrined into law, and presumably stamped with one of those intricate official stamps that German bureaucrats like to stamp things with.

Now, this “Infection Protection Act,” which was rushed through the parliament, is not in any way comparable to the “Enabling Act of 1933,” which formally granted the government the authority to issue whatever edicts it wanted under the guise of remedying the distress of the people. Yes, I realize that sounds quite similar, but, according to the government and the German media, there is no absolutely equivalence whatsoever, and anyone who suggests there is is “a far-right AfD extremist,” “a neo-Nazi conspiracy theorist,” or “an anti-vax esotericist,” or whatever.

As the Protection Act was being legitimized (i.e., the current one, not the one in 1933), tens of thousands of anti-totalitarian protesters gathered in the streets, many of them carrying copies of the Grundgesetz (i.e., the constitution of the Federal Republic of Germany), which the parliament had just abrogated. They were met by thousands of riot police, who declared the demonstration “illegal” (because many of the protesters were not wearing masks), beat up and arrested hundreds of them, and then hosed down the rest with water cannons.

The German media — which are totally objective, and not at all like Goebbels’ Ministry of Propaganda in the Nazi era — dutifully reminded the German public that these protesters were all “Corona Deniers,” “far-right extremists,” “conspiracy theorists,” “anti-vaxxers,” “neo-Nazis,” and so on, so they probably got what they deserved. Also, a spokesperson for the Berlin police (who bear absolutely no resemblance to the Gestapo, or the Stasi, or any other notorious official-ideology-enforcing goons) pointed out that their water cannons were only being used to “irrigate” the protesters (i.e., not being aimed directly at them) because there were so many “Corona Denier” children in their ranks.

According to the government, the German media, the intelligentsia, and, basically, anyone in public life who wants to remain there, these “Corona Deniers” are becoming a problem. They are spreading baseless “conspiracy theories” that are threatening the public health and causing distress to the German people (e.g., that the vast majority of those infected suffer only mild to moderate flu symptoms or, more commonly, no symptoms at all, and that over 99.7% survive). They are walking around without medical-looking masks, which is making a mockery of the government and media’s efforts to convince the public that they are under attack by an apocalyptic plague. They are posting scientific facts on the Internet. They are staging these protests and otherwise challenging the government’s right to declare a “health emergency,” suspend the German constitution indefinitely, and rule society by decree and force.

Despite the German government and media’s efforts to demonize anyone not obediently parroting the official “New Normal” narrative as a “dangerous neo-Nazi Corona Denier,” the “Corona Denialism” movement is growing, not just in Germany, but all throughout Europe. Clearly, the time is coming for Germany to take stronger measures against this threat. The health of the Vater … uh, the nation, is at stake! Fortunately, this “Infection Protection Act” will provide the government with the authority it needs to conceive and carry out some kind of … well, you know, solution. Allowing these degenerate anti-social deviants to run around challenging the German government’s absolute power is not an option, not in a time of national health emergency! These “Nazi-sympathizing Corona Deniers” must be rooted out and dealt with, mercilessly!

I’m not privy to the details, of course, but, it being Germany, I imagine some sort of Special Task Force has been set up to efficiently deal with the “Corona Denier Problem.” Steps are clearly already being taken. Alternative media outlets are being deplatformed (because, according the media, they are “Querfront magazines”). In April, a well-known dissident lawyer was forcibly committed to a psychiatric ward (but the authorities and the media assured us that it had nothing to do with her dissident views, or with the lawsuits she was filing against the government; she just coincidentally became completely paranoid). Heavily-armed police are arresting YouTubers (although it isn’t clear exactly what for, as the authorities have released no details and the mainstream media is not reporting it).

In the run-up to the 29 August demonstration, at which the government granted some neo-Nazis de-facto permission to “storm the Reichstag,” so that the media could film it and discredit the real protest, one German politician went so far as to call for “Corona Deniers” to be deported … presumably on trains, somewhere to the east.

But seriously, I don’t mean to pick on the Germans. I love the Germans. I live in Germany. And they’re hardly the only ones implementing the new pathologized totalitarianism. It’s just that, given their not-too-distant history, it is rather depressing, and more than a little frightening, to watch as Germany is once again transformed into a totalitarian state, where the police are hunting down the mask-less on the streets, raiding restaurants, bars, and people’s homes, where goose-stepping little Good German citizens are peering into the windows of Yoga studios to see if they are violating “social distancing rules,” where I can’t take a walk or shop for groceries without being surrounded by hostile, glaring, sometimes verbally-abusive Germans, who are infuriated that I’m not wearing a mask, and otherwise mindlessly following orders, and who robotically remind me, “Es ist Pflicht! Es ist Pflicht!”

Yes, I am fully aware that it is “Pflicht.” If I had any doubt as to whether it was “Pflicht,” the Berlin Senat cleared that up when they commissioned and ran this charming advert instructing me to fuck myself if I don’t want to follow their “Corona orders” and profess my belief in their new Big Lie.

And OK, before the Literalist Society starts flooding me with outraged emails, no, I’m not calling these Germans “Nazis.” I am calling them “totalitarians.” Which, at this point, given everything we know, if you’re still pretending that this coronavirus in any way warrants the increasingly ridiculous “emergency measures” we are being subjected to, I’m sorry, but that is what you are.

You may not believe that is what you are … totalitarians never do, not until it is far too late.

It functions like a cult, totalitarianism. It creeps up on you, little by little, little lie by little lie, accommodation by accommodation, rationalization by rationalization … until one day you find yourself taking orders from some twisted little narcissistic nihilist on a mission to remake the entire world. You don’t surrender to it all at once. You do it over the course of weeks and months. Imperceptibly, it becomes your reality. You do not recognize that you are in it, because everything you see is part of it, and everyone you know is in it … except for the others, who are not part of it. The “deniers.” The “deviants.” The “foreigners.” The “strangers.” The “Covidiots.” The “virus spreaders.”

See, although the narratives and symbols may change, totalitarianism is totalitarianism. It doesn’t really matter which uniform it wears, or which language it speaks … it is the same abomination. It is an idol, a simulacrum of the hubris of man, formed from the clay of the minds of the masses by megalomaniacal spiritual cripples who want to exterminate what they cannot control. And what they want to control is always everything. Everything that reminds them of their weakness and their shame. You. Me. Society. The world. Laughter. Love. Honor. Faith. The past. The future. Life. Death. Everything that will not obey them.

Unfortunately, once this kind of thing gets started, and reaches the stage we are currently experiencing, more often than not, it does not stop, not until cities lie in ruins or fields are littered with human skulls. It might take us ten or twelve years to get there, but, make no mistake, that’s where we’re headed, where totalitarianism is always headed … if you don’t believe me, just ask the Germans.

 

Support the work of CJ Hopkins
Connect with CJ Hopkins at Consent Factory, Inc.


cover image credit WikiImages / pixabay



Decency Inverted

Decency Inverted

by Eric Peters, Libertarian Car Guy
November 19, 2020

 

It’s a simple ask:

How does a “mask” prevent a person who isn’t sick from distributing a sickness he does not have? A full Moon Suit connected to a closed-circuit oxygen rebreather system would not “stop the spread” if the “spreader” hasn’t got anything to spread.

The Coronamonomaniac’s answer, of course, is that the “mask” protects against the possibility that you might be sick and not realize it – i.e., “asymptomatic” – and their fear of this possibility – no matter how unlikely it may be in fact – obliges you to wear the “mask.”

One might ask, in that case, whether the possibility that someone might be a thief obliges the suspected person to keep their hands in plain sight at all times – so as to assuage the fear of theft?

If not – and most reasonable people would probably agree that it does not – then why must a person who isn’t sick be made to pretend – eternally – he is sick because other people are afraid he might be?

The answer to that should be obvious: He shouldn’t have to pretend he is sick. Ever. Nor be made to appear to agree with the tenets of the Sickness Cult, which the wearing of the “mask” implies he does.

There is something very wrong with this business of insisting that people alter their behavior in degrading ways – as by walking around in fear of other people, avoiding proximity, wearing a silly “mask” over their faces – because some people are afraid.

Why doesn’t their fear oblige them to deal with it rather than others to accommodate it?

Without regard to the impact on others of their insisted-on accommodations?

The mental disease of Coronamonomania requires that everything – and everyone – be subordinated without limit to the unlimited fear some people have of a sickness that by any fact-based metric poses far less threat of actual harm to almost everyone than the impositions being insisted upon.

This is a sound working definition of mass hysteria, an extremely dangerous phenomenon when allowed to run amok.

The question becomes – how to stop its spread?

The difficulty is the natural – and reasonable – aversion most people have for conflict. Their desire to not make others feel bad, if they can avoid it. We say nice things about people’s bad haircuts – or don’t say anything about them at all. We refrain from criticism we know will not be well-received.

We seek to live – and let live.

This decent instinct is being used against decency – by making good people feel bad about not deferring to the rabidized fear of others.

This is a hobble which must be overcome and the way to overcome it is to realize you are not a bad person for not submitting to emotional blackmail. To being made to actually say that a bad haircut is the best one you’ve ever seen and to agree with viewpoints you disagree with.

You know you are not sick. Therefore, decline to pretend you are sick.

If someone else dreads the possibility that you might be sick, that is their problem to deal with. It is not your obligation to accommodate and if they insist it is, then it is time to tell them no.

Firmly.

Just as you would tell a screaming, foot-stomping child attempting to make you bend to his wishes no. That it’s not going work. Scream and stomp your feet to your heart’s content. We’re not buying that toy to get you to calm down.

And we’re not going to wear a “mask” to get you to calm down, either.

There will of course be screaming and foot-stomping. There already has been. And it is precisely because of the deference of good people to this noxious foot-stomping and screaming that the emotional blackmail for more “masking” has been increasing.

We endure what we tolerate.

Let’s stop tolerating it.

There is, unfortunately, no other way to deal with foot-stomping, screaming emotional blackmail. Let them scream and stomp. Let them see that their emotional blackmail no longer has power over us; that our willingness to put up with it and give in to it at any cost is over.

When someone says, “we’re all in this together” – point out that “we” aren’t in this together. Don’t presume to speak for me.

When someone says, “stay safe” – tell them you’d rather stay free. Walk confidently into stores that aren’t enforcing “masking” bu

If you own a business, let your customers know you don’t expect them to “mask” and maybe even consider placing a sign to that effect on your front door. This may draw down the Sickness Polizei upon you but so be it. Put them in the position of having to charge you with a violation of law – as opposed to “not following guidelines” – and place the onus on the courts to prove you guilty under the law.

Stop backing up. Stop giving in to get along.

This whole show is utterly dependent on acquiescence to emotional blackmail. It can be halted and dialed back if people decide to stop giving in to it for the sake of not making the blackmailers upset.

t depending on emotional blackmail to get you to put one on.

Read More and view related video



James Corbett: False Flags and the Dawn of Bioterrorism

False Flags and the Dawn of Bioterrorism

by James Corbett, The Corbett Report
November 20, 2020

 


Watch on Archive / BitChute / LBRY / Minds / YouTube or Download the mp4
TRANSCRIPT

A false flag operation is an action that is carried out in such a way as to make it look like it was done by someone other than the real perpetrator. Taking its metaphor from naval warfare, where ships would sometimes fly false flags as a ruse du guerre in order to sneak up on their enemy, its use has been expanded to include military actions, intelligence operations and even political subterfuge.

It is not difficult to see how governments can use this tactic to whip the public into war hysteria against their political enemies. By staging an attack and blaming their opponents, governments can dupe their population into going along with whatever policies they wish to enact in the name of “fighting the enemy.” It’s a childishly simple tactic but, as we shall see, it has worked for hundreds of years to lead populations into war against targeted groups.

For the past twenty years, the world has been in the midst of a so-called “war on terror” set in motion by a false flag attack of spectacular proportions. And now, the stage is being set for a new spectacular attack to usher in the next stage in that war on terror: the war on bioterrorism.

GATES: We can’t predict when, but given the continual emergence of new pathogens, the increasing risk of a bioterror attack, and the ever-increasing connectedness of our world, there is a significant probability that a large and lethal modern-day pandemic will occur in our lifetime.

SOURCE: Bill Gates speaks at #epidemicsgoviral in 2018 

As the world begins to lose its collective mind over the threat of viruses, the idea that biological agents and infectious pathogens will be the weapon of choice of the terrorists is being seeded in the public imagination. As in every such false flag event, the coming bioterrorist attack will be blamed on a convenient scapegoat: the “invisible enemy” of a deadly new pathogen and the shadowy terror groups who, we will be told, are responsible for releasing it.

But, as history shows, it is the people who are claiming to “predict” this attack in advance, and who are in positions to dictate the world’s response to it, who should be considered the prime suspects in the wake of any such event.

This is an exploration of False Flags and the Dawn of Bioterrorism.

You’re tuned into The Corbett Report.

1.  What is a False Flag?

Although the term “false flag” has been used in a figurative sense since the 16th century to refer to some person or group disguising their true nature or intentions, its modern use derives from the annals of naval warfare, where ships would literally fly the flag of a different nation, pretending to be allies in order to slip past enemy defenses.

The ruse was successful enough that it was adopted for land and air warfare. No longer were literal flags necessary in order to carry out these “false flag” operations. Any use of deception in order to conceal the true origins and perpetrators of an attack could, by extension, be counted as a false flag operation.

It’s a simple idea, but, to those not versed in the art of deceit, it can be devastatingly effective. Unsurprisingly, rulers have used the tactic for hundreds of years to rally their own populations for war against an enemy target.

Take the case of Swedish King Gustav III. In 1788 he was looking for a way to unite an increasingly divided nation and raise his own falling political fortunes. Like many a ruler before and after, he decided that launching a war against his old rivals, the Russians, would be the perfect vehicle for rallying the public around his government. But the king had a problem: there was no appetite among the Swedish public for such a war, and he didn’t have the authority to declare war unilaterally. So he arranged a false flag operation. Gustav dressed up his own soldiers as Russian troops (complete with Russian coins in their pockets) and ordered them to attack a Swedish garrison stationed in Finland. The Swedish public, believing it to be a genuine Russian attack, were outraged, and the Russo-Swedish War of 1788-1790 began.

Or take the case of Seishirō Itagaki, a general in the Imperial Japanese Army who, by 1931, had risen through the ranks to become the Chief of Intelligence in the Kwantung Army, Japan’s largest army group. Itagaki had a problem: he wanted to invade Manchuria, but the Japanese Minister of War wouldn’t allow it. So the general took matters into his own hands by organizing a small cadre of rebels within the Japanese Army and launching a false flag attack. They detonated some explosives on a railway track near a Chinese garrison and blamed the incident on the Chinese themselves. The next day, the Japanese began their attack in response to the “Chinese” provocation and Itagaki got his Manchurian invasion.

Or take the case of the Manning memo. This document records the discussions that took place between US President George W. Bush and UK Prime Minister Tony Blair at the White House on January 31, 2003. They were committed to starting a war with Iraq, but they had a problem: they didn’t have any actual reason for invading Iraq. As the memo reveals, Bush proposed a false flag solution: painting a U2 spy plane in United Nations colours and flying it low over Iraqi airspace in the hopes that it would be shot down by Iraqi air defense. The outrage, it was assumed, would give the leaders the blank check they needed to wage their war. Blair reportedly balked at the idea, but the pair did agree that the invasion would go ahead regardless of whether or not any weapons of mass destruction were ever found, war crimes be damned.

There are many such examples of false flag operations being used throughout history. But the tactic isn’t an old, dusty relic of the distant past. It very much pertains to the world of the 21st century . . .

2. False Flag Terrorism

It seems inevitable, in hindsight, that the idea of a “false flag” attack would be adapted from its literal use in naval warfare to a more general tactic of deception in military engagements.  So it’s not surprising at all, then, that the concept was further abstracted from a stratagem of warfare to a tool of spy craft.

With the rise of the age of terrorism came the rise of false flag terrorism: spectacular acts of violence designed to look like they were the acts of shadowy terror groups. Once again, the trick is simple but effective.

In the early 1950s, the Israelis were concerned that the British would withdraw their forces from the Suez Canal zone, strengthening Egyptian President Gamal Abdel Nasser and his quest to form an alliance against Israel based on Pan-Arab nationalism. Realizing that the only thing that would keep Britain committed to the region was an ongoing state of emergency, they hit upon a simple solution: a false flag terror operation.

Officially codenamed Operation Susannah (but today known as the Lavon Affair), Israeli military intelligence staged a number of bombings around Egypt, hoping to blame the acts on communists, the Muslim Brotherhood, malcontents, or other convenient scapegoats. But the plan was foiled by Egyptian authorities. Several members of the Israeli cell were captured and the Israeli defence minister was forced to resign over the incident. It was never officially admitted until 2005, when Israel formally honoured nine of the spies that had helped carry out the bombings.

But the era of false flag terrorism kicked off in earnest on September 11, 2001, when the neocons in the Bush administration and their accomplices in the military-industrial complex and the intelligence services of multiple countries found an excuse for their longed-for invasion of Afghanistan and the fulfillment of long-standing Zionist plans for carving out a Greater Israel and redrawing the map of the Middle East.

Prized as a pipeline corridor, Afghanistan was also the linchpin of the global heroin trade and an important base of operations for the forthcoming War on Terror. In fact, so important was the country to the Bush administration that it made the full-scale plan for invading Afghanistan the subject of its first national security directive, NSPD-9. The plan was ready and awaiting presidential approval on September 4, 2001, one week before the events that would supposedly justify such an invasion.

RUMSFELD: By the first week of September, the process had arrived at a strategy that was presented to principals and later became NSPD-9, the President’s first major substantive national security decision directive. It w as presented for a decision by principals on September 4th, 2001, seven days before the 11th, and later signed by the President, with minor changes and a preamble to reflect the events of September 11th, in October.”

SOURCE: RUMSFELD 9/11 COMMISSION TESTIMONY MARCH 23, 2004

9/11 was the foundational event of the 21st century, an excuse for numerous items on the checklist of the neocon cabal at the heart of the Bush administration: The creation of the homeland security state. The murderous wars of aggression to reshape the Middle East. The expansion of the military-industrial complex even beyond its Cold War excesses. The formation of the information-industrial complex. We have all watched these events unfolding like a nightmare over the course of the past two decades.

But now, just as the 9/11 myth has finally begun to relinquish its grasp on the public psyche, another event has come along to send the world back into a state of irrational fear. This time, the emergency is predicated not on the Muslim bogeyman but on the invisible bogeyman: SARS-CoV-2.

As we have already seen, the advent of new forms of warfare inevitably brings with it new opportunities for war planners to adapt the false flag strategy for new battlegrounds. And so it is that we find ourselves on the cusp of a new era of false flag operations.

3. The Anthrax False Flag

As it turns out, 9/11 may not prove to be the most long-lasting and world-changing false flag event to have taken place in the fall of 2001. Although largely forgotten today, the anthrax attacks that followed on the heels of “the day that changed everything” have had a profound effect in shaping public policy and setting the stage for the biosecurity state that is emerging today.

The week after September 11, 2001, a series of letters containing anthrax spores were mailed to various media outlets and, later, to two US Senators, Tom Daschle and Patrick Leahy, who had raised concerns about the Patriot Act which the Bush regime was attempting to rush through Congress. The anthrax-laced letters—which caused the shut down of Congress and lead to the emergency passage of the Patriot Act before legislators even had a chance to read the bill—would go on to kill five and injure 17 others.

In those first chaotic days of the attack, ABC’s Brian Ross began reporting from his anonymous “well-placed” sources that the anthrax spores contained traces of bentonite, a “troubling chemical additive” that just happened to be a “trademark of Iraqi leader Saddam Hussein’s biological weapons program.”

BRIAN ROSS: Peter, from three well-placed but separate sources tonight ABC News has been told that initial tests on the anthrax sent to Senator Daschle have found a tell-tale chemical additive whose name means a lot to weapons experts. It is called bentonite. It’s possible other countries may be using it, too, but it is a trademark of Saddam Hussein’s biological weapons program.

SOURCE: ABC Evening News for Friday, Oct 26, 2001

Of course, this turned out to be a complete lie (a lie that Ross has never clarified or retracted to this day).

As was later confirmed, the spores in question were actually derived from the Ames strain, a strain of anthrax whose virulence makes it the “gold standard” for research into the bacterium by the biological warriors at the United States Army Medical Research Institute of Infectious Diseases. Unsurprisingly, once the anthrax was found to have sourced from the US government’s own biological research labs and not an Iraqi weapons program, coverage of the affair in the mainstream media became less frequent and less detailed.

After years of floating the name of bioweapons expert Steven Hatfill as a “person of interest” in the investigation, the FBI pinned the blame on Bruce Ivins, a “lone wolf” who allegedly orchestrated the entire attack himself because of mental instability. Hatfill successfully sued the FBI for nearly $6 million for undue harassment and Ivins conveniently killed himself before ever being charged with any crime. In the end, not a single person was arrested or indicted for their participation in one of the highest profile attacks in American history.

The anthrax false flag killed multiple birds with one stone:

  • It associated the terror attack of 9/11 with a subsequent bioterror attack that was quickly connected to Saddam Hussein and Iraq. That association was still strong in the minds of many Americans (some who may still have erroneously blamed Iraq for the attack) during the build up to the Iraq War in 2002 and 2003.
  • As Whitney Webb points out in her exhaustive report on the event, the anthrax attack also saved Bioport, the crony-connected DoD contractor that supplied the US military with the highly controversial anthrax vaccine. Facing growing concerns about the safety and efficacy of its vaccine, Bioport faced financial ruin . . . until the anthrax attacks happened and demand for their questionable product skyrocketed. Later rebranding as Emergent Biosolutions, the company benefited from the largesse of the Gates-backed Coalition for Epidemic Preparedness, and, as Webb notes, the company “is now set to profit from the Coronavirus (Covid-19) crisis.”
  • The anthrax attack also gave an excuse for the creation of a wide-ranging legislative and institutional framework for implementing medical martial law in the event of a subsequent bioterrorist attack, including the wide-scale adoption of the Model State Emergency Health Powers Act authorizing forced quarantines and forced vaccinations in the wake of a declared health emergency.

The anthrax false flag also gave a gigantic shot in the arm to another major wing of the military-industrial complex: the “biodefense” sector. Before anthrax entered the public consciousness as a weapon of terror in the fall of 2001, bioweapons research had been sidelined and shrouded in secrecy. After the attacks, however, the US government—and, indeed, every government in the world—had a perfect excuse to vastly expand its biological weapons programs in the name of “biological security.” As Jonathan King, a professor of microbiology at MIT, explains:

“[The] response to the anthrax attacks and the bioterrorism initiative has been to launch a nationwide, billion-dollar campaign to ‘defend us’ from unknown terrorists. But the character of this program is roughly as follows: You say, ‘Well, what would the terrorists come up with? What’s the nastiest, most dangerous, most difficult-to-diagnose, difficult-to-treat microorganisms that we can think of. Well, let’s go bring that organism into existence so that we can figure out how to defend against it.’ The fact of the matter is, it’s indistinguishable from an offensive program in which you would do the same thing.”

And now, two decades later, that massive billion-dollar campaign made to “defend us” from the anthrax threat has led to the creation of a vast biosecurity infrastructure. From biological labs conducting gain-of-function research to government offices conducting bioterror “simulations” to legislation granting extraordinary powers to unelected health “authorities” in the wake of the next attack, the groundwork has been laid for the next stage of government-sponsored false flag terrorism.

4. False Flag Bioterrorism

Ever since 9/11 and the anthrax attacks of 2001, the public has been told that the next spectacular terror attack would involve biological agents engineered by shadowy terror groups.

REPORTER: At a Tucson gymnasium, people wait their turn for life-saving pills to be taken after an outbreak of a smallpox virus. Scenarios like these are taking place across the United States. Thankfully, they’re only simulations.

SOURCE: RR0304/A USA: Bioterrorism

MR. LYNCH: Although we are fortunate not to have experienced a biological attack here in the United States since the anthrax attacks, post-September 11th the threat remains very real. Foreign adversaries have already demonstrated an interest in developing genetic and biological weaponry.

SOURCE: U.S. Biodefense, Preparedness, and Implications of Antimicrobial Resistance for National Security

JEANNE MESERVE: GNN has just learned a group calling itself A Brighter Dawn, or “ABD,” is claiming responsibility for the creation and intentional release of the Clade X virus. In a youtube video, a spokesman for the group says the goal is to reduce the human population to pre-industrial levels. That, he says, will bring the world back into balance and prevent the destruction of the planet.

SOURCE: Clade X Pandemic Exercise: Segment 2

REPORTER: The Center for Disease Control is one of only two labs in the world which officially holds samples of the smallpox virus. The other is in Moscow. But now, bioterror experts fear many other countries may have the virus, and there are concerns it could be used as a weapon. Bioterrorism experts envisage grim scenarios where a suicide terrorist contagious with smallpox walks through a busy airport, infecting hundreds of others who spread the virus to their destinations.

SOURCE: RR0304/A USA: Bioterrorism

Those warnings have only increased in urgency in this age of COVID.

GATES: We also face a new threat that the next epidemic has good chance of originated [sic] on a computer screen of a terrorist intent on using genetic engineering to create a synthetic version of the smallpox virus or a contagious contagious and highly deadly strain of flu.

SOURCE: Gates: Millions could die from bio-terrorism

STEPHEN COLBERT: What else are we not listening to that we need to take action on now?

GATES: Well, the idea of a bioterrorist attack is kinda the nightmare scenario because a pathogen with a high death rate would be ???

SOURCE: Bill Gates warns of BioTerror attack 2nd Wave

RICK BRIGHT: There will be likely a resurgence of COVID-19 this fall.
It’ll be greatly compounded by the challenges of seasonal influenza. Without better planning, 2020 could be the darkest winter in modern history.

SOURCE: Whistleblower warns of ‘darkest winter’ if U.S. doesn’t plan against virus

GATES: So we, you know, we’ll have to prepare for the next one that, you know . . . I’d say will get attention this time,

SOURCE: A Special Edition of Path Forward with Bill and Melinda Gates

Statements like these not only implant in the public mind the idea that the next spectacular terror attack is likely to be biological, but that when such an attack occurs, we should immediately pin the blame on the shadowy terrorists who (we will likely be told) cooked the pathogen up in their bioweapons lab in the caves of Tora Bora.

But, just as anyone with national security experience immediately recognized that 9/11 was not the work of 19 men with boxcutters but in fact bore the hallmarks of a precisely coordinated intelligence operation, so, too, should the public be aware that those with the means, motive and opportunity to create and disseminate a globally spreading infectious pathogen are not cave-dwelling terrorists but well-funded government and military researchers.

Although prohibited by the 1972 Biological and Toxin Weapons Convention, the US has, in fact, maintained an illegal and secret germ warfare research program for decades. Long known to insiders but formally denied by the US government, the existence of the program was confirmed in the pages of The New York Times on September 4, 2001, the same day that the invasion orders for Afghanistan were sent to President Bush for authorization, one week before “the day that changed everything” and two weeks before the beginning of the anthrax false flag.

Although the program was downplayed as “foolish, but not illegal” and portrayed as a defensive program that was largely curtailed in the wake of the end of the Cold War, a groundbreaking 2018 investigation by independent journalist Dilyana Gaytandzhieva found that a network of Pentagon-run biolabs in ex-Soviet bloc states continues to this day to produce deadly bacteria, weaponized viruses and toxins prohibited by the Biological Weapons Convention.

But the US is certainly not alone in its multi-billion dollar quest to develop more deadly—and more precise—biological agents.

Britain’s program, centered around the research at the UK’s secretive Porton Down bioweapon laboratory, included the work of researchers like Vladimir Pasechnik, a microbiologist who had worked on the Soviet germ warfare program weaponizing anthrax and other biological agents before defecting to Britain in 1989. He was hired by the UK government to conduct his own research into anthrax antidotes at Porton Down and died just weeks after the anthrax attacks took place.

Dr. David Kelly, who debriefed Pasechnik after his defection and offered him the job at Porton Down, had told a friend that he was going to write a book exposing what he knew about the bioweapons program—but instead ended up dead on Harrowdown Hill under extremely suspicious circumstances.

The Soviets also had an extensive biological weapons research program. The fruits of that program included the novichok agent that has been blamed for high-profile assassination attempts in recent years, including the poisoning of Sergei and Yulia Skripal who were “randomly” discovered by the Chief Nursing Officer of the British Army just ten miles from the Porton Down bioweapons lab.

It was even reported by The Sunday Times over two decades ago that Israel—which is not a signatory to the Biological Weapons Convention—has worked on “developing a biological weapon that would harm Arabs while leaving Jews unaffected.” The Israel Institute for Biological Research where this research was conducted is a continuation of HEMED BEIT, a biowarfare unit in the Israel Defense Force whose founders believed that “if microbiology could help in providing the means to establish the Jewish State, so be it.” The institute made headlines earlier this year for its “groundbreaking research” identifying coronavirus antibodies and its subsequent quest to develop an Israeli COVID-19 vaccine.

But beyond the secret biological weapons programs, there has been a publicly acknowledged and funded program to weaponize viruses and pathogens that has been ongoing for years. And once again, the threat of bioterrorism has been invoked as a reason for funding this admittedly dangerous research to create the perfect bioweapon.

ANTHONY FAUCI: Bioterror is—there’s always the potential of bioterror. And we have a major bio defense research and development effort that spans agencies from the NIH to do the basic research to be able to develop better vaccines, how you counter engineered microbes, how you approach drug resistance, engineered microbes. The CDC has surveillance mechanisms to determine if there’s new microbes or anything out there in society particularly toxic that could be used in a bioterror situation, the Department of Homeland Security, the Department of Defense—we do all of that.

SOURCE: Anthony Fauci on Bioterrorism

This work, referred to as gain-of-function research, involves weaponizing biological agents so that scientists can develop vaccines or other defenses against them. Of course, gain-of-function research is, in its key aspects, identical to an offensive biological weapons program, but is simply framed as a defensive and preventative measure.

The work of the researchers in this field has not been without controversy.

In 1995 researchers dug up a victim of the 1918 Spanish flu from the Alaskan permafrost in order to “resurrect” the virus using genetic sequencing.

In 2015, researchers at the Wuhan Institute of Virology participated in experiments weaponizing bat-derived coronavirus that even other molecular biologists warned were presenting the world with a “clear and present danger.” The research even received funding from USAID, which was illegal at the time, as the US had suspended funding for gain-of-function research in 2014.

Time and again, those looking at the history of biowarfare are confronted by a key fact: those who have dedicated their lives to weaponizing pathogens and dreaming up bioterror scenarios aren’t the shadowy terrorist biologists in their cave fortress compound, but the government-funded researchers at both secret and public biolabs around the world.

We have entered an age where the threat of a bioterror attack is very real. The only questions facing the public now are: Who are the real bioterrorists? And can we rely on government agencies, their appointed health authorities, and the corporate media to accurately identify those terrorists in the wake of the next spectacular terror attack?

Conclusion

Two decades ago, the idea of a false flag attack was incomprehensible to the general public. “Why would the government attack itself?” was the oft-heard question of those who could not imagine such duplicity being used to fool a nation into war.

But this is not the world of 2001. It is 2020, and by now nearly everyone is familiar with false flag operations. What was once an obscure tactic deployed by military and intelligence agencies in the shadowy world of spies and soldiers is now openly discussed and debated in the mainstream news.

Make no mistake: this is a major step. An important tool of control, used to pull the wool over the eyes of the public for centuries, had gone from a laughable fringe “conspiracy theory” to an openly acknowledged (and vigorously denied) conspiracy reality within the space of two decades.

But have we really learnt the lessons of history about false flag terrorism? Do we even really know what that term means? And would we recognize it if that trick were employed again in a different context?

They say forewarned is forearmed. Nowhere is that adage more aptly applied than in the realm of false flag terrorism. The entire reason that these deception operations have been used by country after country for centuries is that they are so effective. But they are only effective because throughout those centuries the general public was unable to wrap their minds around a trick so devious and downright evil.

Now we have to completely break the spell that governments have cast over the public. In the event of any spectacular terror attack (biological or otherwise), we have to take the history of false flag operations into account and put the government at the top of the list of suspects. When enough of the population has adjusted their thinking in this way, the trick will have lost its effectiveness and those seeking to direct society through fear will have to abandon it altogether.

This is a monumental task, but it is not to be taken lightly. Given the infrastructure for full-scale medical martial law that has been carefully laid over the past two decades, and given the lockdowns, forced vaccinations, enforced unemployment, and digital dollars tied to social credit scores that have been promised by those seeking to put us through the Great Reset, the future of humanity may depend on our response to the next bioterror attack.

The only question is: Can we wake up enough of the public to these tricks before the real bioterrorists launch their next false flag operation?

 

Connect with and support the work of James Corbett



James Corbett: How to Spot a Propaganda Trial Balloon

James Corbett: How to Spot a Propaganda Trial Balloon

by James Corbett, The Corbett Report
November 18, 2020

 

Your thoughts and opinions are incredibly important to those who want to direct your behaviour. So it should be no surprise that propagandists float trial balloons in order to gauge public reaction to new proposals before going ahead with their plans. Join James on today’s #PropagandaWatch as he breaks down this important mechanism of propaganda.



Watch on Archive / BitChute / LBRY / Minds / YouTube or Download the mp4

SHOW NOTES:
The Canadian Military Declares War on Canadians – #PropagandaWatch

Canadians shouldn’t be viewed as “targets” – Military initiative to aim propaganda at public is shut down

Polls Show People Aren’t Buying Establishment B.S. – #PropagandaWatch

COVID-19 is rapidly changing: Examining public perceptions and behaviors in response to this evolving pandemic

Denmark is creating a roadmap for mandatory vaccination

Study shows the source of COVID-19 safety messaging impacts effectiveness

Study: Public messaging should be communicated before the availability of COVID-19 vaccines

STAT-Harris Poll: Most Americans won’t get a Covid-19 vaccine unless it cuts risk by half

Politics affect public buy-in on COVID-19 vaccine, study shows

 



Globalist Technocrats Poised to Press the Great Reset Button

Globalist Technocrats Poised to Press the Great Reset Button

Not one area of life will be left untouched by The Great Reset plan, which aims to reform everything from government, energy and finance to food, medicine, real estate, policing — even how we interact with our fellow human beings.

 

by Dr. Joseph Mercola
sourced from Children’s Health Defense
video by James Corbett, The Corbett Report
November 18, 2020

 

Story at-a-glance:
  • The globalist technocracy is using the COVID-19 pandemic to bypass democratic accountability, override opposition, accelerate their agenda and to impose it on the public against our will.
  • The Great Reset refers to a global agenda to monitor and control the world through digital surveillance. You’ll be tied to it through an electronic ID linked to your bank account and health records, and a social credit ID that will end up dictating every facet of your life.
  • The Great Reset is about getting rid of capitalism and free enterprise, and replacing them with technocracy, publicly referred to as “sustainable development” and “stakeholder capitalism”.
  • There’s not a single area of life that is left out of this Great Reset plan. The planned reform will affect everything from government, energy and finance to food, medicine, real estate, policing and even how we interact with our fellow human beings in general.
  • Privacy protections are a major hurdle in this plan, which is why every effort is made to get people to loosen their views on the right for privacy. In the U.S., we also have the Constitution that stands in the way, which is why efforts to undermine, circumvent, ignore or nullify it are increasing.

What is this “Great Reset” we’re now hearing about? In a nutshell, the Great Reset refers to a global agenda to monitor and control the world through digital surveillance.

As explained by journalist James Corbett in his Oct. 16, Corbett Report above, the Great Reset is a new “social contract” that ties every person to it through an electronic ID linked to your bank account and health records, and a social credit ID that will end up dictating every facet of your life.

It’s about getting rid of capitalism and free enterprise, and replacing them with “sustainable development” and “stakeholder capitalism” — terms that belie their nefarious, anti-humanity intentions. As noted in the book, “Technocracy: The Hard Road to World Order”:

“… Sustainable Development is Technocracy … The Sustainable Development movement has taken careful steps to conceal its true identity, strategy and purpose, but once the veil is lifted, you will never see it any other way. Once its strategy is unmasked, everything else will start to make sense.”

The grand plan 

In her blog post “The Great Reset for Dummies,” Tessa Lena summarizes the purpose behind the call for a global “reset”:

“The mathematical reason for the Great Reset is that thanks to technology, the planet has gotten small, and the infinite expansion economic model is bust — but obviously, the super wealthy want to continue staying super wealthy, and so they need a miracle, another bubble, plus a surgically precise system for managing what they perceive as ‘their limited resources.’

“Thus, they desperately want a bubble providing new growth out of thin air — literally — while simultaneously they seek to tighten the peasants’ belts, an effort that starts with ‘behavioral modification,’ a.k.a. resetting the western peasants’ sense of entitlement to high life standards and liberties (see awful ‘privilege’).

“The psychological reason for the Great Reset is the fear of losing control of property, the planet. I suppose, if you own billions and move trillions, your perception of reality gets funky, and everything down below looks like an ant hill that exists for you. Just ants and numbers, your assets. Thus, the practical aim of the Great Reset is to fundamentally restructure the world’s economy and geopolitical relations based on two assumptions:

“One, that every element of nature and every life form is a part of the global inventory (managed by the allegedly benevolent state, which, in turn, is owned by several suddenly benevolent wealthy people, via technology).

“And two, that all inventory needs to be strictly accounted for: be registered in a central database, be readable by a scanner and easily ID’ed, and be managed by AI, using the latest ‘science.’

“The goal is to count and then efficiently manage and control all resources, including people, on an unprecedented scale, with unprecedented digital … precision — all while the masters keep indulging, enjoying vast patches of conserved nature, free of unnecessary sovereign peasants and their unpredictability.”

Global asset reallocations will not benefit “the people”

These new global “assets” can also be turned into brand new financial instruments that can then be traded. An example of this was given by Vandana Shiva, Ph.D., in my interview with her.

In it, she explained how India is headed toward Zero-Budget Natural Farming — a brand-new concept of farming in which farmers must trade the carbon rate in their soil on the global market if they want to make a living. They’ll get no money at all for the crops they actually grow.

There’s not a single area of life that is left out of this Great Reset plan. The planned reform will affect everything from government, energy and finance to food, medicine, real estate, policing and even how we interact with our fellow human beings in general.

Privacy protections, of course, are a major hurdle in this plan, which is why every effort is made to get people to loosen their views on the right for privacy. In the U.S., we also have the Constitution that stands in the way, which is why efforts to undermine, circumvent, ignore or nullify it are increasing.

“To sum it up, the desired end result is a giant, joyless, highly controlled global conveyor of everything and everybody where privacy is tremendously expensive, dissent is unthinkable, and spiritual submission is mandatory.

It’s like a 24/7 medicated reality, except the medications are both chemical and digital, and they are reporting you back to the mothership, which can then punish you for bad behavior by, say, blocking your access to certain places or by putting a hold on your digital bank account — perhaps without any human intervention at all,” Lena writes.

Stakeholder capitalism

An Oct. 5, Winter Oak article addressed the “technocratic fascist vision” of professor Klaus Schwab, founder and executive chairman of the WEF who wrote the book, “The Fourth Industrial Revolution”. Schwab announced the World Economic Forum’s Great Reset Initiative in June 2020, which includes stripping all people of their privately owned assets.

In addition to being a staunch technocrat, Schwab also has a strong transhumanist bend, and he has spoken of a near future in which humans merge with machines and in which law enforcement will be able to read our mind.

Winter Oak — a British nonprofit social justice organization — points out that Schwab and his globalist accomplices are using the COVID-19 pandemic “to bypass democratic accountability, to override opposition, to accelerate their agenda and to impose it on the rest of humankind against our will.”

“Ultimately, the Great Reset will result in two tiers or people: The technocratic elite, who have all the power and rule over all assets, and the rest of humanity, who have no power, no assets and no say-so in anything.”

This is no conspiracy theory. The plan is out in the open. As noted by Time magazine, “The COVID-19 pandemic has provided a unique opportunity to think about the kind of future we want.” The same statement has been delivered by a number of politicians and organizations around the world in recent months.

Schwab’s book, “COVID-19: The Great Reset” also urges industry leaders and decision makers to “make good use of the pandemic” and “not letting the crisis go to waste.” Incidentally, the owner of Time magazine and founder of Salesforce, Marc Benioff, is also a board member of the WEF, so he’s clearly familiar with the reset plan.

The problem is that while the plan is being sold as a way to, finally, make life fair and equitable for all people, the required sacrifices do not apply to the technocrats running the system. Ultimately, the Great Reset will result in two tiers or people: the technocratic elite, who have all the power and rule over all assets, and the rest of humanity, who have no power, no assets and no say-so in anything.

While technocracy is not a political system but an economic one, in practical terms it does resemble fascism. None of it is being sold under the banner of fascism, of course. Instead, they use financial terms like “stakeholder capitalism,” described by Forbes magazine as “the notion that a firm focuses on meeting the needs of all its stakeholders: customers, employees, partners, the community and society as a whole.”

In that same article, Forbes points out that this strategy has already been tried and failed. It failed because balancing conflicting stakeholder claims was near-impossible and only led to mass confusion and poor returns. The failure of this strategy is what led big businesses to focus on maximizing shareholder value instead.

Now, at a time when big business finds itself under attack for “single-mindedly shoveling money to its shareholders and its executives at the expense of customers, employees, the environment and society as a whole,” the answer, they say, is to return to stakeholder capitalism. But if it didn’t work before, what makes us think it will work now?

Great reset plan for big food 

A Nov. 9, article in The Defender, a new media platform by the Children’s Health Defense, also points out the problems with the World Economic Forum’s Great Reset plan for the food industry:

“The architects of the plan claim it will reduce food scarcity, hunger and disease, and even mitigate climate change. But a closer look at the corporations and think tanks the WEF is partnering with to usher in this global transformation suggests that the real motive is tighter corporate control over the food system by means of technological solutions.”

Aside from the food industry, partners include data mining giants, telecommunications, weapons manufacturers, finance, drug companies and the biotechnology industry.

Looking at that list, it should come as no surprise that the WEF insists the future of food and public health hinges on genetically modified organisms (GMOs), laboratory-grown protein, drugs and industrial chemicals.

The EAT Forum and the rise of food imperialism

To further the fake food takeover, the WEF has partnered with the EAT Forum, which will set the political agenda for global food production. The EAT Forum was cofounded by the Wellcome Trust, which in turn was established with the financial help of GlaxoSmithKline.

EAT currently collaborates with nearly 40 city governments across Africa, Europe, Asia, North and South America and Australia, and maintains close relationships with imitation meat companies such as Impossible Foods, which was co-funded by Google, Jeff Bezos and Bill Gates.

As noted by The Defender, the ultimate aim is to “replace wholesome nutritious foods with genetically modified lab creations.” To this end, EAT is working with the United Nations Children’s Fund (UNICEF) to establish global dietary guidelines and sustainable development initiatives.

The “Planetary Health Diet” developed by EAT is a diet that is supposed to replace all others. Federic Leroy, a food science and biotechnology professor at University of Brussels told The Defender:

“The diet aims to cut the meat and dairy intake of the global population by as much as 90% in some cases and replaces it with lab-made foods, cereals and oil.”

Vandana Shiva, Ph.D., has raised harsh critique against the proposed diet saying it “is not about nutrition at all. It’s about big business and it’s about a corporate takeover of the food system.” The Defender adds:

“According to EAT’s own reports, the big adjustments the organization and its corporate partners want to make to the food system are ‘unlikely to be successful if left up to the individual,’ and the changes they wish to impose on societal eating habits and food ‘require reframing at the systemic level with hard policy interventions that include laws, fiscal measures, subsidies and penalties, trade reconfiguration and other economic and structural measures.’

But Shiva said this is the wrong approach, because ‘all of the science’ shows that diets should be centered around regional and geographical biodiversity. She explained that ‘EAT’s uniform global diet will be produced with western technology and agricultural chemicals. Forcing this onto sovereign nations by multinational lobbying is what I refer to as food imperialism.’”

The future of food and health care

You can get a feel for where the future of food is headed by analyzing the WEF’s strategic intelligence map. As you can see, this top-down approach ties food production to a wide range of sectors, including biotech, the chemical industry, artificial intelligence, the internet of things and the digital economy.

For more details on Schwab and the WEF’s strategic intelligence plan, see Covert Geopolitics’s article, “Breaking Down the Global Elite’s Great Reset Master Plan.”

Read More at Children’s Health Defense

cover image credit geralt /pixabay



The New Religion — The Church of Rona

The New Religion

by Carl Vernon
November 17, 2020

 



 



Dark Journalist w/ Catherine Austin Fitts: Humanity in the Balance — Our Creative Shared Intelligence Faces a Globalist Financial Coup D’Etat & Incredibly Dark Agenda to Control Humanity

Dark Journalist w/ Catherine Austin Fitts: Humanity in the Balance — Our Creative Shared Intelligence Faces a Globalist Financial Coup D’Etat & Incredibly Dark Agenda to Control Humanity

 

Truth Comes to Light editor’s note: This 3.5+ hour interview touches on a wide range of topics including the unfolding financial coup d’etat, attempts to manufacture a civil war in the US, global government secrecy, secret space program, underground bases, population reduction, the hidden history of humanity, transhumanism (integrating humans with robotics), mind control and much more — with an emphasis on awakening humanity, insistence on transparency, and consciously using our innate creativity to choose genuine humanity and freedom over transhumanism and slavery.

 

Excerpts:

DJ:   You talk a lot about the transhumanist movement and what it’s trying to do. Now it’s right in our face. You’ve been talking about it for years about what they’ve been up to. And you have a whole section dedicated to Bill Gates’ creepy technology.

When you look at what they are essentially trying to do with things like smart phones, with things like nano particles in injections…and with the covid stuff also — the cover your face and all this, don’t interact with each other — what are they fundamentally trying to do there to human interaction? What’s the purpose behind it?

Catherine:  Okay, so we live in the middle of a creative shared intelligence.

DJ:  Yes.

Catherine:  Okay? So we are physical beings but we are electromagnetic beings and we resonate with all life. We resonate with the sunlight and the sun, with the birds and the trees and the animals, with each other and all life. And literally what these guys, as far as I can tell, are trying to do, is put a toll booth between every connection and circumvent the resonation into  their machines.

DJ:  Wow.

Catherine:  So they literally want to grid the entire morphogenetic field and get us to resonate with a machine instead of with life and each other. You know, this is trying to make themselves God.

[…]

Catherine:  I really think they believe there is still a middle of the road and they can skate through on the middle of the road and I don’t think there is. I think it’s freedom or slavery, it’s transhumanism or a human civilization, and death is not the worst thing that can happen.

Now we haven’t brought up the weirdest scenario and the most weird scenario, as you know, is David Jacobs’s right.

DJ:  Yes. ..And that’s an alien takeover basically…

Catherine:  Or an interdimensional.

DJ:  Yes. And this is actually very fascinating because there is so much research around it. And certainly the UFO file is undeniable, beyond just its incredible technological…Then you go really outside of it and look at it and you say, is it aliens?…because it is acting so alien.

[…]

Catherine:  What’s important to understand is either aliens exist or we have become as aliens from each other. In other words, if the official reality and reality have separated much and the leadership class has separated so much from the average person that we have become as if separate species. So even if aliens don’t exist, you need to understand that they do, because we have a leadership class that sees us as an alien species.

[…]

Catherine:  The thing they are trying to destroy, in addition to love, is imagination. Because we have the power and the ability to create and invent our world. We can create babies and we can create all sorts of stuff. We can create our world. 

[…]

Catherine:  They are tremendously emboldened by the success of the mind control technology… It’s been wildly successful and it’s really worked for them. The problem is, the more you try to engineer life with mind control and machine, the more nuts and incoherent everybody gets…

But what I’m watching is, I really feel like, by corrupting the general mind by the mind control technology, it’s also making them crazy. And I always say, people who win a rigged game get stupid. And I really think as a society, western civilization right now, is collectively — we’re losing our minds.

[…]

Catherine:  I keep saying this again and again. I’m going to pound the table. Death is not the worst thing that can happen. Do not be afraid. Okay? You have no reason to fear death. I realize it’s inconvenient, particularly if somebody is depending on your cash flow. But death is not the worst thing that can happen. Slavery is the worst thing that can happen.

So get out of fear. It’s not hopeless. If it was hopeless, they wouldn’t be trying to persuade you that it was hopeless.

 

Dark Journalist – Catherine Austin Fitts Exclusive Interview: Humanity In The Balance! 

by Daniel Liszt, Dark Journalist
November 13, 2020



Original video available at Dark Journalist YouTube channel.

Dark Journalist Daniel Liszt welcomes Former Asst. HUD Secretary and Solari Report Publisher Catherine Austin Fitts to the show for a breakthrough discussion of the Global Agenda being rolled out.

Catherine sees a totalitarian great reset with the central controllers trying to keep humanity from discovering our power to shape events and make our own future!

TOPICS:

Deep Surveillance

Digital Currency

Black Budget

AI

Robotics

Mind Control

Fight for the Future

Human Livestock Management

Advanced Nano Technology

You can make sure this important work continues by subscribing to Dark Journalist here:
https://darkjournalist.com/s-subscribe.php

The Dark Journalist X SERIES: https://darkjournalist.com/xmaster.php

[As a service to protect truth from censorship & to share widely, mirrored copies of this video are available at Truth Comes to Light BitChute, Brighteon, &  Lbry/Odysee channels. All credit, along with our sincere thanks, goes to the original source of this video. Please follow links provided to support their work.]

 

Connect with Daniel Liszt, Dark Journalist

Connect with Catherine Austin Fitts, Solari Report

Solari Report’s growing body of work on the Missing Money

Truth Comes to Light editor’s note: See related videos — Greg Hunter’s interview with Dr. Mark Skidmore about the missing trillions and Richard Dolan’s interview with Dr. David Jacobs about an “alien” agenda of planetary acquisition.

 

Dr. Mark Skidmore – Deep State Cover-Up of Missing $21 Trillion Deeply Disturbing

 

“THIS PLANET WILL BE THEIRS.” David Jacobs on the Richard Dolan Show. Dec. 10, 2018.





James Corbett w/ Dan Dicks: The Canadian Military Declares War on Canadians

James Corbett w/ Dan Dicks: The Canadian Military Declares War on Canadians

by James Corbett, The Corbett Report, with Dan Dicks, Press for Truth
November 13, 2020

 

Dan Dicks of PressForTruth.ca joins us to delve deeper into the insane story of the Canadian military fake wolves psyop. We go beyond the ludicrous story of the government using fake wolves to scare the public to discover that the Canadian military is now openly announcing that they are targeting the Canadian public themselves with their newly-weaponized public affairs department. The Canadian military has declared war on Canada. Will Canadians even notice?

The Canadian Military Declares War on Canadians – #PropagandaWatch 

Watch on Archive / BitChute / LBRY / Minds / YouTube or Download the mp4

SHOW NOTES

PressForTruth.ca

Canadian Military FAKE WOLVES FEAR CAMPAIGN EXPOSED! But You WON’T BELIEVE What They Are Doing NEXT!!!

Forged letter warning about wolves on the loose part of Canadian Forces propaganda campaign that went awry

THIS Is How You CONDITION The Masses For The MILITARIZATION OF COVID-19(84)!!!

Canadian military wants to establish new organization to use propaganda, other techniques to influence Canadians

Vancouver Mega Freedom Rally Live with Press For Truth

Press For Truth BANNED On YouTube!

CANADIAN MILITARY FAKE WOLVES FEAR CAMPAIGN EXPOSED! BUT YOU WON’T BELIEVE WHAT THEY ARE DOING NEXT! by Dan Dicks, Press for Truth



 

 



Global Dominance Agenda Marches On, Breaking You Down & Rebuilding You Into a Mind-Controlled Global Citizen

Global Dominance Agenda Marches On, Breaking You Down & Rebuilding You Into a Mind-Controlled Global Citizen

Agenda 21, Agenda 2030, Agenda 2050, climate change, global pandemics, technocracy, police state…

by Clarity Coaching
November 1, 2020

 



(Oeiginal Title) If You Think You Can Handle The Truth, Here It Is! 

Original video available at Clarity Coaching YouTube channel.

[As a service to protect truth from censorship & to share widely, mirrored copies of this video are available at Truth Comes to Light BitChute, Brighteon, Lbry & Odysee channels. All credit, along with our sincere thanks, goes to the original source of this video. Please follow links provided to support their work.]

 

cover image credit pixabay

 



Jon Rappoport: Trump/Biden — Two Bombshell Breaking Stories | And, Why Trump Must Win

Excerpts:

“Trump passively gave in. He opened the door to a coup and then stood aside.

Biden is a complete puppet of the coup. He wants to take the tyranny to a whole new level, as his masters have commanded.”
—
“Periods of tyranny come from the Right and they come from the Left. This one is coming mainly from the Left with its delusional Marxist utopian fantasies. But when all is said and done, all tyrannies, no matter their disguise, no matter their brand of rhetoric, come from power at the top. And power at the top has no political ideology. Ideology is merely a tool for propaganda and mind control.”
—
“Trump is the lesser foe. With a large enough outpouring of public sentiment and demand on behalf of freedom, he could become, in certain but not all respects, an ally. Don’t trust him. Try to force his hand.”
—
“The Oligarchs—bankers, mega-corporate CEOs, financiers, government leaders, intelligence agencies—collude to cut out competition so they can stand alone at the summit of the mountain. And they call this arrangement SOCIALISM. They PROMOTE socialism. They’ve staked out OWNERSHIP of socialism worldwide.”
—
‘ “We are being socialized in America and everybody knows it. If we had a chance to sit down and have a cup of coffee with the man in the street…he might say: ‘You know, the one thing I can never figure out is why all these very, very wealthy people like the Kennedys, the Fords, the Rockefellers and others are for socialism. Why are the super-rich for socialism? Don’t they have the most to lose…?’ In reality, there is a vast difference between what the promoters define as socialism and what it is in actual practice. The idea that socialism is a share-the-wealth program is strictly a confidence game to get the people to surrender their freedom to an all-powerful collectivist government. While the insiders [Oligarchs] tell us we are building a paradise on earth, we are actually constructing a jail for ourselves.” ‘

 

Trump/Biden: Two Bombshell Breaking Stories
And, Why Trump Must Win

by Jon Rappoport, No More Fake News
October 29, 2020

 

ONE: Tucker Carlson announced, on his highly popular FOX broadcast, that a trove of Biden documents implicating Biden in illegal business relationships with China, the Ukraine, and other countries has gone missing. [1]

The documents were shipped through a major commercial courier, from Manhattan to Carlson by FOX staff, and somewhere along the route, the envelope was found open by courier employees—and the contents were gone.

The courier did an extensive investigation of the route and found no evidence to indicate how this happened.

Questions: Did no one at FOX make a copy of these documents? There was only one set? The docs couldn’t have been sent to Tucker electronically? Tucker should consider the possibility that someone at FOX was the culprit.

TWO: “Executive Order on Creating Schedule F in the Excepted Service.” Sounds meaningless, right? It’s not. [2]

President Trump has just released a new executive order which gives him the power to fire a wide range of bureaucratic federal employees who resist implementing White House policies.

The executive order strips these bureaucrats of all sorts of built-in job protections.

It’s no secret that, since taking office, Trump has been receiving huge pushback from federal agencies, all of which are part of the Federal Branch, under his command.

If Trump wins the election, his order will stay intact. If Biden wins, he’ll cancel the order and go back to federal business as usual.

For decades, these alphabet agencies have been exceeding their legal powers by essentially making law. They do this by taking newly passed Congressional legislation and fashioning enforcement-regulations that “fit” the legislation.

Except, in practice, the agencies interpret the laws to their liking. They pervert the meaning of laws.

The American Thinker quotes the Washington Post [3]: “The directive [executive order], issued late Wednesday, strips long-held civil service protections from employees whose work involves policymaking, allowing them to be dismissed with little cause or recourse, much like the political appointees who come and go with each administration.”

“Federal scientists, attorneys, regulators, public health experts and many others in senior roles would lose rights to due process and in some cases, union representation, at agencies across the government. The White House declined to say how many jobs would be swept into a class of employees with fewer civil service rights, but civil service experts and union leaders estimated anywhere from tens of thousands to hundreds of thousands in a workforce of 2.1 million.”

There is major upside and downside to this executive order.

On the one hand, the president can fire bureaucrats who resist his policies because they want to undermine him. He can also fire bureaucrats who fashion regulations that pervert Congressional legislation.

On the other hand, the president can also fire bureaucrats who are simply doing an honest job which happens to get in the way of the president’s corrupt practices.

For example, the president wants a new class of dangerous pesticides green-lighted by the EPA. The EPA refuses to knuckle under. But under threats of being fired, EPA executives “reconsider.”

Of course, big-time corporations and other actors already exert corrupt influence over these federal agencies.

On the plus side, Trump might be able to fire Tony Fauci from his long-held throne at the National Institutes of Health.

Here are two backgrounders…

ONE: Why Trump must win.

For people who want to live free lives, who know what freedom is, it’s time to acknowledge that we’re living in a new age of tyranny.

It’s not coming, it’s already here.

Developments over the past nine months have shown this. On the back of a false pandemic, states have been locked down; over a million businesses have been closed; thus, millions of lives have been destroyed or taken to the brink of destruction; large cities have been decimated.

If that isn’t tyranny, I don’t know what is.

And it’s not over. Not by a long shot. At the drop of a hat, new lockdowns can be imposed.

But understand—-human society does pass through these episodes and periods of tyranny. We are in one now. We are not immune.

So at this point, there are questions about what to do, and these questions are strategic. They are asked from the basis of realizing what we are IN and UNDER. Rule by force. Rule through deception.

The last nine months were presided over by Donald Trump. There is no escaping that fact. He gave in. He stood aside. He was grievously and criminally derelict in his duty to freedom and liberty and the Constitution. He failed to keep America open.

He will never admit it, and neither will his most ardent supporters, who weave tales of imminent Trump-rescue by “citing” his unparalleled genius and his brilliant secret plans.

Popular leaders always have legions of true believers. This is nothing new. Don’t you think, in centuries past, when kings claimed to rule by Divine Right, that their followers concocted and believed extraordinary myths justifying their kings’ monumental acts of oppression?

But from where we stand now, and the questions of STRATEGY we are facing, in this new age of tyranny, we’re looking at two men who are vying for the presidency.

Who would be worse, Trump or Biden?

Trump passively gave in. He opened the door to a coup and then stood aside.

Biden is a complete puppet of the coup. He wants to take the tyranny to a whole new level, as his masters have commanded.

Biden doesn’t require his followers to make excuses for his criminal acts—as in the case of Trump. Biden’s followers WANT those criminal acts. They want more lockdowns. They want national mask mandates. They want forced tracing, testing, and vaccination, ORDERED FROM THE FEDERAL LEVEL, wiping out any resistance from brave governors, however few they may be.

Biden’s followers want climate change to move to the top tier of the federal agenda, in the form of reduced energy-output quotas for all companies. More destruction.

Biden’s followers want more riots in cities, and widespread defunding of the police. They truly believe “social justice” movements will effect beneficial change—when, in fact, these movements are funded by the super-wealthy, on behalf of socialism, which IS an illusion of share-and-care, a covert operation leading to even greater government of the rich, by the rich, for the rich. Because treacherous billionaires will end up owning all the means of production. If you need an education along these lines, start with Gary Allen’s 1971 classic, None Dare Call It Conspiracy.

For those who think Trump is an inveterate liar through and through, Biden is easily his equal.

Periods of tyranny come from the Right and they come from the Left. This one is coming mainly from the Left with its delusional Marxist utopian fantasies. But when all is said and done, all tyrannies, no matter their disguise, no matter their brand of rhetoric, come from power at the top. And power at the top has no political ideology. Ideology is merely a tool for propaganda and mind control.

Liberty and freedom are not ideological, either. They are the outcome of thousands of years of struggle. Their adherents know individual responsibility is a key corollary. The individual is free to live his life in any way he wants to, as long as he doesn’t encroach on another’s freedom.

Trump, even in his addled and manic state, understands some part of this. Biden has given up any pretense of understanding. He now comes from the school of, “Since we know what is best for you, we’ll impose it.” And that’s assuming Biden is mentally coherent, even on his best day.

On the medical front, Trump has shown some willingness to challenge the dictates of Fauci and the CDC. Biden is solidly in the camp of, “I’ll consult the experts and follow their advice.” That is a lethal position. For example, expect him, if elected, to push for a FEDERAL mandate to impose a toxic COVID vaccine.

If enough of the public demands freedom from lockdowns and masks and distancing, Trump will go along, at least part of the way. Biden will try to crack down.

Before his brain aneurysm and pulmonary thrombosis, in 1988, Biden was a highly intelligent political operator. His brand of globalism was similar to Bill Clinton’s, but without Clinton’s self-confident flair and big bullshit front. Since 1988, Biden has gradually deteriorated. If elected, there is every chance he won’t be able to finish his term, and the dangerously corrupt hatchet woman, Kamala Harris, would take over the Oval Office.

Trump modulates his failures by maintaining a relentlessly upbeat attitude. He covers his COVID betrayal (refusing to keep the economy open) with this super-salesman’s con and shuck and jive.

All in all, we are looking at a choice of opponents in the war for freedom. Trump and Biden. Strategically speaking, the choice is clear.

Trump is the lesser foe. With a large enough outpouring of public sentiment and demand on behalf of freedom, he could become, in certain but not all respects, an ally. Don’t trust him. Try to force his hand.

In a new age of tyranny, that’s enough for now.

Presidents are not messiahs.

BACKGROUNDER TWO: The Biden agenda.

I wrote this article several years ago. It spells out one of the central ruses of our time, and it is a ruse the puppet Biden prefers, because the men who control his strings prefer it…

There are “people’s” groups all over the world who advocate the overthrow of the Oligarchs who control nations.

These people’s groups want to install socialism as the answer to Oligarchy.

That’s preposterous.

The Oligarchs—bankers, mega-corporate CEOs, financiers, government leaders, intelligence agencies—collude to cut out competition so they can stand alone at the summit of the mountain. And they call this arrangement SOCIALISM. They PROMOTE socialism. They’ve staked out OWNERSHIP of socialism worldwide.

In other words, the “people’s” groups, who claim to be battling for a better world, are doing the Oligarchs’ bidding. Unconsciously, or on purpose.

Useful idiots.

Socialism has never been about toppling power-hungry leaders. Its pretension of equality and share-and-care is a cover for totalitarianism by the few, for the few.

Karl Marx, while predicting a coming utopia on Earth, expressed the absolute need for a “transition” phase called the “dictatorship of the proletariat.”

Of course, that was a partial misnomer. The “dictatorship” part was correct, but the proletariat would never run it. They would labor for it. They would look up from ground level at the leaders who were supposedly their friends and guardians—and soon realize they’d been taken in by a long con. There was no transition government. There was just the same old Oligarchy under another name, that’s all.

From Gary Allen’s classic, None Dare Call It Conspiracy, published 50 years ago:

“We are being socialized in America and everybody knows it. If we had a chance to sit down and have a cup of coffee with the man in the street…he might say: ‘You know, the one thing I can never figure out is why all these very, very wealthy people like the Kennedys, the Fords, the Rockefellers and others are for socialism. Why are the super-rich for socialism? Don’t they have the most to lose…?’ In reality, there is a vast difference between what the promoters define as socialism and what it is in actual practice. The idea that socialism is a share-the-wealth program is strictly a confidence game to get the people to surrender their freedom to an all-powerful collectivist government. While the insiders [Oligarchs] tell us we are building a paradise on earth, we are actually constructing a jail for ourselves.”

When a mega-corporate CEO, whose company is in deep financial trouble, magically secures a giant loan through a crony, and when that corporation continues to pollute the land and destroy lives, and while the government agency that should be hauling off the CEO to prison sits on its hands, that’s socialism in practice. That’s the real thing.

The government may not officially own such corporations, as in the classical definition of socialism, but at the top, the government and the biggest corporations are cooperating, as one. It’s a distinction without a difference.

Why don’t more people understand all this?

Because their minds are clouded with propaganda and feel-good New Age oatmeal. Because they’re convinced that believing in something that sounds good on the surface (“a better and more just world for all”) is enough, is a pinnacle of achievement for them. And since they’re told this belief is socialism, they’re for it.

They will fall for any program on that basis. If pernicious medical experts assure them that mandated mass vaccination will protect the planet from disease, they will snap up that vision in a minute. “A healthy Earth for everyone.” It must be true. It feels right.

Here is an astonishing statement from the Mayor of New York, Bill de Blasio [4]: “What’s been hardest is the way our legal system is structured to favor private property. I think people all over this city, of every background, would like to have the city government be able to determine which building goes where, how high it will be, who gets to live in it, what the rent will be. I think there’s a socialistic impulse, which I hear every day, in every kind of community, that they would like things to be planned in accordance to their needs. And I would, too…Look, if I had my druthers, the city government would determine every single plot of land, how development would proceed. And there would be very stringent requirements around income levels and rents. That’s a world I’d love to see, and I think what we have, in this city at least, are people who would love to have the New Deal back, on one level. They’d love to have a very, very powerful government, including a federal government, involved in directly addressing their day-to-day reality.”

The control of private property, from above, is of course one of the tenets of socialism.

Oligarchs, who promote their brand of socialism, who are also Globalists (no nations; no borders; global governance), want to sweeten their pot through floods of immigrants. No, they’re not thinking about “doing good.” They have propaganda operatives who spout that line.

They’re thinking about how they can blur and erase all sorts of distinctions surrounding private ownership of private property—and instead, disruptively resettle immigrants, make them dependent on the State, sink property values, and induce more and more citizens to accept the idea that “everything belongs to everybody.”

This gibberish phrase actually means: the Oligarchs own it all.

This is their premise and their goal.

They mean business, literally and figuratively.

On a much lower level, scratch the surface of any self-proclaimed socialist who happens own a home, and watch what happens when you demand he turn that home over to “the people.” He suddenly becomes a raw naked capitalist. He rails against the State…

The State—to whom, when the pressure is off, he claims every citizen should swear allegiance, so that money and property and services and goods and energy and every necessity and luxury of life can be managed, for the benefit of all.

This article illustrates the Biden agenda, stripped of pretense.

Echoing across 50 years, here is another excerpt from Gary Allen’s, “None Dare Call It Conspiracy”:

“What we are witnessing is the Communist tactic of pressure from above and pressure from below, described by Communist historian Jan Kozak as the device used by the Reds to capture control of Czecho-Slovakia. The pressure from above comes from secret, ostensibly respectable Comrades in the government and Establishment, forming, with the radicalized mobs in the streets below, a giant pincer around middle-class society. The street rioters are pawns, shills, puppets, and dupes for an oligarchy of elitist conspirators working above to turn America’s limited government into an unlimited government with total control over our lives and property.”

“The American middle class is being squeezed to death by a vise…In the streets we have avowed revolutionary groups such as the Students for a Democratic Society (which was started by the League for Industrial Democracy, a group with strong C.F.R. ties), the Black Panthers, the Yippies, the Young Socialist Alliance. These groups chant that if we don’t ‘change’ America, we will lose it. ‘Change’ is a word we hear over and over. By ‘change’ these groups mean Socialism. Virtually all members of these groups sincerely believe that they are fighting the Establishment. In reality they are an indispensable ally of the Establishment in fastening Socialism on all of us. The naive radicals think that under Socialism the ‘people’ will run everything. Actually, it will be a clique of Insiders in total control, consolidating and controlling all wealth. That is why these schoolboy Lenins and teenage Trotskys are allowed to roam free and are practically never arrested or prosecuted. They are protected. If the Establishment wanted the revolutionaries stopped, how long do you think they would be tolerated?”

“Instead, we find that most of these radicals are the recipients of largesse from major foundations or are receiving money from the government through the War on Poverty. The Rothschild-Rockefeller-C.F.R. [Council on Foreign Relations] Insiders at the top ‘surrender to the demands’ for Socialism from the mobs below. The radicals are doing the work of those whom they hate the most.”

Does that excerpt from “None Dare Call It Conspiracy,” written in 1971, sound familiar today? Of course it does. It reflects the same old strategy of pressure applied from both the top and bottom. The squeeze play.

The super-rich monopolists pretend to “bow to the socialist wishes” of the underclass and the protestors and the rioters.

It’s a straight con.

Don’t get caught in the word game which confuses Communism, Socialism, the Corporate State, Fascism, and Crony Capitalism.

When you put all these terms through the wash, they come out looking the same. They mean power at the top, disguised to appear as popular movements.

This is what lies beneath the “I have a plan” statements of Joe Biden.

SOURCES:

[1] https://twitter.com/TuckerCarlson/status/1321608055549775872

[2] https://www.whitehouse.gov/presidential-actions/executive-order-creating-schedule-f-excepted-service/

[3] https://www.americanthinker.com/blog/2020/10/president_trump_makes_a_bold_move_to_weaken_the_swamps_power.html

[4] https://blog.nomorefakenews.com/2019/01/16/mayor-of-new-york-is-karl-marxing-again/

 

Connect with Jon Rappoport at No More Fake News



The Virus-Story: Breaking the Chains of Medical Civilization

The Virus-Story: Breaking the Chains of Medical Civilization

by Jon Rappoport, No More Fake News
October 28, 2020

 

In the same way the CIA invented foreign enemies which required us to go to war, there are people who have invented stories of fearful germs that demand medical treatment and prevention. The story tellers know that among the public, many people WANT the germ, need it, and even love it. Yes, love it, after enough conditioning has helped them along the path of surrender.

The COVID operation aims to engulf all of civilization in a preposterous and fake medical nightmare.

The operation has its roots in “modifying” citizens to accept medical dictates.

There are many kinds of such dictates, and it would take volumes to explore them all. Here I present a set of numbers from the US National Center for Health Statistics, a division of the CDC, covering the year 2018:

Percent of adults who had contact with a health care professional: 84.3%.

Percent of children who had contact with a health care professional: 93.6%.

Number of physician office visits (2016): 883.7 million.

Here is another related estimate: according to the US National Alliance on Mental Illness, in a recent year, “More than 25 percent of college students have been diagnosed or treated by a professional for a mental health condition…”

Try to grasp how this unprecedented rate of exposure to doctors shapes the minds of Americans. Appointments, tests, diagnoses, advice, orders, prescriptions, drugs and vaccines, follow-ups, referrals to specialists.

These factors alone—never mind the toxic effects of treatments, or wall to wall medical ads and other propaganda—add up to a medical civilization.

Given this reality, how do you think people are going to respond when they are told there is a pandemic and they must follow orders?

After a hundred years of Rockefeller Medicine…new normal? We’ve been living under the new normal for a long time.

How many drug prescriptions do you think are written in the US every year? According to statista.com, “It is estimated that in 2019, 4.38 billion retail prescriptions will be filled throughout the United States.”

Many, many people accept the ubiquitous medical civilization without thought or pause. It’s “just the way things are.”

Pretended pandemics are an arm of medical civilization. But now we’ve reached a point where The Medical is a gateway into a technocratic Brave New World.

This attempted transition is launched from the foundation of lifelong conditioning of the public to doctors and everything those doctors order and represent.

Mind control par excellence.

Two important groups of people—politicians and journalists—are operating from bias in their decisions, because they, too, have been trained to place themselves under the care of doctors on an ongoing basis. Are they going to rip out that hard wiring of their own experience when the rubber meets the road, when they’re faced with professional questions about medical credibility? No. They’re going to side with the CDC and WHO and university experts.

What I’m describing in this article goes beyond the acceptance of “Science” as the dominant paradigm. This conditioning is deeply personal and deeply seated in the minds of people who have been trudging along the bleak path of medical care since early childhood. Medical care for every so-called “symptom.”

I have spent many hours exposing the actual death and maiming effects of medicines on the population. Again, here I’m simply discussing the up-close connection between eternal patient and doctor.

In that sense, telling a dedicated person to take off his mask is telling him to destroy what he believes is a deep lifeline, without which he might very well drown.

Medical civilization’s leaders want us to bow down to the germ. They want us to drool like Pavlov’s dogs, when they ring the bell signaling the presence of a “new virus.” Our anticipated food, in this case, is supposed to be treatment. Treatment and containment measures.

Surely, a Declaration of Medical Independence is needed. “When in the course of human events, it becomes necessary for one people to dissolve the medical bands which have connected them with some Health Authority…whenever any Form of Medicine becomes destructive…it is the Right of the People to alter or to abolish it, and to institute new Medicine, laying its foundation on such principles and organizing its powers in such form, as to them shall seem most likely to effect their Safety and Happiness…”

Under the heading of “such principles,” one statement would make it clear that every person has the natural right to reject false faith in the germ, in its power, and in its very existence.

Let those who fear the germ, or want it, cling to it like an idol, if they must, if they refuse to be dissuaded. The rest of us will go our way, secure in our freedom from the idolatry, knowing that medicalized civilization is a tyrant, built without our consent.

Keeping freedom is now the great challenge.

The global lockdowns, present and future; the business closures; the bankruptcies; the resultant family breakups and suicides and drug addictions; the expansion of poverty, hunger, starvation; the desolation of once-great cities—on what basis has all this destruction been launched?

A story about a virus.

So pardon me if I keep attacking that story. If I keep pointing out gaping holes in that story. My basic position is this: I reject the cultish rhetoric coming out of labs. It is divorced from the world of human beings. It aims to claim ownership over our bodies, minds, and souls. Through one abstraction piled on another, its proponents have staked out a cause that is anti-life. With the data they derive and invent from their serums and sequencing, they set up a prison in which we are supposed to be biological machines that merely react to the stimuli of microbes.

Reject that lunatic non-reality.

The set-up and the con are clear: “We say there is a deadly virus on the loose. We describe it and promote it. We run the game and make the rules. We say you are unprotected unless we protect you with treatment and containment measures. We can quibble about which treatments. We can quibble about how much containment, where and when, and under what circumstances, since we define the circumstances; and we can loosen and tighten the rules at our discretion. But in the end, we are the sellers and you are the buyers. You buy our story. We are a protection racket. You give us your lives or we close you down. And guess what? Either one of those choices produces the same result. Get it?”

So when I hear someone say, in effect, THIS containment measure is necessary and effective, but THAT one is minimally effective, and THIS country did well by adopting a LESS RESTRICTIVE MODEL, and SMART CONTAINMENT WOULD LOOK LIKE THIS, I know that person has bought enough of the story to keep the basic con going; and the elite planners are winning.

The war is long. They must not win.



The Missing Coronavirus: Why I’m Not Surprised

The Missing Coronavirus: Why I’m Not Surprised

by Jon Rappoport, No More Fake News
October 27, 2020

 

As my readers know, I’ve been exposing the fact that no one has proved the SARS-CoV-2 virus exists. I’ve been exposing the fact in a number of articles, coming at the issue from multiple angles. [1] [2] [3] [4] [5] [6] [7] [8]

I’m not surprised at what I’ve found. I could offer MANY reasons for my lack of surprise. In this article, I’ll just cite one reason. A prior case with similar features.

That case is astonishing because: it was exposed in the mainstream press; many alternative news outlets failed to recognize the implications; most independent reporters have rarely, if ever, mentioned the scandal.

It’s as if there is a fear of facing up to fraud beyond a certain level of “acceptability.”

“Yes, we can expose this fraud and that one, but the other one over THERE…don’t touch it. It’s too hot, it’s too big. Let’s pretend it didn’t happen. Let’s gloss over it and move on to other things…”

And with that, I take you back to the summer of 2009. The world was agog with a pandemic called Swine Flu, caused by the H1N1 virus.

The CDC was reporting thousands of cases in America. A new vaccine had been rushed into production.

But behind the curtain, something was wrong. Actually, the CDC had STOPPED counting cases. How could that be? The agency’s main task was reporting illness and death numbers. And in the wake of their stoppage, how could the CDC claim to know there were thousands of Swine Flu cases in the US?

These questions intrigued a star investigative reporter at CBS, Sharyl Attkisson. She dug in and found out why the CDC had stopped counting cases.

Here, from an interview I conducted with her, several years ago, is her explanation:

Rappoport: In 2009, you spearheaded coverage of the so-called Swine Flu pandemic. You discovered that, in the summer of 2009, the Centers for Disease Control, ignoring their federal mandate, [secretly] stopped counting Swine Flu cases in America. Yet they continued to stir up fear about the “pandemic,” without having any real measure of its impact. Wasn’t that another investigation of yours that was shut down? Wasn’t there more to find out?

Attkisson: The implications of the story were even worse than that. We discovered through our FOI efforts that before the CDC mysteriously stopped counting Swine Flu cases, they had learned that almost none of the cases they had counted as Swine Flu was, in fact, Swine Flu or any sort of flu at all! The interest in the story from one [CBS] executive was very enthusiastic. He said it was “the most original story” he’d seen on the whole Swine Flu epidemic. But others pushed to stop it [after it was published on the CBS News website [9]] and, in the end, no [CBS television news] broadcast wanted to touch it. We aired numerous stories pumping up the idea of an epidemic, but not the one that would shed original, new light on all the hype. It was fair, accurate, legally approved and a heck of a story. With the CDC keeping the true Swine Flu stats secret, it meant that many in the public took and gave their children an experimental vaccine that may not have been necessary.

—end of interview excerpt—

The routine lab testing of tissue samples from the most likely Swine Flu patients was coming back, in the overwhelming percentage of cases, with: NO SIGN OF SWINE FLU OR ANY OTHER KIND OF FLU.

Attkisson’s article about this scandal, published on the CBS News website, languished there. The next, bigger step—putting out the story on CBS television news—was waylaid. No deal. And CBS shut down any future investigation on the subject. Attkisson’s article died on the vine. No other major news outlet in the world picked up her article and ran with it deeper into the rabbit hole.

Those test samples from “Swine Flu patients” were being analyzed at state labs all over the country. The analysis was looking for the H1N1 virus, the purported cause of Swine Flu. Whatever the types of lab tests being done, they were coming back negative.

In other words, the virus wasn’t there. It was missing.

The whole pandemic, in the US, was resting on a virus that was absent.

There are important differences between the Swine Flu and COVID debacles. But you get the idea. Where is the virus?

There are punch lines to the Swine Flu story. One of them is: mainstream molecular biologists, geneticists, infectious disease specialists, and public health experts were not deterred in the slightest by Sharyl Attkisson’s revelations. These professionals did not go back to the drawing board. They did not question their own methods. They never questioned their ability to discover or isolate a new virus. They remained unshakable in their biases.

That’s called a clue.

Here’s another clue. About three weeks after Attkisson’s article was published by CBS, the CDC—the agency Attkisson had exposed—decided to double down and tell a new fantastic lie.

On November 12, 2009, WebMD published that CDC lie: “Shockingly, 14 million to 34 million U.S. residents — the CDC’s best guess is 22 million — came down with H1N1 swine flu by Oct. 17 [2009].” (“22 million cases of Swine Flu in US,” [10] by Daniel J. DeNoon).

22 MILLION cases. Based on nothing. Based on a virus that wasn’t there.

SOURCES:

[1] https://blog.nomorefakenews.com/2020/10/08/the-smoking-gun-where-is-the-coronavirus-the-cdc-says-it-isnt-available/

[2] https://blog.nomorefakenews.com/2020/10/09/covid-the-virus-that-isnt-there-the-root-fraud-exposed/

[3] https://blog.nomorefakenews.com/2020/10/12/the-fake-coronavirus-and-the-missing-study-the-secret-in-plain-sight/

[4] https://blog.nomorefakenews.com/2020/10/13/yet-another-case-of-the-missing-virus-they-lied-and-locked-down-the-world/

[5] https://blog.nomorefakenews.com/2020/10/15/if-the-virus-isnt-there-why-do-they-believe-it-is/

[6] http://blog.nomorefakenews.com/2020/10/19/dr-tom-cowan-explores-the-covid-virus-invented-out-of-sheer-nonsense/

[7] https://blog.nomorefakenews.com/2020/10/22/the-virus-that-isnt-there-genetic-sequencing-and-the-magic-trick/

[8] https://blog.nomorefakenews.com/2020/10/26/the-missing-virus-answering-critics-objections/

[9] https://www.cbsnews.com/news/swine-flu-cases-overestimated/

[10] https://www.webmd.com/cold-and-flu/news/20091112/over-22-million-in-us-had-h1n1-swine-flu#1

 

Connect with Jon Rappoport at No More Fake News



The Missing COVID Virus — Answering Critics’ Objections

The Missing COVID Virus — Answering Critics’ Objections

by Jon Rappoport, No More Fake News
October 26, 2020

 

For months, I’ve been providing evidence that the SARS-CoV-2 virus has not been proven to exist.

Several recent objections to my analysis have been brought forward.

I’m not interested in mentioning names or getting into disputes with people who might otherwise be doing important work.

One objection that’s been raised: a key CDC document [1] I quoted [2], which openly admitted that the virus was “not available,” was not really published in July of this year. It was reprinted or updated in July; it was originally published in February, when presumably, the CDC might have had a problem obtaining isolated virus.

Really? The “pandemic” was already underway in February. The CDC, one of the two most powerful public health agencies in the world, couldn’t get isolated virus then—couldn’t get it anywhere. In other words, there was a declared pandemic without a proven virus.

That is a damning fact. I don’t care whether it was February or July. If the CDC couldn’t get the virus, no one had it.

No one had it, because no one had isolated it. Researchers simply assumed it existed.

Not only that, the CDC document [1] [2] in which the agency admitted the virus was “not available” was a long article describing how to perform the PCR test for the virus. What virus? The one that wasn’t there?

You put together a test procedure that will change the fate of humanity, but you don’t have the item the procedure is supposed to detect. This is permissible? This is excusable? Not unless science is fairy tales.

A few superficial critics of my work should also realize this CDC document is far from my only evidence showing the virus hasn’t been isolated. They should read all my articles on the subject.

Another objection to my analysis: labs do, in fact, have isolated virus in the form of “viral stocks.”

But what does that phrase mean? It means SOUP. In dishes, in labs, researchers assume they have virus mixed with cells, mixed with chemicals and drugs and who knows what else. If this is “isolation,” a rabbit is a spaceship.

Further, it is claimed, because some of those cells—monkey cells—die in the dish in the lab, this means the virus is there and is doing the killing.

Nonsense. First of all, the cells are being starved of nutrients. Second, they’re open to being poisoned by the drugs and chemicals in the soup. The presumption of the virus doing the killing is unwarranted and absurd. [3] [4] [5]

The third objection to my analysis: researchers can assemble the PCR test without actually having the virus. They can substitute “synthetic RNA” which is a close match to the virus.

I see. And they know the synthetic RNA is a close match to the missing virus exactly how? Answer: they don’t know. They assume. They pretend. [6] [7] [8] [9] [10] [11]

This would be like saying: “Ahem. There is an unknown planet in our solar system. We haven’t seen it, we don’t know where it is, we don’t know what it looks like, but we do know the moon is a very close version of the unknown planet. Therefore, we can use everything we know about the moon to infer a precise description of the unknown planet.”

This kind of tap-dancing might win you a prize at a junior high school variety show, but it has nothing to do with science.

For those who want to further explore the core issue of the existence of the virus—e.g., medical professionals, who have large gaps and blind sports in their understanding—I STRONGLY suggest accessing the work of Dr. Andrew Kaufman [12] and Dr. Tom Cowan [13].

I understand that some people who are very much opposed to the lockdowns and the economic destruction want to keep the argument along the channels of: the deceptive PCR test; the false case and death numbers; the dangerous vaccine; the ripping away of Constitutional and natural freedoms.

Anyone who has been reading my more than 200 articles about COVID [14] knows I’ve been tackling those issues since the beginning. But the existence of the virus is not merely a distraction. It’s at the starting gate of the whole effort to initiate new levels of enslavement for all humans. It can’t be brushed aside.

It would be foolish of me to criticize people who are otherwise doing very important work to stem the tide of the technocratic takeover of Earth, simply because they aren’t addressing the existence of the virus.

If a few of them want to criticize me, fine. I’ve been around the block more times than I can count. It’s not a problem. I’d suggest, though, they do more than a dip a toe into the water of the stupendous virus-fraud.

And don’t try the tactic of accusing me of “confusing people about the pandemic.” That is not a standard for measuring veracity. It’s actually a low-level con. When two sides disagree, proponents of one side assert the other side is sowing confusion. Baloney. The confusion, in this case, is inherent in the conventional view of virus-isolation and proof of discovery.

One disease one germ, a thousand diseases a thousand germs—this lock-step ironclad pharmaceutical propaganda of more than a century has caused monstrous harm. It’s time to end the madness.

We don’t need unanimity on every issue. But we do need a measure of good will and decency. I’m glad to report that, with only a few exceptions, this is what I find.

Coda: Blithely accepting the existence of the virus puts people on a slippery slope. From that point on, they may accept at least partial anti-human “containment measures.” Lockdowns under certain circumstances, some mask wearing, some distancing, some restrictions on the size and nature of gatherings, some isolation from loved ones, some tracing, some testing. Before they know it, they’re dealing from a position of weakness and compromise: “I agree that a certain amount of destruction is necessary, but not as much destruction as Fauci wants…” On moral, spiritual, strategic, political, economic, and scientific grounds, that’s disastrous.

Now, as a backgrounder, here is my article about Dr. Tom Cowan’s recent exploration of the COVID virus invented out of sheer nonsense: [5]

Dr. Tom Cowan explores the COVID virus invented out of sheer nonsense

—Dr. Cowan analyzes yet another key document posted by the CDC, in their journal, Emerging Infectious Diseases: “Severe Acute Respiratory Syndrome Coronavirus 2 from Patient with Coronavirus Disease, United States”—

by Jon Rappoport

October 19, 2020

The hits keep coming. The CDC used an arbitrary computer “tinker-toy” process to invent a description of the virus. The virus that no one has proven exists. This is the basic conclusion of Dr. Tom Cowan.

The CDC article [3] was discovered by Sally Fallon Morrell. Her co-author, Dr. Cowan, fleshes out the fraud. Cowan’s article is titled, “Only Poisoned Monkey Cells ‘Grew’ the ‘Virus’.” [4] [5]

Dr. Cowan: “[The CDC journal article] was published in June 2020 [original publication, March 2020]. The purpose of the article was for a group of about 20 virologists to describe the state of the science of the isolation, purification and biological characteristics of the new SARS-CoV-2 virus, and to share this information with other scientists for their own research. A thorough and careful reading of this important paper reveals some shocking findings.”

“First, in the section titled ‘Whole Genome Sequencing,’ we find that rather than having isolated the virus and sequencing the genome from end to end, they found 37 base pairs from unpurified samples using PCR probes. This means they actually looked at 37 out of the approximately 30,000 of the base pairs that are claimed to be the genome of the intact virus. They then took these 37 segments and put them into a computer program, which filled in the rest of the base pairs.”

In other words, the sequencing of the SARS-CoV-2 virus was done by assumption and arbitrary inference. If this is science, a penguin is a spaceship.

Cowan: “To me, this computer-generation step constitutes scientific fraud. Here is an equivalency: A group of researchers claim to have found a unicorn because they found a piece of a hoof, a hair from a tail, and a snippet of a horn. They then add that information into a computer and program it to re-create the unicorn, and they then claim this computer re-creation is the real unicorn. Of course, they had never actually seen a unicorn so could not possibly have examined its genetic makeup to compare their samples with the actual unicorn’s hair, hooves and horn.”

“The researchers claim they decided which is the real genome of SARS-CoV-2 by ‘consensus,’ sort of like a vote. Again, different computer programs will come up with different versions of the imaginary ‘unicorn,’ so they come together as a group and decide which is the real imaginary unicorn.”

As I’ve been stating [10], the “discovery” of the “new virus” was actually the foisting of a PRE-DETERMINED STORY ABOUT A VIRUS. Nothing real or believable about it.

But once the official pattern is laid down, others follow it dutifully.

Dr. Cowan uncovers more insanity in the CDC journal article. Using the ASSUMED new virus, in an UN-ISOLATED STATE, the researchers try to prove it is harmful by injecting it on to several different types of cells in the lab:

Cowan: “The real blockbuster finding in this study comes later, a finding so shocking that I had to read it many times before I could believe what I was reading. Let me quote the passage intact:”

“’Therefore, we examined the capacity of SARS-CoV-2 to infect and replicate in several common primate and human cell lines, including human adenocarcinoma cells (A549), human liver cells (HUH 7.0), and human embryonic kidney cells (HEK-293T). In addition to Vero E6 and Vero CCL81 cells [monkey cells]. … Each cell line was inoculated at high multiplicity of infection and examined 24h post-infection. No CPE was observed in any of the cell lines except in Vero [monkey] cells, which grew to greater than 10 to the 7th power at 24 h post-infection. In contrast, HUH 7.0 and 293T showed only modest viral replication, and A549 cells [human cells] were incompatible with SARS CoV-2 infection’.”

“What does this language actually mean, and why is it the most shocking statement of all from the virology community? When virologists attempt to prove infection, they have three possible ‘hosts’ or models on which they can test…”

“The third method virologists use to prove infection and pathogenicity — the method they most rely on — is inoculation of solutions they say contain the virus onto a variety of tissue cultures. As I have pointed out many times, such inoculation has never been shown to kill (lyse) the tissue, unless the tissue is first starved and poisoned.”

“The shocking thing about the above [CDC journal] quote is that using their own methods, the virologists found that solutions containing SARS-CoV-2 — even in high amounts — were NOT, I repeat NOT, infective to any of the three human tissue cultures they tested. In plain English, this means they proved, on their terms, that this ‘new coronavirus’ is not infectious to human beings. It is ONLY infective to monkey kidney cells, and only then when you add two potent drugs (gentamicin and amphotericin), known to be toxic to kidneys, to the mix.”

“My friends, read this again and again. These virologists, published by the CDC, performed a clear proof, on their terms, showing that the SARS-CoV- 2 virus is harmless to human beings. That is the only possible conclusion, but, unfortunately, this result is not even mentioned in their conclusion. They simply say they can provide virus stocks cultured only on monkey Vero cells, thanks for coming.”

So first…use a process of genetic sequencing that involves concocting, out of an arbitrary computer program…

The existence and structure of the “new virus”…

And then, taking a soup that the researchers claim contains the virus, in an un-isolated state, inject the soup into several types of cells in the lab…

And discover the prime target—human cells—are not infected by the imaginary virus.

And after this good day’s work, walk away and pretend nothing odd or self-incriminating happened.

And oh yes, lock down the planet based on this “science.”

Naturally, we MUST take a toxic vaccine that prevents non-infection by the non-virus.

SOURCES:

[1] https://www.fda.gov/media/134922/download

[2] https://blog.nomorefakenews.com/2020/10/08/the-smoking-gun-where-is-the-coronavirus-the-cdc-says-it-isnt-available/

[3] https://wwwnc.cdc.gov/eid/article/26/6/20-0516_article

[4] https://drtomcowan.com/only-poisoned-monkey-kidney-cells-grew-the-virus/

[5] http://blog.nomorefakenews.com/2020/10/19/dr-tom-cowan-explores-the-covid-virus-invented-out-of-sheer-nonsense/

[6] https://blog.nomorefakenews.com/2020/10/08/the-smoking-gun-where-is-the-coronavirus-the-cdc-says-it-isnt-available/

[7] https://blog.nomorefakenews.com/2020/10/09/covid-the-virus-that-isnt-there-the-root-fraud-exposed/

[8] https://blog.nomorefakenews.com/2020/10/12/the-fake-coronavirus-and-the-missing-study-the-secret-in-plain-sight/

[9] https://blog.nomorefakenews.com/2020/10/13/yet-another-case-of-the-missing-virus-they-lied-and-locked-down-the-world/

[10] https://blog.nomorefakenews.com/2020/10/15/if-the-virus-isnt-there-why-do-they-believe-it-is/

[11] https://blog.nomorefakenews.com/2020/10/22/the-virus-that-isnt-there-genetic-sequencing-and-the-magic-trick/

[12] https://www.andrewkaufmanmd.com/

[13] https://drtomcowan.com

[14] https://blog.nomorefakenews.com/category/covid/



The Virus That Isn’t There and the Sales-Job

The Virus That Isn’t There and the Sales-Job

by Jon Rappoport, No More Fake News
October 23, 2020

 

In previous articles [1] [2] [3] [4] [5], I’ve established the fact that the existence of the SARS-CoV-2 is unproven; and I’ve brought forward Dr. Tom Cowan’s evidence that the genetic sequence of “the virus” was cobbled together, piecemeal, from databases, based on zero science. In other words, the “sequencing” was a fraud. [6] [7] [8]

The chosen direction of the fraud: a coronavirus. That was the arbitrary choice.

Researchers picked, off the data-shelf, a “new coronavirus”—meaning they assembled pieces of genetic code they claimed were “corona,” and they hooked them up and said, “Voila, we have a new SARS-type virus.”

If you look at the motley collection of pre-pandemic drills and exercises and conferences, the theoretical virus almost always turned out to be a coronavirus. THAT was the pre-ordained story line.

That was the plan. Selling that story.

Am I suggesting that many, many scientists, and even political leaders and globalist big shots knew, in advance, that no real virus would ever be discovered, that the sequencing would be a fake? Of course not.

In every major covert operation, information is compartmentalized. In this particular operation, we have a stunning fact: almost everyone automatically believes the genetic sequencing and the virus are real. That goes for elite scientists as well. They’re in the dark.

Only a very few are aware that the whole process of cobbling together the “new virus” is fraught with fraud. So, for all intents and purposes, “the virus” con is protected. It’s protected by institutionalized science. By massive consensus and massive ignorance.

The situation is even more stunning than that. All over the world, there are scientists in labs of various kinds who believe they’re working with “the virus,” when they’re working with a cobbled-together IDEA of the virus.

So, for the most part, in this COVID operation, the key players are only aware that researchers could arbitrarily choose one virus over another as the “cause of the pandemic.” They’re not aware that the choice is actually a fake virus.

The choice of a new coronavirus was made for a simple reason. The diagnostic test would turn up huge numbers of false positives, thus jacking up case numbers and providing the rationale for the lockdowns and the economic devastation. Which were, all along, the real aims of the operation.

To put in more specifically, the PCR test would register positive, because it was geared to detect genetic sequences commonly present in people all over the world.

To put it still another way—the PCR test was pre-set with DATA which would “match” THE DATA extracted from patients. The fix was in.

The virus was concocted out of data. It was and is data. The test was loaded with data that frequently matches the virus-data.

Think of it this way. You have a map of a lost gold mine. It seems to chart a course through the mountains and valleys of California. Of course, the map is a fake. It was drawn and made to look old.

You follow the map, and sure enough, in a remote mountain area, you arrive at a giant hole in the side of a hill. But the hole and the “mine” are fake, too. They’re a Potemkin Village. The tunnel and the braces and the struts were built recently.

The “map” matches “the mine.” Fake leads to fake.

In the digital age, any material thing can be digitized. The material thing is then represented by code. “Activate the code” and a virtual portrait of the thing pops up. But it’s just as easy to invent code for something that doesn’t exist. Or has never been proven to exist.

Like SARS-CoV-2.

Pure gold and pure garbage are made interchangeable. In the form of DATA. [9]

SOURCES:

[1] https://blog.nomorefakenews.com/2020/10/08/the-smoking-gun-where-is-the-coronavirus-the-cdc-says-it-isnt-available/

[2] https://blog.nomorefakenews.com/2020/10/09/covid-the-virus-that-isnt-there-the-root-fraud-exposed/

[3] https://blog.nomorefakenews.com/2020/10/12/the-fake-coronavirus-and-the-missing-study-the-secret-in-plain-sight/

[4] https://blog.nomorefakenews.com/2020/10/13/yet-another-case-of-the-missing-virus-they-lied-and-locked-down-the-world/

[5] https://blog.nomorefakenews.com/2020/10/15/if-the-virus-isnt-there-why-do-they-believe-it-is/

[6] https://drtomcowan.com/only-poisoned-monkey-kidney-cells-grew-the-virus/

[7] http://blog.nomorefakenews.com/2020/10/19/dr-tom-cowan-explores-the-covid-virus-invented-out-of-sheer-nonsense/

[8] https://wwwnc.cdc.gov/eid/article/26/6/20-0516_article

[9] https://blog.nomorefakenews.com/2020/10/22/the-virus-that-isnt-there-genetic-sequencing-and-the-magic-trick/



The Virus That Isn’t There, Genetic Sequencing, and the Magic Trick

The Virus That Isn’t There, Genetic Sequencing, and the Magic Trick

by Jon Rappoport, No More Fake News
October 22, 2020

 

Recently, I’ve written a series of articles revealing that the existence of the SARS-CoV-2 virus is unproven.

I’ve quoted key CDC and study documents that confess “the virus is unavailable.” Which is like an ice company saying they have no access to water. [1] [2] [3] [4] [5]

I’ve published quotes from Dr. Tom Cowan’s major article [6] exposing how CDC journal authors “assemble” the idea of a virus from cobbled sequences they ASSUME are parts of SARS-CoV-2. (Below, I reprint my article on Dr. Cowan’s shocking findings.)

Now, I want to make overall comments on the con, the game, the hustle.

The public, and most medical professionals, are awed by the whole concept of genetic sequencing. They accept the process as a holy of holies. If researchers in their lab claim they’ve “sequenced the virus,” the virus must exist. How else could its genetic structure have been discovered?

Of course, the virus doesn’t have to exist at all. We are talking about an illusion. Stage magic.

And if we could force him to explain his trick, the magician would say:

“Notice, I begin with a fragment of RNA I assume is part of a larger new virus. My assumption isn’t proven. I simply make the claim.”

“Then I lay out the genetic structure of that little piece of RNA, and I discover I need a great more genetic information to fill out the sequence of the whole virus.”

“That’s not really a discovery. I already knew I’d need much more. The question is: where am I going to get that added information?”

“The answer is: from data bases. These bases contain miles of sequences that have already been established—rightly or wrongly. Sequences of other viruses.”

“Which sequences do I choose? I make guesses. I make assumptions. Actually, I choose according to a story line that has already been laid down. In this case, a story about a member of the coronavirus family. That’s right. I always knew what I was going to look for. In fact, that initial piece of RNA I began with? I could have selected all sorts of other pieces of RNA, but I chose that one because it seemed to be from the coronavirus family.”

“Does this whole business sound like a Lego or tinker-toy operation? Well, it is. I never have a physical specimen of the virus. I never isolate the purported virus from all the material that surrounds it. I just assume or pretend the virus is in there.”

“Anyway, I now select all sorts of genetic sequences from the huge database. And I hook the sequences together, AS IF they were already connected and real and waiting for me to find them. They weren’t, but I pretend they were.”

“That pretense is the key. It’s like selling a sucker a map leading to a lost silver mine. There was never a map. The con artist cobbled it together from pieces of other old maps of a territory in the mountains of Colorado. The map looks real. It looks whole. But it was never whole.”

“THE GENETIC SEQUENCE OF THE VIRUS is that map. It’s made to look like a one long code that was there all along. But it wasn’t. It isn’t.”

“Every good magic trick works this way. The magician makes the audience believe he is performing one smooth operation. But he isn’t. He’s taking all sorts of detours. He’s reaching into his sleeve and pulling out a card. He’s palming that card so no one sees it. He’s slipping the card into the deck in his other hand. And all the while, he’s talking confidently and making other gestures to distract the audience.”

“The whole purpose of the trick is to inspire awe. In the lab, the same principle applies. The researchers SEEM to find one long genetic sequence of the whole virus. Astonishing.”

“But that’s not what happened. Not by a long shot.”

“And notice one other very important thing. In the lab, we are actually piecing and cobbling together the pattern—the code—of a virus. We don’t have to deal with actual genes. What we do is all on the level of IDEATIONAL construction. We’re hooking up DATA. So that’s another level of the trick. We’re not stringing together pieces of material. We’re stringing together pieces of data from genetic databases. This would be like standing on stage in front of an audience and doing a very clever card trick without having a deck of cards in the first place. Now THAT’S a trick for the ages.”

With all this I mind, read my previous article on Dr. Tom Cowan’s shocking discoveries:

Dr. Tom Cowan explores the COVID virus invented out of sheer nonsense

—Cowan analyzes yet another key document posted by the CDC, in their journal, Emerging Infectious Diseases: “Severe Acute Respiratory Syndrome Coronavirus 2 from Patient with Coronavirus Disease, United States”—

by Jon Rappoport
October 19, 2020

The hits keep coming. The CDC used an arbitrary computer “tinker-toy” process to invent a description of the virus. The virus that no one has proven exists. This is the basic conclusion of Dr. Tom Cowan.

The CDC article [7] was discovered by Sally Fallon Morrell. Her co-author, Dr. Cowan, fleshes out the fraud. Cowan’s article is titled, “Only Poisoned Monkey Cells ‘Grew’ the ‘Virus’.” [6]

Dr. Cowan: “[The CDC journal article] was published in June 2020 [original publication, March 2020]. The purpose of the article was for a group of about 20 virologists to describe the state of the science of the isolation, purification and biological characteristics of the new SARS-CoV-2 virus, and to share this information with other scientists for their own research. A thorough and careful reading of this important paper reveals some shocking findings.”

“First, in the section titled ‘Whole Genome Sequencing,’ we find that rather than having isolated the virus and sequencing the genome from end to end, they found 37 base pairs from unpurified samples using PCR probes. This means they actually looked at 37 out of the approximately 30,000 of the base pairs that are claimed to be the genome of the intact virus. They then took these 37 segments and put them into a computer program, which filled in the rest of the base pairs.”

In other words, the sequencing of the SARS-CoV-2 virus was done by assumption and arbitrary inference. If this is science, a penguin is a spaceship.

Cowan: “To me, this computer-generation step constitutes scientific fraud. Here is an equivalency: A group of researchers claim to have found a unicorn because they found a piece of a hoof, a hair from a tail, and a snippet of a horn. They then add that information into a computer and program it to re-create the unicorn, and they then claim this computer re-creation is the real unicorn. Of course, they had never actually seen a unicorn so could not possibly have examined its genetic makeup to compare their samples with the actual unicorn’s hair, hooves and horn.”

“The researchers claim they decided which is the real genome of SARS-CoV-2 by ‘consensus,’ sort of like a vote. Again, different computer programs will come up with different versions of the imaginary ‘unicorn,’ so they come together as a group and decide which is the real imaginary unicorn.”

As I’ve been stating [5], the “discovery” of the “new virus” was actually the foisting of a PRE-DETERMINED STORY ABOUT A VIRUS. Nothing real or believable about it.

But once the official pattern is laid down, others follow it dutifully.

Dr. Cowan uncovers more insanity in the CDC journal article. Using the ASSUMED new virus, in an UN-ISOLATED STATE, the researchers try to prove it is harmful by injecting it on to several different types of cells in the lab:

Cowan: “The real blockbuster finding in this study comes later, a finding so shocking that I had to read it many times before I could believe what I was reading. Let me quote the passage intact:”

“’Therefore, we examined the capacity of SARS-CoV-2 to infect and replicate in several common primate and human cell lines, including human adenocarcinoma cells (A549), human liver cells (HUH 7.0), and human embryonic kidney cells (HEK-293T). In addition to Vero E6 and Vero CCL81 cells [monkey cells]. … Each cell line was inoculated at high multiplicity of infection and examined 24h post-infection. No CPE was observed in any of the cell lines except in Vero [monkey] cells, which grew to greater than 10 to the 7th power at 24 h post-infection. In contrast, HUH 7.0 and 293T showed only modest viral replication, and A549 cells [human cells] were incompatible with SARS CoV-2 infection’.”

“What does this language actually mean, and why is it the most shocking statement of all from the virology community? When virologists attempt to prove infection, they have three possible ‘hosts’ or models on which they can test…”

“The third method virologists use to prove infection and pathogenicity — the method they most rely on — is inoculation of solutions they say contain the virus onto a variety of tissue cultures. As I have pointed out many times, such inoculation has never been shown to kill (lyse) the tissue, unless the tissue is first starved and poisoned.”

“The shocking thing about the above [CDC journal] quote is that using their own methods, the virologists found that solutions containing SARS-CoV-2 — even in high amounts — were NOT, I repeat NOT, infective to any of the three human tissue cultures they tested. In plain English, this means they proved, on their terms, that this ‘new coronavirus’ is not infectious to human beings. It is ONLY infective to monkey kidney cells, and only then when you add two potent drugs (gentamicin and amphotericin), known to be toxic to kidneys, to the mix.”

“My friends, read this again and again. These virologists, published by the CDC, performed a clear proof, on their terms, showing that the SARS-CoV- 2 virus is harmless to human beings. That is the only possible conclusion, but, unfortunately, this result is not even mentioned in their conclusion. They simply say they can provide virus stocks cultured only on monkey Vero cells, thanks for coming.”

So first…use a process of genetic sequencing that involves concocting, out of an arbitrary computer program…

The existence and structure of the “new virus”…

And then, taking a soup that the researchers claim contains the virus, in an un-isolated state, inject the soup into several types of cells in the lab…

And discover the prime target—human cells—are not infected by the imaginary virus.

And after this good day’s work, walk away and pretend nothing odd or self-incriminating happened.

And oh yes, lock down the planet based on this “science.”

Naturally, we MUST take a toxic vaccine that prevents non-infection by the non-virus.

SOURCES:

[1] https://blog.nomorefakenews.com/2020/10/08/the-smoking-gun-where-is-the-coronavirus-the-cdc-says-it-isnt-available/

[2] https://blog.nomorefakenews.com/2020/10/09/covid-the-virus-that-isnt-there-the-root-fraud-exposed/

[3] https://blog.nomorefakenews.com/2020/10/12/the-fake-coronavirus-and-the-missing-study-the-secret-in-plain-sight/

[4] https://blog.nomorefakenews.com/2020/10/13/yet-another-case-of-the-missing-virus-they-lied-and-locked-down-the-world/

[5] https://blog.nomorefakenews.com/2020/10/15/if-the-virus-isnt-there-why-do-they-believe-it-is/

[6] https://drtomcowan.com/only-poisoned-monkey-kidney-cells-grew-the-virus/

[7] https://wwwnc.cdc.gov/eid/article/26/6/20-0516_article



David Icke Shares Work of German Neurologist: Masks Are Destroying Children’s Brains

David Icke Shares Work of German Neurologist: Masks Are Destroying Children’s Brains

by David Icke, DavidIcke.com
October 16 2020

 



Original video available at David Icke BitChute channel.

[As a service to protect truth from censorship, mirrored copies of this video are available at Truth Comes to Light BitChute, Lbry, Odysee & Brighteon channels. All credit, along with our sincere thanks, goes to the original source of this video.]

Truth Comes to Light editor’s note:

See also:

German Neurologist Warns Against Wearing Facemasks: ‘Oxygen Deprivation Causes Permanent Neurological Damage’ by Henna Maria, Sott.net



How to Wear Your Mask Like a Boss

How to Wear Your Mask Like a Boss

by The HighWire with Del Bigtree
October 15, 2020

 



Want to learn to wear your mask like a BOSS? You’ve got to learn from a boss. Take a look.



If the Virus Isn’t There…Why Do They Believe It Is?

If the Virus Isn’t There…Why Do They Believe It Is?

by Jon Rappoport, No More Fake News
October 15, 2020

 

For the past eight months, I’ve been providing evidence that no one has proved the COVID virus exists.

Over the past week, I’ve quoted two major sources—the CDC and the authors of a major European study—who admit they did not have any virus. [1] [2] [3] And both of these groups were, at the same time, constructing a way to do a diagnostic test for that very virus which wasn’t there.

I’ve also pointed out that scientists throw around the phrase, “isolation of the virus,” like short-order cooks slinging hash in a diner. The phrase is used with incredible carelessness and deceptive imprecision.

Likewise, researchers’ claims of having “sequenced” the genetic structure of the virus are very misleading, because the sequencing is done without direct observation of the virus. It is INFERRED from analyzing a piece of RNA which is ASSUMED (not proved) to come from the virus.

Most of these scientists are true believers. They accept, like dogma, the standard and non-valid procedures for “isolating” and “sequencing” the virus.

A smaller number of scientists understand the hoax, but they remain criminally silent—or they are actively perpetuating the hoax.

In a similar vein—but without the absurd certainty—astronomers make all sorts of inferences about what is occurring on distant planets; but they support sending probes into space to actually see and record what is happening there; and they admit they are frequently surprised and shocked by what they find: a picture that contradicts many of their inferences.

Not so with virologists and geneticists. They utilize a closed system of analysis, which automatically confirms what they already believe. This is the furthest thing from science. This would be on the order of claiming the devil is causing hurricanes, and then “proving it” with a gibbering brand of abstract theology.

Of course, when it comes to viruses, the follow-up is censorship or ridicule of those who doubt theological “biology.”

If a prestigious medical journal opened up its pages to an intelligent debate about the existence of the COVID virus, remarkable things would happen. In the light and fresh air of honest debate, all sorts of skeletons would emerge from the closet. But such a debate is not permitted.

Why? Obviously, because the result would be devastating.

Because of the absence of such open and frank discussion, people are left with two thoughts: a pandemic based on nothing is too astonishing to consider; and a hundred years of official propaganda about germs (and genes) as the ominous ever-present source of all disease is too formidable to reject.

I want to give you an idea what it’s like to encounter researchers’ arcane descriptions of “isolating the virus.” Here is a section from a major Chinese study, published in the New England Journal of Medicine, on February 20, 2020. This is the key study which “confirmed” that a new virus was causing an outbreak in China. Title: “A Novel Coronavirus from Patients with Pneumonia in China, 2019.” [4] The section is: “Isolation of Virus”. You’ll need hip boots and a machete as you wade your way through it—

“Bronchoalveolar-lavage fluid samples were collected in sterile cups to which virus transport medium was added. Samples were then centrifuged to remove cellular debris. The supernatant was inoculated on human airway epithelial cells,13 which had been obtained from airway specimens resected from patients undergoing surgery for lung cancer and were confirmed to be special-pathogen-free by NGS.14”

“Human airway epithelial cells were expanded on plastic substrate to generate passage-1 cells and were subsequently plated at a density of 2.5×105 cells per well on permeable Transwell-COL (12-mm diameter) supports. Human airway epithelial cell cultures were generated in an air–liquid interface for 4 to 6 weeks to form well-differentiated, polarized cultures resembling in vivo pseudostratified [!] mucociliary epithelium.13”

“Prior to infection, apical surfaces of the human airway epithelial cells were washed three times with phosphate-buffered saline; 150 μl of supernatant from bronchoalveolar-lavage fluid samples was inoculated onto the apical surface of the cell cultures. After a 2-hour incubation at 37°C, unbound virus was removed by washing with 500 μl of phosphate-buffered saline for 10 minutes; human airway epithelial cells were maintained in an air–liquid interface incubated at 37°C with 5% carbon dioxide. Every 48 hours, 150 μl of phosphate-buffered saline was applied to the apical surfaces of the human airway epithelial cells, and after 10 minutes of incubation at 37°C the samples were harvested. Pseudostratified [!] mucociliary epithelium cells were maintained in this environment; apical samples were passaged in a 1:3 diluted vial stock to new cells. The cells were monitored daily with light microscopy, for cytopathic effects, and with RT-PCR, for the presence of viral nucleic acid in the supernatant. After three passages, apical samples and human airway epithelial cells were prepared for transmission electron microscopy…”

I can guarantee one thing: If a medical journal opened up its pages to a frank and protracted discussion, from all comers, about this “process of isolation,” you would see fireworks exploding in all directions. Within a few months, there would be raging global debate about the authenticity of “isolation.”

The density of the description in the China study is exactly why, for months, I’ve been demanding a straightforward real-world experimental test of the “new virus.” [5]

You line up 1000 patients who have been diagnosed with the new epidemic illness. You remove tissue samples from all of them. You put these samples through the above “isolation process.” You decide which patients have a huge amount of virus in their bodies.

Those patients should certainly be ill.

Then LET’S SEE. Are they ill or are they running marathons?

Real world.

Not lab world.

This study will never be done for one obvious reason. Unlike the astoundingly complex manipulations that go on in the lab, this real-world experiment has a yes or no answer. Are the patients ill or healthy?

But that’s asking too much from these researchers. They would rather infer and assume whatever suits their fancy.

They never want the rubber to meet the road.

SOURCES:

[1] https://blog.nomorefakenews.com/2020/10/08/the-smoking-gun-where-is-the-coronavirus-the-cdc-says-it-isnt-available/

[2] https://blog.nomorefakenews.com/2020/10/09/covid-the-virus-that-isnt-there-the-root-fraud-exposed/

[3] https://blog.nomorefakenews.com/2020/10/13/yet-another-case-of-the-missing-virus-they-lied-and-locked-down-the-world/

[4] https://www.nejm.org/doi/pdf/10.1056/NEJMoa2001017

[5] https://blog.nomorefakenews.com/2020/10/12/the-fake-coronavirus-and-the-missing-study-the-secret-in-plain-sight/

cover image credit PublicDomainPictures, pixabay



James Corbett: What I Learned From the Master of Propaganda

James Corbett: What I Learned From the Master of Propaganda

by James Corbett, The Corbett Report
October 13, 2020

 



Watch on Archive / BitChute / LBRY / Minds / YouTube

Did you know that Edward Bernays was on Late Night with David Letterman in 1985? Well, he was, and the full conversation is up on GooTube (for now). Join James for an exploration of the insights we can gain into the manipulation of the public mind by the man who literally wrote the book on Propaganda.

SHOW NOTES:

“Bernays” search on corbettreport.com

Interview 1581 – James Corbett Breaks Down the Great Reset

Bernays on Letterman

Propaganda by Edward Bernays

Edward L. Bernays interview, 1986-10-23

The Century of the Self – Part 1: “Happiness Machines”

Episode 259 – Meet Adam Curtis, Establishment Contrarian



Newtown, CT Resident: Questioning the Sandy Hook Narrative — Mind-Boggling “Coincidences” Connect Mafia-Like Ties Within Key Town Positions

Newtown, CT Resident: Questioning the Sandy Hook Narrative — Mind-Boggling “Coincidences” Connect Mafia-Like Ties Within Key Town Positions

 

Rebecca Carnes, Sandy Hook: Crime Family Structure Key to Control. Right, Sandy Hook Fire Department?

by Rebecca Carnes
sourced from James Fetzer
July 12, 2020

 

[jamesfetzer.org editor’s note: For those who want more background about the Sandy Hook event, watch “Sandy Hook Update: Tracy loses, Wolfgang wins. The Deep State Strikes Back!”, where you can see much of the evidence for yourself, including how Shannon Hicks took staged photos of a mock evacuation of children from the school. This may be the most important article ever published on the Sandy Hook hoax.]

 

Among the Everest-like mountain of unbelievable “facts” and assorted discrepancies that make up the official Sandy Hook story delivered to Newtown residents and the American public, are the many mind-boggling and statistical-shattering “coincidences” that connect family members in key town positions. First up on our list for consideration: The Sandy Hook Fire Department.

Most anyone outside of Newtown (and maybe even those in Newtown who haven’t lived here long enough to know the names of certain town leaders and their well-placed family members) – probably wouldn’t piece together the mafia-like family ties and otherwise of those in Newtown’s power positions during and after the Sandy Hook event. But these local relationships between town, police, fire, church, newspaper, real estate, school and court – are incredibly revealing when taking a good, close-up look at what was delivered as the official Sandy Hook story according to the distorted lens of the controlled media and especially according to the Connecticut State Police (CSP) report on Sandy Hook issued in 2013 by Danbury District Attorney and Newtown resident (coincidence #1) Stephen J. Sedensky III.

For starters, let’s take a look at the Sandy Hook Fire Department who was so hyper-connected to the Sandy Hook terror production they could have hosted it and served refreshments at their fire station (oh yeah, they pretty much did). And let’s not neglect to examine the key divorces, marriages and family relations between Sandy Hook firefighters and important power players in our town leadership, the likes of which make the intermingling and intrigue of a 1980s soap opera look mild.

Horrified citizens of this country who watched the orchestrated terror descend on Newtown that fateful Dec. 14, 2012 morning, likely didn’t bat an eyelash when the media reported that Sandy Hook Elementary School secretary Barbara Halstead was one of the first “victims” to call 911 that morning. That’s because your average citizen (and maybe even your average Newtown resident) might not have known that among the first five emergency responders that morning, two were directly related to Barbara and all were firefighters from the Sandy Hook fire station located at the bottom of the Sandy Hook Elementary School’s driveway. The first to arrive on scene was Barbara Halstead’s former husband and long-time Sandy Hook Fire Chief William “Bill’ Halstead Sr. (coincidence #2), along with Barbara’s Sandy Hook firefighter daughter Karin Halstead who just happened to also be Captain of Newtown’s EMS (Emergency Management Services) department in charge of overseeing emergency communications that morning (coincidence #3).

Also in tow as among the first five responders, was former Sandy Hook Fire Captain John Jeltema who was Karin Halstead’s boyfriend at the time and now her husband. As head of Newtown’s Emergency Management on 12/14, Karin Halstead was therefore in charge of overseeing the 911 system and EMTs – and was likely one of the first to hear her mother Barbara’s 911 call from the Sandy Hook school office (coincidence #4).

At 9:46 a.m. that morning, Karin Halstead is also the one who absurdly and shockingly told the first two ambulances and paramedics responding to the emergency 911 call to NOT drive up the school driveway but rather park and wait in the rear lot of the Sandy Hook fire station. Karin Halstead’s husband is Sandy Hook firefighter and former Sandy Hook Fire Captain John Jeltema who is also brother to Connecticut State Trooper Christine Jeltema (coincidence #5) who we just saw give a press conference in May regarding the apparent mental breakdown and killing rampage reportedly perpetrated by Peter Manfredonia. Peter being the Sandy Hook native and UConn student who just happened to grow up on the same Yogananda Street as Adam Lanza (coincidence #6) and whose uncle Chris Manfredonia lived directly behind the Lanza house (coincidence #7) and … (try and swallow all of these “coincidences” without choking, please) .. arrived at the Sandy Hook school at 9:30 a.m. at about the same time as Adam Lanza (coincidence #8).

Chris Manfredonia was reported as saying he got to the school 15 minutes early with plans to attend a scheduled 9:45 a.m. gingerbread house-making activity with is first-grade daughter in Kaitlin Roig’s class. According to news reports in the L.A. Times and elsewhere, Manfredonia reportedly said he heard popping sounds, smelled sulfur and then ran around the outside of the school to try and get to his daughter when he was stopped and handcuffed by police. Chris Manfredonia and an armed, off-duty tactical SWAT officer who just happened to be near the school that morning and was running through the woods away from Sandy Hook Elementary School were both detained by police (as were three other men who are seen in aerial footage fleeing the school grounds). A troublesome entry on the official Sandy Hook Timeline (Page 1, A 84, Appendix) of the Connecticut State Police (CSP) report, states that a “parent” arrived at SHES at 9:30 a.m. for a gingerbread house project and was “buzzed into” the school at the main doors after which he reports hearing gunfire of about 15 shots.

Here’s the excerpt from Page 1 of the CSP Timeline:

09:30:00 Parent arrives at SHES for the gingerbread house event and has to be buzzed into SHES. At around 9:34, hears gunfire, reports approx 15 shots.

So the official narrative of the Connecticut State Police and Stephen Sedensky’s district attorney’s office puts Chris Manfredonia INSIDE Sandy Hook Elementary School at 9:30 a.m. at about the same time Adam Lanza reportedly shoots the glass out to the right side of the main entrance doors and begins shooting the teachers and kids. Why would the press report that Chris Manfredonia was running around the outside of the school trying to reach his daughter somehow and then was stopped by police? Who gave them this information? How could there be such a significant discrepancy in the CSP report and what was told to the public? How come nobody in the press ever interviewed Chris Manfredonia to clear up this matter? How come the Newtown police quickly cleared and released Chris Manfredonia that morning, especially if he was IN THE SCHOOL when the shots were reportedly being fired, as the official CSP report attests?

Read the rest of the article, including images and links, HERE.



Dr. Joseph Farrell: Emergency Powers, COVID-19, Bio-Economic EMF Warfare, Deep State, Continuity of Government

Dr. Joseph Farrell Emergency Powers COVID-19 Bio-Economic EMF Warfare Deep State COG!

by Daniel Liszt, Dark Journalist
March 26, 2020

 

Dark Journalist And Dr. Joseph Farrell COVID-19 Bio-Economic EMF Warfare Deep State COG Continuity Of Government!

Special LiveStream with QA

Bio-Economic Warfare

In this fascinating episode Dark Journalist interviews Oxford Scholar Dr. Joseph Farrell on the seizing of unconstitutional Emergency Powers in relation to the COVID-19 health crisis.

They examine whether this is an operation designed to accomplish a financial reset that consolidates financial, political and surveillance power into the hands of a repressive Deep State.

Support Dark Journalist: https://darkjournalist.com

The Dark Journalist X Series Trailer: https://youtube.com/watch?v=eSVNSAy02ss



Janus, Illuminati God of Chaos & Deception: Twin Towers & Two-Faced Rulers

Janus, Illuminati God of Chaos & Deception: Twin Towers & Two-Faced Rulers

by Zen Gardner
September 17, 2011

 

Janus Bifrons ~ Who was the two-faced Greco-Roman god?

The irony is that people not only know their rulers and society overall are two-faced, they expect it.

Whether consciously or subconsciously we all know lying and deception are inherent to the matrix that’s been foisted upon us.

Another irony is that even in the definition of Janus there are two very different versions as to whom this mythological character really was.

Who was Janus?

We see this two-faced image a lot in our lives. Many know it dates back to Greek and Roman mythology. However, there’s much more to this character than meets the eye.

We’ll start with the lighter version:

Janus means “archway” in Latin. Janus was the Roman god of gateways and beginnings, often depicted as having two faces looking in opposite directions. The month of January is named for him.

Interesting. Sounds pretty innocuous. Wikipedia also mentions:

As a god of motion he looks after passages, causes the startings of actions, presides on all beginnings and since movement and change are bivalent, he has a double nature, symbolized in his two headed image.

And more:

His two faces (originally, one was always bearded, one clean-shaven; later both bearded) originally represented the sun and the moon. He was usually depicted with a key. 

Janus head is a popular phrase for deception, that is, when action does not match speech.

OK. I can do that.

“Two-faced” apparently came from this archetype emblazoned into our collective subconscious.

There’s a lot of deceit and cover up in the world, to the extent most people are quite leery of each other. Very unfortunate, when trust would go so much further but the world’s been corrupted and corruption is glorified.

And this “permission” to deceive to get ahead and even subjugate others is apparently too good to pass up for some.

A quick perusal of governmental, corporate, legal, financial and social leadership and behavior around the world is all the confirmation you need.

Keys, Janus and the Pope

Note Janus was depicted with a key. It turns out there’s a lot to this. Remember he’s the god of doors.

There’s another god, a goddess, who also bore a key.

Remember, Catholicism teaches ancient paganism with Christian names and terms. This is another perfect illustration of that.

 

 

 

Follow me:

About 378, the Pope fell heir to the keys that were the symbols of two well-known Pagan divinities at Rome. Janus bore a key, and Cybele bore a key; and these are the two keys that the Pope emblazons on his arms as the ensigns of his spiritual authority. (and flag)

Cybele…with fish god mitre the pope wears, and key in hand ~ goddess worship anyone?

What was this power of the keys?

It was these two gods (Janus and Cybele) that had the power of heaven and earth.

Whoa…that’s a lotta power, heaven and earth. As you can see, all this ties in with the Isis-Samiramis et al lineage of goddess worship that goes down through millennia and in which today’s Illuminati still revel.

Look at early American architecture and symbolism from the goddesses on pedestals and domes around Washington DC to the Freemasonic gift called the Statue of Liberty.

It’s all essentially the same old goddess.

In the US she’s called “Columbia”. Ring a bell?

Compare the headgear of the two above images.
In this picture the Pope carries the bent cross of the antiChrist.

Yup, the government is fully based on Freemasonic paganism to the core. All for occult power as they honor the forces they worship and tap into. More on that in a minute.

But this Vatican connection and switchover from these pagan key gods to supposed “keys of the kingdom” that somehow links to Peter whom they claim to be the first Vicar of Christ of which the Pope is spiritually descended is absolutely typical historical revisionism.

The pagan Roman priesthood (before the birth of Jesus Christ) had a sovereign pontiff who held the keys.

Pagan keys of Janus and Cybele

The goddess Cybele was also worshiped as Cardea, and the College of Cardinals was named for her.

She bore a key like Janus, which opened the gates of the invisible world.

In Greek mythology Cybele holds the key to Earth, shutting her up in winter and opening her again in the spring. 

Similarly, Janus opens the door of the sky and releases the dawn.

The term Cardinal is derived from Cardo, a hinge. Janus, whose key the Pope bears, was the god of doors and hinges…

It was only in the second century before the Christian era that the worship of Cybele under that name was introduced to Rome; but the same goddess, under the name of Cardea, with the “power of the key,” was worshipped in Rome, along with Janus, ages before. Source

Byzantine two-headed (faced) Eagle holding the keys

Now the “Flip Side” of Janus

Janus was no small potato. As you research more and more into him, he connects a lot of dots and represents serious forces.

He presides over the concrete and abstract beginnings of the world, such as religion and the gods themselves; he too holds the access to Heaven and other gods: this is the reason why men must invoke him first, regardless of the god to whom they want to pray or placate.

He is the initiator of the human life, of new historical ages, and economical enterprises: in myth he first minted coins and the first coin of the libral series, bears his effigy on one face.  Source

Who was this guy?

He’s apparently a gateway, for economic power and societal change.

But is this a real entity?

Someone they invoke?

And/or a blueprint for chaos?

Texe Marrs calls it:

The Illuminati secret formula for world revolution and deceit. This is how and why Satan is making such incredible progress. The Janus Factor is Satan’s hidden method. The two-faced Roman god Janus was known as “Keeper of the Keys” and as “Interpreter of the Mysteries.” Throughout history, Janus operatives ~ Darwin, Hegel, Freud, Marx, Lenin, Obama, and others ~ have successfully employed the Janus method to psychically and culturally churn global events and overturn all standards of morality and human dignity. Source

In other words, by playing with right v. wrong and reversing social norms to bring society into chaos, or utilizing the use of opposites with the Hegelian dialectic where a planned action provokes a similarly planned re-action, and other techniques, you can do a lot of manipulative damage.

As they have. Another dialectical symbol found throughout history, signifying the same concept as Janus is the two headed eagle, or phoenix.

The eagle of the Holy Roman Empire

 

Double headed eagle on Albert Pikes Freemasonry book ‘Morals and Dogma” with Order Out of Chaos slogan.

Enter Freemasonry

Freemasonry is all about opposites and duality, and playing one side against another as some sort of occult ritualistic exercise, supposedly to evoke the illuminated man and world.

It’s basically what the motto on their two-headed eagle crest says, create chaos to bring about the new world order essentially.

Most involved in lower level Freemasonry don’t know what the heck they’re involved in, like lower level anythings.

But the commitment to their agenda gets extremely serious at higher levels and human life takes a back seat to the “illuminated” program of using these techniques and powers for very evil ends.

Freemasonic symbolism is rife with duality..sun-moon, black-white, twin pillars, male-female etc.

Janus-Bifrons is his full name

The Illuminati are all about levels of disguise via carefully constructed lies, half-truths and diversions. Just as their doctrines of opposites seem to have this new-agey air of esoteric truth, these entities they literally worship in some form or another always have a cover.

What they are leaving out in the name Janus in all the popularized pictures and references to this guy is that Janus was actually known as Janus-Bifrons, and when you research THAT name it takes us to a whole different place.

In demonology Bifrons was a demon, Earl of Hell, with six legions of demons (twenty-six for other authors) under his command.

He teaches sciences and arts, the virtues of the gems and woods, herbs, and changes corpses from their original grave into other places, sometimes putting magick lights on the graves that seem candles. He appears as a monster, but then changes his shape into that of a man.

The origin of the name is, without any doubt, the Roman god Bifrons (Janus).

Other spellings: Bifrovs, Bifröus.

The Queen of England’s royal Masonic goat on parade.

Oh dear! How did this photo of the future King of England with his “pet goat” end up here?

Bifrons was also one the names given to the baphomet allegedly worshipped by the Knights Templar, and which description was as a statue with two heads surely inspired in the Roman god Bifrons, one looking towards the left to tell the past, and the other looking towards the right to tell the future, all this by means of the power of a demon (there were other suppositions on the figure of the baphomet). Source

It is also said the Janus-Bifrons appeared as a monster and then changed his appearance to that of a man.

In other words, he was (is) a shape-shifter.

A computer game demon named Bifrons (Janus’ real name) Reptilian. Hmmm…

 

AND BAPHOMET?


The Knights Templar were the precursors to today’s Freemasons. Now we see how this all ties in together. Looks like this could be the same nasty dude in a few different disguises. Typical.

 

Now Baphomet actually takes us straight to witchcraft and the horned goat.

 

Which also ties in with Freemasonry. Any way you connect it, we’re down in the bowels of the occult now.

And as we know, the Illuminati are drenched in witchcraft however you slice it or want to call it.

The melding of Janus and Cybele.

Speaking of keys, when it comes to evoking spirits as the Satanic Illuminati do, there’s a lot of black magick involved that has very specific procedures. And many of these wicked controllers are adepts in this to increase their power and obtain favors.

The Lesser Key of Solomon contains detailed descriptions of spirits and the conjurations needed to invoke and oblige them to do the will of the conjurer (referred to as the “exorcist”). It details the protective signs and rituals to be performed, the actions necessary to prevent the spirits from gaining control, the preparations prior to the invocations, and instructions on how to make the necessary instruments for the execution of these rituals. Source

Things to steer clear of. Janus was considered the most important god of the Greco-Roman pantheon…even above Zeus (Jupiter). Yes, he was above the recognized head god ~ a very Luciferian concept.

Janus Global Communications logo.

So when you see references to Janus it’s nothing innocent, believe me.

Pleasant. By the way the dove at the top represents the goddess Columbia aka Isis aka Semiramis et all….right back to the other key holder, his contemporary Cybele…

Janus brought up to date

Janus is a very popular name and logo. Again, freemasonry rules the corporate world in addition to politics, finances, etc. They speak to each other in logos, and attempt to evoke spiritual power from their use.

The elite bloodlines and their minions have been into this for millennia. Take a look at an occult Rothschild party in the early part of last century:

Baroness Marie-Hélène de Rothschild sporting golden calf baphomet,
and Baron Alexis de Redé as two-faced Janus at a Rothschild soiree..

Janus was also a secret government psyop group. Again, nothing really constructive going on, one might say:

The super-secret Janus Group utilizes very highly-trained psychic assassins, who employ such techniques as the green and red marble systems, as well as the White Glove method. 

In order to psychically kill enemies of the Illuminati, the Director of Janus (an Illuminatus) wields more political clout than the hierarchy of the National Security Agency. 

He was an intimate friend of the late Roy Cohn ~ a director of Permindex, the group which masterminded the assassination of President John Kennedy. Source

Comforting to know you’re in good hands…

Weathered gargoyle embraces Shepard Hall, City College of New York

This one even boasts the Illuminati pyramid.

And finally…

Speaks for itself.

The lying, masked manipulative media in a Janus nutshell…

Conclusion

I hope this little foray into this age old deity has been “illuminating”.

It continues to amaze me how it always traces back to an innate lust for power and control by these elite Illuminati minions right through the ages.

They preserve what they consider to be their “inside edge” within their bloodline, and this can be traced back to the dawn of this civilization…and probably the one before.

[ED: From the ultimate deception of 911. The harbinger of change bringing the world to a darker place, serving the desires of the very dark beings on this planet. I repeat, Bush’s sitting with that classroom of children was Masonic symbolism and dark ritual at its most bizarre, in-your-face, in plain sight variety. The goat book, the innocent children, their chant. It all harks back to Janus!]

It’s important to decode their language, be it through symbolism, mythology, alchemical practices or societal engineering and programming.

ONCE YOU’RE ON TO IT,

IT LOSES ITS POWER.

The simple and ignorant will pass on and suffer the consequences.

Keep on learning, and most of all….keep wondering.

Love, Zen

 

Zen Gardner is an impactful and controversial author and speaker with a piercing philosophical viewpoint. His writings have been circulated to millions and his personal story has caused no small stir amongst the entrenched alternative pundits. His book You Are the Awakening has met rave reviews and is available on amazon.com. You Are the Awakening examines the dynamics of the awakening to a more conscious awareness of who we are and why we are here – dynamics which are much different from the programmed approach of this world we were born into.



Sopping Up the Gullibles and the Truly Great Escape

Sopping Up the Gullibles and the Truly Great Escape

by Zen Gardner
April 4, 2018

 

I’m continually dumbfounded by the things our human family will fall for. Myself included obviously, even what draws my attention. It’s a wild ride here.

Actually it’s not surprising nor at all unprecedented. We’ve been duped all of our lives. In fact, we’re bred duped in a fabricated whirled of false choices. I look back at my own life incredulously at the things I’ve fallen for. But I woke up from much of it, and continue waking up as many are doing. The key is to keep on – keep on learning, keep on changing, and keep on letting go of what doesn’t serve us any longer.

The pace is quickening. Today’s belief is tomorrow’s interesting phase we passed through, as we learn yet again to keep letting go. Fluidity is the key. What’s real and truly effective in our growth and lives will manifest. It’s all in place – we just need to clear the rubble, let things out, admit them and get in touch with them, learn deeply from them, and release it. All the while digging deep within for the Wellspring.

Easier said than done but it’s a process that can’t be bypassed.

In the external, the massive examples of “the big dupe” in society at large are religions, governments and the imposed economic system for starters. But those are obvious. Society is rife with containment systems from the top down and bottom up. Finding out about manipulated wars, false flags and controlled opposition is a massive wakey wakey moment for most. But that’s just the tip of the iceberg. The true degree to which humanity is being manipulated is almost unfathomable. But we need to pass through that phase into the realm of profound personal freedom and spiritual empowerment.

The False Hope Trap and the Mutant Matrix

What seems to escape the awareness of many is this false hope phenomenon designed to draw the disillusioned back into the arena of endless futility. From hopey changey political types to diversions with outlandish “inside information” of never substantiated “massive political changes” under way – all to suck up energy and attention. That so many seemingly awake activists got swept into Trumpmania right on the tail of the O-bummer illusion was a total shock to many of us. And it goes on, one after the other.

By design.

I’ll add Q-anon to that just because of the effect and what it’s aroused, but I don’t know and it doesn’t matter to what extent it’s “real”. Psyops abound no matter how much “truth” they reveal. Now “The Event” is captivating everyone’s imagination. That’s hardly any different from the rapture escape hatch but again, there’s truth to it. For goodness’ sake, we’re in the middle of “the event “- we are the event if you ask me. The shift is arriving through us. The external will change, if need be, once we do. But it will likely collapse as the new is concurrently being born in the hearts of mankind.

It’s anything but “be here now” it seems. There’s always another ploy afoot to channel this false hope agenda and keep us from the business at hand. Beware of that.

My question regarding these ploys is: why Isn’t this stuff obvious at this point? As Ole Dammegard, who has relentlessly and fearlessly exposed the pattern of these psyops says, “Come on, people!” What do people want, a revival or reformation of a system that was a set up from the get go? The US for example was designed from its inception to be exactly the manipulated globalist corporation that it is today, for all those holding on to the Constitution as some sort of safe guard. That’s way hard for many to swallow it, but it’s the truth.

Be A Glean Machine

Of course there are elements of truth and safeguards for supposed freedom peppered throughout the American experiment. How else would it work? This is true of just about everything, learning to see what’s true, false and/or agendized. We need to learn how to glean the truth and what resonates from any source and jettison the rest.

Just look how whole populations have been funneled into complete slavery and servitude. Of course they have to give the illusion of choice and some tenets of apparent freedom and personal rights. It’s still a gulag; a big comfy spun-into-fantasyland one. They discovered a long time ago this phony idea of democracy would work better at subduing a populace than outright despotism, which is very hard to enforce and obviously wrong and therefore causes rebellion.

The master stroke is to keep everyone seemingly “happy” with their “stuff” and entertainments and the illusion of choice. Of course you can add in the Huxleyan pharmacological nightmare and Orwellian style full spectrum surveillance and all the rest. And how was that sold? For peoples’ protection of course; and the drugs are to make us “happy and healthy”. Not to mention all the other vectors aimed at crippling humanity, from toxic food, air and water to the microwaved environment and on and on.

It’s quite the mind-boggle. No wonder so few want to wake up out of this dystopian nightmare. Not only would they have to do something about it, but they’d risk losing their comfy lives. That’s why they fiddle with energy and commodity prices to keep everyone placated. That’s also why they don’t pull the plug on the economy. It would be too messy. They like the slow full spectrum control and population reduction method, as outlined by the Fabians way back when and even before. That way we clean up as we go and the population slowly dies off and the rest give in. They’re long range planners, and slow burn executioners.

Does this surprise you? Or scare or depress you? It’s just reality on that level. We’re at an amazing convergence point in human history. We need to see it for what it is and the opportunity this provides us. What is the real solution to all this? Try and fix it? Try and stop it? How? Can we even? Certainly not on their playing field that they keep luring people back into.

This is where the supernatural comes in. It’s actually just plain natural but it’s been marginalized again by the matrix lie. What are we essentially? Just meat robots pushing or being pushed around by other meat robots? That’s what these dark forces would have us believe. Why?

Because once we discover who we really are and the soul-level power within us it blows the whole thing to smithereens. And it’s not a low level power thing like the brute force or clever mind tricks and tech crap they use. Our weapons are not of this world. They are spiritual. It’s time to activate those and trust the fact that fighting on their level or fearing them or being in awe of their phony power (think Wizard of Oz behind the curtain) is not an option.

Because it isn’t. We cannot play their game. We have a much much bigger mission here.

We need to get to Source as deep and as fast as we can and drop everything else. That’s how I see it. We set the wheels of the Multiverse in motion when we put first things first and dig deep to our eternal connections. We cannot do it ourselves at their level. It’s a ploy to draw us in and not discover the heavy duty amazingness that we are connected to and can thereby co-create and release the immense power of true love and truth from a level they know not of.

I’m reminded of the ancient Chinese tale of a spiritual master who was confronted by barbaric warriors who had just slain a whole village. He stayed in complete peace as they threatened him every which way. The inner and outer chatter of the thugs grew and grew as the wise man didn’t flinch even at thrusting swords. Eventually the errant attackers killed themselves to prove how brave they were.

For those of you in the know, that sure sounds like the Samson option the psychopaths have up their sleeve – so be it. We’re just visiting this planet anyway to learn many things and move on. But oh, what drama! It’s very real, but ephemeral at the same time as we grow through this.

The Big Lie Sold Via Many Tricks – Over and Over

The matrix is a set up and complete lie in absolutely every aspect, permeating every phase of deliberately structured society. As the sign in the close-out store says “Everything must go!” That goes for virtually everything external and internal, including all of our personal idols and worn out beliefs and ideas and self image fears and contortions. The only way out of this mess is through the wormhole within us – our essential being that is connected to all of the Universe, and powered, protected and led by its very Source.

But I do wonder how can anyone place any credence at all in these obvious tricks. That may sound arrogant but you have to admit, it’s remarkable. What are people hoping for? For the metastasizing mutant matrix to correct itself, or that it’s in any way, shape or form fixable?

That’s a central tenet of the trap. Work on the illusion as if it’s real. It’s heavy duty energy diverging stuff and distraction from the real work within us to discover who we truly are and our connectivity to Source. The implications of this awareness are paramount.

The matrix is a vibrational black hole. Get in it, work in it, enter into conflict with it and ceaselessly describe and gripe about its workings and we’re burnt toast. Not just spent misdirected energy, but actually feeding the thing we’re so called opposing. Yes, go through the process to become aware of its existence and pervasive hold on humanity, but let’s be conscious and take the wisest course of action once we are awake and informed, and move through it.

The attachment is what to look out for. False hope diversions are incessantly being thrown at us and they’re easy to glom into. They seem to bring temporal peace and assurance in the battleground here. They’re not real. We can’t let ourselves get fooled and diverted from the real work. Drilling down to awareness and powers we never dreamed of. This is the first step. They can happen concurrently, but never neglect the drive for true connection to Source, unimpeded. We’ll know it when we get there. That’s the battle.

The good thing about any or all of these tests is that they show us how centered and grounded we are, or aren’t. We have to heed the signals as we go. Tests only make us stronger – ours is to keep drilling down to what’s actually real and then and only then make the true “difference” we long for.

Drop Out, Get Free and Grow Up

This awakening is real, as tired as that word may be getting. People are having massive personal changes in their lives now, shifts in perspective and awareness that in many cases they weren’t even looking for. Or wanting. It’s on. It’s in and all around us, evident in the preponderance of awake internet contributors, budding voices in society, and especially ourselves and those around us going through inexplicable personal changes. Let’s pay attention to this and move with it and let the rest go.

The mutant matrix is bound, and meant to, collapse and shrivel up. Don’t try to fix it or revive it, that’s a trap. The more we get on board with this vibrational shift and make the necessary personal changes the easier the transition will be. We can’t let fear or allow anger in any of their many forms direct our minds and lives. It’s easy to fall for, let’s just let our anger turn to compassion and give our full energy to this shift, beginning with ourselves.

Reactivity is enslavement. Observe and stay conscious and heart led. Guard your space.

The public arena is a play, a very persistent and intricately staged one. Let’s turn off our mental TVs as well as our physical ones. It’s a lure, a bait and switch, never mind the mindless amusements, which means away from thinking. It’s time to focus our lives like a laser to where we truly desire in our hearts. This brings great peace. Call it prayer, meditation, focus, personal commitment through shedding of distractions and shallowness. Whatever works.

But please realize this: the external and everything illusory is deliberately collapsing to help us all in this process. it’s a symbiotic unfolding as it should be. When we truly step back and observe from true inner selves this is clearly manifest.

Operations Here As I See Them

I keep any eye on what’s going on in the outer world, but it doesn’t rule my life and thoughts. My journey and continued awakening does. I prefer learning about inspirational and revelatory deep spiritual teachings most of all, as well as advances in true science, hidden history, archeology, and extra-normal phenomena in context if I feel like learning.

And I like learning. Processing towards a greater understanding in a greater and greater heart felt context is my passion.

The amount of alone and quiet time I spend has increased exponentially. My motto the past two years has been “keep the space”. In other words, guard my personal time and surroundings carefully with plenty of time for silence and nature and learning to be receptive and submissive to the process, because that’s where the real workings are going on. They need space and time to transpire and work through us. That may help others. There are no shortcuts – I feel like I’ve tried them all. Some learn more quickly than others, I’m on the slow boat but I’m thankful to be afloat.

It’s not particularly pleasant in some respects as the old impulses atrophy, but it must be done. We must venture into the unknown as I see it, and let the Universe, the great Creative force, work in our lives, without which we will never be equipped to effectively aid this amazing transition we’re in the midst of. This calling to Source is manifesting in amazing ways, many turning to previously held or newly discovered “faiths” of different persuasions and paradigms. Let it be. All roads eventually lead to Source or whatever you want to call it, as long as our hearts are pure and we don’t fall for limiting beliefs, dogma, hierarchy, interfering entities, or mind-titillating trip offs.

But such is the journey. We each have our own, and create our own realities along the way to deeper discovery.

It appears to me our contribution is first and foremost vibrational and spiritual in many ways. Our personal beingness is our contribution. At the end of life it is only who we have become that matters; not our deeds, reputation or good works. That’s the secret “weapon” that’s not so secret anymore. Who we are. Let’s revel in our newfound personal openness and the subsequent changes that brings on, and move boldly through everything thrown at us and make that connection.

And let’s not try to take all this and ourselves too seriously. We’re missing the fun and excitement of this great play when we do that. Let’s find our eternal centers, hook up, do our parts joyfully, and enjoy the show!

Keep on keeping on. We are the greatest secret! It’s in us.

See you there!

All the best, Zen

 

Zen Gardner is an impactful and controversial author and speaker with a piercing philosophical viewpoint. His writings have been circulated to millions and his personal story has caused no small stir amongst the entrenched alternative pundits. His book You Are the Awakening has met rave reviews and is available on amazon.com. You Are the Awakening examines the dynamics of the awakening to a more conscious awareness of who we are and why we are here – dynamics which are much different from the programmed approach of this world we were born into.



CIA Mind Control Morphed into Psychiatry?

Source:  No More Fake News

by Jon Rappoport
July 11, 2017

 

Here is a new introduction to a piece I wrote several years ago. Then I’ll reprint the piece.

The famous CIA mind-control program, MKULTRA, always used psychiatrists; often these professionals headed up projects; they carried out the bulk of the research. But what I’m talking about here is the “evolution” of MKULTRA into mainstream psychiatry that affects the lives of millions of people every day.

I’ve demonstrated, on a number of occasions, that not one of the 300 so-called official mental disorders has a lab test to back up the diagnosis. No defining lab test. No blood test, no saliva test, no brain scan, no genetic assay. All 300 “disorders” are described and defined by committees of psychiatrists—and their non-scientific decisions are published in the DSM, the Diagnostic and Statistical Manual of Mental Disorders, published by the American Psychiatric Association.

Unfortunately, the treatments for every one of these arbitrary diagnoses are toxic drugs; drugs that addle the brain; drugs that reduce people to a state of abject dependence; drugs that make people think they’re insane; drugs that cause violent behavior; drugs that create life-threatening problems when patients try to withdraw from them quickly; drugs whose effects mimic the very descriptions of mental illness.

In other words, modern psychiatry, backed by drug makers, has an ideal formula for disabling populations.

So it’s more than interesting that the CIA has pursued a mind control program (MKULTRA) to achieve, in certain respects, the same objectives.

—end of introduction—now here is my piece on a forgotten CIA document:

Drugs to transform individuals…and even, by implication, society.

Drug research going far beyond the usual brief descriptions of MKULTRA.

The intention is there, in the record:

A CIA document was included in the transcript of the 1977 US Senate Hearings on MKULTRA, the CIA’s mind-control program.

The document is found in Appendix C, starting on page 166. It’s simply labeled “Draft,” dated 5 May 1955.

It states: “A portion of the Research and Development Program of [CIA’s] TSS/Chemical Division is devoted to the discovery of the following materials and methods:”

What followed was a list of hoped-for drugs and their uses.

First, a bit of background: MKULTRA did not end in 1962, as advertised. It was shifted over to the Agency’s Office of Research and Development.

John Marks is the author of the groundbreaking 1979 book, Search for the Manchurian Candidate, which helped expose MKULTRA. Marks told me a CIA representative informed him that the continuation of MKULTRA, after 1962, was carried out with a greater degree of secrecy, and he, Marks, would never see a scrap of paper about it.

I’m printing below, the list of the 1955 intentions of the CIA regarding their own drug research. The range of those intentions is stunning.

Some of my comments gleaned from studying the list:

The CIA wanted to find substances which would “promote illogical thinking and impulsiveness.” Serious consideration should be given to the idea that psychiatric medications would eventually satisfy that requirement.

The CIA wanted to find chemicals that “would produce the signs and symptoms of recognized diseases in a reversible way.” This suggests many possibilities—among them the use of drugs to fabricate diseases and thereby give the false impression of germ-caused epidemics.

The CIA wanted to find drugs that would “produce amnesia.” Ideal for discrediting whistleblowers, dissidents, certain political candidates, and other investigators. (Scopolamine is such a drug.)

The CIA wanted to discover drugs which would produce “paralysis of the legs, acute anemia, etc.” A way to make people decline in health as if from diseases.

The CIA wanted to develop drugs that would “alter personality structure” and thus induce a person’s dependence on another person. How about dependence in general? For instance, dependence on institutions, governments?

The CIA wanted to discover chemicals that would “lower the ambition and general working efficiency of men.” Sounds like a general description of the devolution of society.

As you read the list yourself, you’ll see more implications/possibilities.

Here, from 1955, are the types of drugs the MKULTRA men at the CIA were looking for. The following statements are direct CIA quotes:

A portion of the Research and Development Program of TSS/Chemical Division is devoted to the discovery of the following materials and methods:

1. Substances which will promote illogical thinking and impulsiveness to the point where the recipient would be discredited in public.

2. Substances which increase the efficiency of mentation and perception.

3. Materials which will prevent or counteract the intoxicating effect of alcohol.

4. Materials which will promote the intoxicating effect of alcohol.

5. Materials which will produce the signs and symptoms of recognized diseases in a reversible way so that they may be used for malingering, etc.

6. Materials which will render the induction of hypnosis easier or otherwise enhance its usefulness.

7. Substances which will enhance the ability of individuals to withstand privation, torture and coercion during interrogation and so-called “brain-washing”.

8. Materials and physical methods which will produce amnesia for events preceding and during their use.

9. Physical methods of producing shock and confusion over extended periods of time and capable of surreptitious use.

10. Substances which produce physical disablement such as paralysis of the legs, acute anemia, etc.

11. Substances which will produce “pure” euphoria with no subsequent let-down.

12. Substances which alter personality structure in such a way that the tendency of the recipient to become dependent upon another person is enhanced.

13. A material which will cause mental confusion of such a type that the individual under its influence will find it difficult to maintain a fabrication under questioning.

14. Substances which will lower the ambition and general working efficiency of men when administered in undetectable amounts.

15. Substances which promote weakness or distortion of the eyesight or hearing faculties, preferably without permanent effects.

16. A knockout pill which can surreptitiously be administered in drinks, food, cigarettes, as an aerosol, etc., which will be safe to use, provide a maximum of amnesia, and be suitable for use by agent types on an ad hoc basis.

17. A material which can be surreptitiously administered by the above routes and which in very small amounts will make it impossible for a man to perform any physical activity whatsoever.

—end of quoted section from the 1955 CIA document—

At the end of this 1955 CIA document, the author [unnamed] makes these remarks: “In practice, it has been possible to use outside cleared contractors for the preliminary phases of this [research] work. However, that part which involves human testing at effective dose levels presents security problems which cannot be handled by the ordinary contactors.”

“The proposed [human testing] facility [deletion] offers a unique opportunity for the secure handling of such clinical testing in addition to the many advantages outlined in the project proposal. The security problems mentioned above are eliminated by the fact that the responsibility for the testing will rest completely upon the physician and the hospital. [one line deleted] will allow [CIA] TSS/CD personnel to supervise the work very closely to make sure that all tests are conducted according to the recognized practices and embody adequate safeguards.”

In other words, this was to be ultra-secret. No outside contractors at universities for the core of the experiments, which by the way could be carried forward for decades.

A secret in-house facility.

Over the years, more facilities could be created.

If you examine the full range of psychiatric drugs developed since 1955, you’ll see that a number of them fit the CIA’s agenda. Speed-type chemicals to addle the brain over the long term, to treat so-called ADHD. Anti-psychotic drugs [Haldol, Risperdal, etc.], AKA “major tranquilizers,” to render patients more and more dependent on others (and government) as they sink into profound disability and incur motor brain damage. And of course, the SSRI antidepressants, like Prozac and Paxil and Zoloft, which produce extreme and debilitating highs and lows—and also push people over the edge into committing violence.

These drugs drag the whole society down into lower and lower levels of consciousness and action.

If that’s the goal of a very powerful and clandestine government agency…it’s succeeding. In mainstream psychiatry.



Parasites on the Loosh – Knowing and Dissolving the Enemy of Mankind

Parasites on the Loosh – Knowing and Dissolving the Enemy of Mankind

by Zen Gardner
May 11, 2016

 

Introduction

The fundamental understanding that we are an energy source for some form of inter-dimensional parasites is becoming more and more predominant. After all, it fits not only ancient and even current religious and spiritual teachings, but every form of social and psychological framework as well. That we’re being used and abused is obvious, but by whom ultimately, and why?

There’s clearly a wickedly contrary current at play working against the instinctive creative and loving force most of us are tapped into and endeavor to manifest in our lives. We have not just opposition, but apparently a seemingly coordinated or similarly “inspired” enemy of mankind continually acting contrary to our best interests.

A simple perusal of the abusive systems at large in the human societal fabric paints a very clear picture.

Whether it’s deliberately dumbing down education and controlled media that only stifle and misdirect, or the engineered highly toxic social, geological, technological and essential resource manipulation we see escalating at an exponential rate, humanity and our planet are under attack and at a serious crossroads.

Loosh Change

Understanding the gnostic/archontic explanation of earth’s situation as propounded by John Lash as well as the Wetiko teachings put forth by Paul Levy, or even the growing body of alien occupation and exploitation research coupled with exposés of the real meanings of ancient religious and archeological discoveries, are profoundly important in order to more fully grasp what is going on here.

In addition, a further understanding regarding the actual energy being harvested, also known as loosh energy, is imperative and complimentary to this and extremely compelling, having its own attributes to help us more fully understand our socio-political, economic as well as psycho-spiritual environment.

Just how these parasitic forces operate and indeed manage us, however we conceptualize them on whatever level, in order to provide the enslaved energetic food source they need to live on, is essential to our empowerment.

It’s not exactly a pleasant subject, but then neither is the human devolution and depopulation agenda for the obvious purpose of the obvious, abject domination, if not destruction, of our species and planet.

The concept of loosh energy was more modernly articulated by Robert Monroe of the Monroe Institute, although the concept as a known reality has been around a long, long time. His articulations are revealing, compelling and ultimately empowering.

Loosh, being life force energy (spiritual energy), is just simply energy, and includes the energy familiar to us as emotional energy both happy and unhappy.

Most notably, as terminology of rare usage, “loosh,” per se, was the word devised by Robert Monroe referring to the emotional energy radiated by animals and humans in dire circumstances that entail intense, severe pain and suffering in body and psyche.

And so, “loosh,” in this older usage, described a negative experiential spectrum.

So Who is Utilizing It, and Why?

That humanity is in a deliberately induced state of suffering is an incontrovertible truth. History attests to the oppressive and cruel reigns of dynasty after empire after micro hierarchy. We seem to resign ourselves to them in the knowledge that we can see them, yet the present day in our faces reality that it’s still going on and we’re even subject to them escapes us. We’re basically designed to not truly “see” them for what they truly are.

The “why” of that is a massive subject, our cowardly, seemingly self serving personal abdication of responsibility and sovereignty, but let’s stick to the overarching reality for starters.

[Spoiler Alert. Knowing these self-evident truths and the personal responsibility directly implied will bring on extreme personal turmoil; that or abject rejection in the form of denial, another learned behavior at the behest of the assumptive, invading controllers designed to defuse action.]

Back to loosh…

This “loosh” was not a discovery of something new.

Rather, it was simply Monroe’s identifying, and hence naming, of a metaphysical, alchemical phenomenon that has always existed (spiritual energy simply is) and – probably since many centuries ago, perhaps even millennia – was developed and exploited as a dark, multidimensional occult art and skill, utilized by secret societies and institutionally for social programming and mind control, and raised to a zenith in our electronic era.

Once there was a Monroe Institute, then related offshoots and derivations of that type of experimentation and research soon became the specialized, highly refined activities and techniques of Area 51 and Montauk for “military” and “defense” objectives (so-called), and the pop-music /entertainment industries and institutional pedophilia as they particularly are today.

As a type of spiritual energy identified by Monroe, capitalized upon by the secret services and black-ops, and exploited as a social engineering utility by the interdimensional Negatives, “loosh” essentially is of the earth planes (lower dimensions) and the trauma energy of the human and animal emotional body (for example, via the cruelty imposed upon and endured by the animal kingdom, and the brutality of the abbatoir).

As negative emotional energy, especially the energy of pain, trauma, stress, abuse, and suffering, or as Georgi very rightly described it, as “dreadful loosh,” it contains the heightened molecular content and organic /hormonal adrenalin-cortisol cascades, coursing through the quantum dynamics of blood, body, and brain systems.

Under such intense extremity of trauma, the blood and flesh is, for the Negative Entities, thus highly ‘enriched’ and hence highly prized, their brand of premium gold caviar diamond steak, as it were.

(There is a passage in the Old Testament where the gods rush in from afar, salivating at the aroma of burning human flesh. The so-called “God” or “Gods” in the O.T. – Old Testament – were/are mostly Negative Entities.)

Not only is this negative loosh highly coveted, but most crucially of all, it is absolutely necessary for probably most Negative Entities, for enabling and facilitating existence in the Earth planes, as well as for the ability to hold the human form so they don’t slide into shapeshifting.

Apparently, because of the vibrational difference in frequency levels, there is a fundamental physiological incompatibility which our negative loosh neutralizes for them, and which even enhances their energetic stamina and function in the Earth and lower dimensions.

Vibration and frequency, in them, in humans, and animal Earthlings, are key to loosh’s entrapment dynamics and emancipation from it.

More “Loosh” Energies and the Muti-faceted Entropic Breakdown Agenda

This is nothing less dramatic than demon possession and vampirism on a massive scale explained, or whatever semi-or-not paradigm you might subscribe to. We have to understand the dynamics of what is being reined upon us in order to fully empower ourselves in every facet of our being.

We’re in an interdimensional as well as an earthly, material conflict and it’s a battle for our survival, consciously as well as physically. Understanding these deeper dynamics is paramount to our welfare.

The concept of entropy lends itself to this, the scientifically identified impact of breaking down and reducing the energy of any given process or body in order to release energy. Burning fossil fuels is a perfect example, breaking down elements in order to harvest their energy.

There are so many examples of this, physically as well as socially… and especially spiritually. Religious institutions and belief systems are designed to do this.

You’ll see that entropic breakdown for energy harvesting phenomena such as nuclear reactions, cyber information and attention harvesting more and more, but understand the destructive process we are witnessing is releasing energy for a much deeper purpose than is being told. In fact, it’s unfathomable to the deliberately controlled mind.

These are the aspects we need to research for ourselves, but when we do, we find common denominators on every side.

Good Loosh, Bad Loosh

Now the good news.

All “loosh” is not bad or necessarily manipulated. We generate amazing amounts of good energy that won’t necessarily be contained or tainted.

But it takes some recognizing on our parts, as well as a centered and truth grounded reference point on our parts:

That’s empowering and should resonate. We clearly have the upper hand, despite their reversal of truth. Something to beware of continually. There’s always an overwhelming energy harvesting design to whatever they devise.

Harvesting Through Fear and Focused Attention

Our focusing on their designed end product is what brings their synthetic construct into reality. False education and especially media propaganda play an important role in all of this, with the ever looming backdrop of immense social engineering. That today’s news is focused almost solely on the acts and programmed words of world puppet leaders and the moves and lives of oligarchs and the parasitic “elite” is evident. As the expression says, energy flows where attention goes.

We’re feeding them with our attention, by design.

In other words, humanity is empowering the entire construct, in addition to energetically feeding this parasitic, spiritual and fully inorganic invading force.

This is vitally important to realize. While billions are glued to their boobtoobs drinking in not just propaganda and mind control, there’s an energetic exchange happening. As quantum physics has proven, we bring into reality what we direct our energy towards. This has profound ramifications on every moment of our lives.

The engineered wars, terror, tension and scarcity memes used for millennia, and heightened today by the aid of artificially intelligent empowered synthetic technology, makes for fertile ground for abuse and negative loosh production.

The Parasitic Loosh Harvest Reality – Child Abuse and Human Sacrifice

Meanwhile, not just by the terrors of war or continued engineered suffering of humanity, oligarchs, secret societies, and just about any organization or individual, human or not, who is integrally involved in this anti-human parasitic, self serving force, will also be an active participant in horrific child abuse and human sacrifice, to degrees unimaginable by true, empathic natural humans.

It’s part of the formula. An essential one. Torture, pain, suffering and death as the ultimate energy release to be harvested are their staples. It’s not aberrant in their minds; it’s survival. They are not of us. A profound differentiation you have got to make if you’re to survive and learn how to fight back and help save our race and planet.

The abuse, ritual sacrifice, and trafficking realities are coming into greater conscious awareness but it’s a long way from really hitting home. When you extrapolate this out to realize the entire control grid is parasitic in the most horrific and obscene ways possible, using us as literal energy sources via not just our work value, but our life force, that’s when the truth starts hitting home.

So How and Why is this Understanding Empowering?

These would-be controllers and seeming ‘hot shots’ we see in the news with their suits, uniforms and even religious or otherwise regalia are fundamentally impotent. They’re not organic nor do they care one bit about anything but themselves and some sort of Borg mind, cancer-like agenda to suck their host dry. If you look honestly at even the exposed public power figures they’re sick psychos in human form. I would venture to say they are not of us and a fully infiltrated, unscrupulous enemy within, and that we are in deep, dire straights if we don’t shake the hypnotic trance and rise up against them.

That includes the secondary psychopaths who’ve bought into the Borg program.

The real truth is, based on anything natural and creative and good, they’re ugly, sickly, shallow and weak, the definition of a blood and life sucking parasite. What needs to be realized, most of all, is that the power of this so-called enemy attempting to oppress us is ultimately of our own complacent making. Their only power is that which we empower them with. Without us they’re nothing.

Therein lies our strength. Not just to our awakening to these greater truths and understandings, but completely disengaging in any form of physical, economic, social or psychic support and letting ourselves be empowered by the realization of their resultant futility. But only if we truly wake up and take appropriate action in our lives, cleaning up our own selves and old programming, facing fears and avoidance issues, and detaching, yes detaching, from our tick like dependence on this false system and take full control of our lives – and then stand up for the truth in everything we do, whatever it takes.

They or their collective “it” are a synthetic virus, lab manufactured if you will. They can only mimic, just as psychopaths mimic normal behavior to get by while they suck anything in their path dry.

Nature itself is not on their side. That’s why they’re attempting to destroy it.

Conclusion

That the power of one candle is enough to enlighten a darkened room is weeny compared to the powers that lay within each of us. But it alludes to the idea. But I say enough over spiritualizing and convenient mental distancing of ourselves from our horrendous situation on this planet. This is way too late and beyond any reparation short of complete and utter pro-active rebellion with an intent to destroy their power. We have been invaded and beyond oppressively controlled, abused and sucked dry long enough. Anything at all was too much, but now we find ourselves so far down the tubes it may seem hopeless.

Screw that attitude. That we’re here, alive and just now discovering out true natures and infinite possibilities only speaks to the fact that this must have been our living, creative universe’s way of challenging us to the max to bring out the best in us. That’s good enough for me. It sure resonates.

Listen to the true human heart speaking. Learn to discern who is who out there and around, and stand in your truth and learn to act decisively. Don’t let them divert your attention or appeal to some soft peddling new age or otherwise compromise about reformation, “love and light”, or pray to some external BS to keep you from exposing and hence destroying their influence.

This parasitic voice works through the ego. As Don Juan called it, they gave us their mind, the predator mind. It’s that false self, out to protect itself, and hence this whole overriding system of abuse and compliance with it. If we’re not going militant in our resolution and understanding we will be consumed and the planet devoid of truly human life. What’s left will be a replica, virtual sadomasochist robots who love their slavery. Those who survive that is.

Do you want your progeny to live like that?

Because that’s what we’re heading for at such an incredible speed and with such momentum it’s causing even good hearts to faint.

Not me, and I hope not you. Get some damn courage and get to work. You’re gonna lose it all and all your loved ones and beloved home planet anyway if we don’t wake up and rise to this occasion.

Epilogue – The Empowerment of Greater Truth Coupled with Conscious Action

The fact that we can now specifically identify our oppressors and their techniques is incredibly empowering. While they appear to and in many ways do have the upper hand, it’s fundamentally extremely flimsy and illusory – a construct meant to displace our humanity and sense of conscious connection.

But it’s only if we agree to it and support it.

It will take a form of spiritual violence to take a stand. This is what’s being called for, and whatever else may follow. I hope you’re up to it. I sure am. This is what I came here for. And I’ve done the work to prepare for it.

Know your true identity as an amazing individual yet part of a vast continuum of the ultimate Source. Their fear based intimidation wilts in our gaze of knowing truth. Be strong. Informed, empowered and encouraged. And ACT accordingly, whatever the consequences. Everything will be thrown at you. That’s the nature of being a warrior in battle.

We already have every possible element needed to refute and dissipate this imposed, parasitic control system.

Live freely – and carry on the process. We’re not just observers, but doers of the very real truth we’ve come to understand. Act and be bravely! There’s nothing to fear in all truth and reality. It’s a charade only made real by letting their false reality in, like choosing to let a nightmare go through your waking day. Why do that?  Shake it and simply be who you truly are and act accordingly and be willing to go where it takes you, fears and all.

Their only power is in illusion, as real as the mass hypnosis and resultant subservience and empowerment makes it appear. It doesn’t matter how weird or strange these manifesting influences may seem to be or how many are bowing down to them. Stand on your authentic own.

Find it first of all, that’s the real journey, and then stand like a tree against the storm – and then move forward.

See you on the frontline. We were born for this.

Love, Zen

 

Zen Gardner is an impactful and controversial author and speaker with a piercing philosophical viewpoint. His writings have been circulated to millions and his personal story has caused no small stir amongst the entrenched alternative pundits. His book You Are the Awakening has met rave reviews and is available on amazon.com. You Are the Awakening examines the dynamics of the awakening to a more conscious awareness of who we are and why we are here – dynamics which are much different from the programmed approach of this world we were born into.



Fluorides, the Atomic Bomb, and Fake News

by Jon Rappoport
March 15, 2017 

Occasionally, I reprint this article. I wrote it some years ago, during research on toxic chemicals pervading the landscape. I used to send the piece to mainstream reporters, but I eventually gave that up as a bad bet.

They’re dedicated to fake news…and now they’re losing control over public consciousness. Losing badly. Independent media are in the ascendance, and rightly so.

In 1997, Joel Griffiths and Chris Bryson, two respected mainstream journalists, peered into an abyss. They found a story about fluorides that was so chilling it had to be told.

The Christian Science Monitor, who had assigned the story, never published it.

Their ensuing article, “Fluoride, Teeth, and the Atomic Bomb,” has been posted on websites, sometimes with distortions, deletions, or additions. I spoke with Griffiths, and he told me to be careful I was reading a correct copy of his piece. (You can find it—“Fluoride, Teeth, and the Atomic Bomb,” at fluoridealert.org.)

Griffiths also told me that researchers who study the effects of fluorides by homing in on communities with fluoridated drinking water, versus communities with unfluoridated water, miss a major point: studying the water is not enough; toxic fluorides are everywhere—they are used throughout the pharmaceutical industry in the manufacture of drugs, and also in many other industries (e.g., aluminum, pesticide).

I want to go over some of the major points of the Griffiths-Bryson article.

Griffiths discovered hundreds of documents from the World War 2 era. These included papers from the Manhattan Project, launched to build the first A-bomb.

Griffiths/Bryson write: “Fluoride was the key chemical in atomic bomb production…millions of tons…were essential for the manufacture of bomb-grade uranium and plutonium for nuclear weapons throughout the Cold War.”

The documents reveal that fluoride was the most significant health hazard in the US A-bomb program, for workers and for communities around the manufacturing facilities.

Griffiths/Bryson: “Much of the original proof that fluoride is safe for humans in low doses was generated by A-bomb program scientists, who had been secretly ordered to provide ‘evidence useful in litigation’ [against persons who had been poisoned by fluoride and would sue for damages]… The first lawsuits against the US A-bomb program were not over radiation, but over fluoride damage, the [government] documents show.”

A-bomb scientists were told they had to do studies which would conclude that fluorides were safe.

The most wide-reaching study done was carried out in Newburgh, New York, between 1945 and 1956. This was a secret op called “Program F.” The researchers obtained blood and tissue samples from people who lived in Newburgh, through the good offices of the NY State Health Department.

Griffiths/Bryson found the original and secret version of this study. Comparing it to a different sanitized version, the reporters saw that evidence of adverse effects from fluorides had been suppressed by the US Atomic Energy Commission.

Other studies during the same period were conducted at the University of Rochester. Unwitting hospital patients were given fluorides to test out the results.

Flash forward. Enter Dr. Phyllis Mullenix, the head of toxicology at Forsyth Dental Center in Boston. In the 1990s, Mullenix did a series of animal studies which showed that, as Griffiths/Bryson write: “…fluoride was a powerful central nervous system (CNS) toxin…”

Mullenix applied for further grant monies from the National Institutes of Health. She was turned down. She was also told that fluorides do not have an effect on the CNS.

But Griffiths/Bryson uncovered a 1944 Manhattan Project memo which states: “Clinical evidence suggests that uranium hexafluoride may have a rather marked central nervous system effect…it seems most likely that the F [fluoride] component rather than the [uranium] is the causative factor.”

The 1944 memo was sent to the head of the Manhattan Project Medical Section, Colonel Stafford Warren. Warren was asked to give his okay to do animal studies on fluorides’ effects on the CNS. He immediately did give his approval.

But records of the results of this approved project are missing. Most likely classified.

Who was the man who made that 1944 proposal for a rush-program to study the CNS effects of fluorides? Dr. Harold Hodge, who worked at the Manhattan Project.

Who was brought in to advise Mullenix 50 years later at the Forsyth Dental Center in Boston, as she studied the CNS effects of fluorides? Dr. Harold Hodge.

Who never told Mullenix of his work on fluoride toxicity for the Manhattan Project? Dr. Harold Hodge.

Was Hodge brought in to look over Mullenix’s shoulder and report on her discoveries? It turns out that Hodge, back in the 1940s, had made suggestions to do effective PR promoting fluoride as a dental treatment. So his presence by Mullenix’s side, all those years later, was quite possibly as an agent assigned to keep track of her efforts.

Getting the idea here? Build an A-bomb. Forget the toxic fluoride consequences. Bury the fluoride studies. Twist the studies.

More on Hodge. In 1944, “a severe pollution incident” occurred in New Jersey, near the DuPont plant in Deepwater where the company was trying to build the first A-bomb. A fluoride incident. Farmers’ peach and tomato crops were destroyed. Horses and cows became crippled. Some cows had to graze on their bellies. Tomato crops (normally sold to the Campbell Company for soups) were contaminated with fluorides.

The people of the Manhattan Project were terrified of lawsuits and ensuing revelations about the toxic nature of their work. A heads-up memo was written on the subject. Its author? Harold Hodge. Among other issues, he reported on the huge fluoride content in vegetables growing in the polluted area.

Also the high fluoride levels in human blood.

The farmers began to bring lawsuits. Big PR problem.

The lawsuits were settled quietly, for pittances.

Harold Hodge wrote another memo. Get this quote: “Would there be any use in making attempts to counteract the local fear of fluoride on the part of residents [near the A-bomb facility]…through lectures on F [fluoride] toxicology and perhaps the usefulness of F in tooth health?”

Griffiths/Bryson write: “Such lectures were indeed given, not only to New Jersey citizens but to the rest of the nation throughout the Cold War.”

This was a launching pad for fluorides as “successful dental treatments.”

Now you know why promoting toxic fluorides as a dental treatment was so important to government officials.

Footnote: In Stanley Kubrick’s 1964 film, Dr. Strangelove, Brigadier General Jack D. Ripper rails about the destruction fluorides are wreaking on the “pure blood of pure Americans.” Of course, General Ripper is fleshed out as a crazy right-wing fanatic. He’s ready and willing to start a nuclear war. How odd. Apparently unknown to the Strangelove script writers, fluorides were, in fact, very toxic and were an integral part of the program that created atomic bombs in the first place.



The Psycho-Schism Is Here

The Psycho-Schism Is Here

by Zen Gardner
April 23, 2013

 

Crazy times for sure at Psychotic High. And as predicted, the shift we’re undergoing is impacting vast swathes of society as people either recognize the awakening or are completely ignorant of what’s going on, willingly or unwillingly, and are succumbing to the induced confusion.

All on cue.

The blinding Boston Bullshit Massacre is just another in a long sequence of stimuli in the planned psycho-spiritual assault on Americans, cramming ever more freakish fear into their already overloaded heart, mind and spirit components.

Marie Antoinette would have been brainwashed instead of decapitated in this day and age. Much easier.

Here’s an appropriate post that begins to tell part of the tale of the drastic literally psychotic effects we’re witnessing:

Terrorism. Chaos. Fear of the future. In the age of Obama, America is undergoing a “fundamental transformation” – that much everyone knows.

But what few seem to realize about this transformation is that the sheer stress of living in today’s America is driving tens of millions to the point of illness, depression and self-destruction. Consider the following trends:

  • Suicide has surpassed car crashes as the leading cause of injury death for Americans. Even more disturbing, in the world’s greatest military, more U.S. soldiers died last year by suicide than in combat;
  • Incredibly, 11 percent of all Americans aged 12 and older are currently taking SSRI antidepressants – those highly controversial, mood-altering psychiatric drugs with the FDA’s “suicidality” warning label and alarming correlation with school shooters. Women are especially prone to depression, with a stunning 23 percent of all American women in their 40s and 50s – almost one in four – now taking antidepressants, according to a major study by the CDC;

By the way, things are no better over the pond – and may be worse, according to one major study that concluded almost 40 percent of Europeans are plagued by mental illness. (More here)

It Goes To Show

We’re living in strategically and psychologically compressed and driven times. Hardly anything major in the socio-political realm happens by coincidence or natural means. It’s almost always staged and by very professional executors. Any reasonable open minded study of history will reveal the same conclusion as to how their particular paradigm was sculpted via similar staged events and conditions during virtually any epoch of human history.

Same story, different time.

The recent frenzy over Boston’s own Baked Bullshit Barrage is a manifestation of a mounting, desperate effort to cauterize the American mind once and for all. They want the masses to accept any and every state explanation for anything, great or small, according to their interpretation. These are tests.

And they’re getting away with them.

It’s nasty to the bone, yet so few see it. A very sad state of affairs indeed…when so few challenge the status quo and start to wake up, so little and so late.

Find out the Truth for yourself. Challenge the mainstream disinfo, and reach for the light. Then spread the word.

It’s all there in plain sight.

YOU are the difference! We all are.

Keep on consciously and lovingly being awake, aware and active,

Love always, Zen

 

Zen Gardner is an impactful and controversial author and speaker with a piercing philosophical viewpoint. His writings have been circulated to millions and his personal story has caused no small stir amongst the entrenched alternative pundits. His book You Are the Awakening has met rave reviews and is available on amazon.com. You Are the Awakening examines the dynamics of the awakening to a more conscious awareness of who we are and why we are here – dynamics which are much different from the programmed approach of this world we were born into.



Social Engineering in the West; the Shutting Down of Human Consciousness

Social Engineering in the West; the Shutting Down of Human Consciousness

by Willem Felderhof
December 15, 2016

 

“The conscious and intelligent manipulation of human behaviors, thoughts and opinions is the primary element in society. Those who hold the knowledge and manipulate these unseen mechanisms in society constitute the invisible government and are the true rulers of humanity. We are governed, our minds are molded, our tastes are formed, and our ideas are suggested, by men we never heard of”.

The above quote was made by Edward Bernays in 1928. He was referring to then already highly effective forms of mind control programs that humanity was subjected to in the manipulated 3 dimensional control matrix as we still know it. Close to a century later and with the help of numerous think tanks and institutes that serve the ruling elites like the Tavistock institute, mind control techniques have been refined to unimaginable levels, where humanity is on the brink of becoming fully robotized and ready to serve in the new world order, without even knowing it. Anyone who claims not being under the influence of social engineering/Mind control or is not aware of it at all, is clearly lost and does not have a clue what is going on in their manipulated minds and therefore they do not understand what is going on around them as well.

Following quote by überpsychopath Zbigniew Brzezinski:

“The technotronic era involves the gradual appearance of a more controlled society. Such a society would be dominated by an elite, unrestrained by traditional values. Soon it will be possible to assert almost continuous surveillance over every citizen and maintain up-to-date complete files containing even the most personal information about the citizen. These files will be subject to instantaneous retrieval by the authorities”.

Now bear in mind that this statement was made almost 50 years ago and think about the endless technological possibilities the psychopathic social engineers have access to today. Fact is that most of humanity embraces his/her enslavement and illusionary state of freedom, not only due to ignorance but also because it helps avoiding any responsibility and/or precious time consuming Self-work. We just do not want to know the unpleasant Truth that our minds are owned and controlled by Satanic dark occultists. The result of lifelong (trauma based) refined mindcontrol programming is a shut down of consciousness on a massive scale. As a result of that we see the rise of an engineered obedient slave with a total lack of any impulses of authenticity and free will, that operates from the vibration of fear.

Eugenics

One of the main game tools of the occult social engineers is Eugenics. Eugenics is an ancient satanic social ideology advocating higher rates of sexual reproduction for people with traits and characteristics desired by its proponents and, reduced rates of reproduction and sterilization for those with undesired traits and characteristics. This satanic practice is a primary religious tenet of the psychopathic rulers, who believe that it is simply “natural order” for the most ruthless of humans whose genes are the fittest to rule over the rest of the human herd. They truly see themselves as the chosen ones, as gods, because they are genetically superior over those they rule over. From that deceased psyche emanates the twisted belief that they can decide who is allowed to live and who must die. And this morbid form of human harvesting happens in plain sight for those who are willing to see the Truth.

Garbage in, garbage out

The occult ruling class discovered long, very long, ago how to influence the breeding process within entire populations for the purpose to make these populations easier to control. The controlling of human breeding is done by manipulation of the human consciousness. In other words; population control through mind control.

They are also creating humans with horrible traits and characteristics through the manipulation of human biology, biochemistry, and consciousness via chemicals in our food/water and air. Exposure to insane levels of unnatural electro magnetic fields are interfering with, and changing human physiology for the worse. It is literally a form of “down” breeding since the tactics are clearly used to weaken and destroy the targeted population i.s.o. improving them. Of course this is part of the depopulation agenda as well.

A blatant indication of a deeply mind controlled human being, that is in a solid state of denial, is someone who claims that this is all just the result of normal evolution. Where eugenics is one of the pillars of Satanism, ego worship and self preservation is another one. Most people do not want to hear the ugly Truth that we are ruled by occultist with a Satanic mindset. Let alone consider the idea that the hijacked human consciousness is being morphed into a pseudo satanic, false self obsessed clone of its rulers through social engineering. But all you have to do is look around you to get a confirmation of this unpleasant Truth.

The end product of this programming is a self obsessed human being that is totally disconnected from reality, and full time occupied with (false) self serving activities. That product is lost in non relevant behavior and thoughts and is entirely establishment serving and non establishment threatening. The perfect obedient slave. Because this “product’ is fully ego identified and self obsessed, it is unaware of its connection to the collective reality;  it is operating by a consciousness that is in a shut down modus. On a deeper level this engineered contracted type of consciousness operates from the vibration of fear, self loathing and ignorance. And because of that it will feed (while being unaware of it) the ongoing manifestation of more chaos, control, and suffering in the “external” collectively manifested reality.

The current manifested reality that we as a collective experience, is the aggregate of the consciousness of the individuals. So in order to change the current external reality, large numbers of people have to change their inner reality by (re) gaining the sacred knowledge of human consciousness and how it operates and manifests in accordance with Natural Law. Understanding the concept of non separation from the external reality, is an indication of knowledge of a True Self that operates from non duality.

War on the True Self

Through the relentless eugenics and trauma based mind control programs we see the clear emerging of a false self/ego identified, socially engineered woman and man that operate from the vibration of fear and that is stripped from “it’s” genuine masculine and feminine modalities. The desired by products of this engineered madness are: further destruction of the sacred masculine and feminine dynamics; break down of traditional family bonds and the break down of the sacred emotional, spiritual and sexual bond between man and woman. (if you google sacred bond man and woman you will see mostly pop ups from Hillary Clinton)

The engineered woman is being culturally conditioned to no longer be attracted to any of the qualities of the genuine man. Such genuine qualities include high holistic intelligence, real/natural confidence emanating from healthy self-esteem, being very vocally opinionated, independence, a rebellious attitude towards authority and placing very high values on individual freedom. Such traits are, of course, seen as highly dangerous to the goals of the rulers, who wish to see society produce weak men, since weak emasculated men are very unlikely to resist the State, while the genuine man will rebel against it.

The socially engineered woman wants to be placated, revered and pampered through relentless princess programming at early age where they are programmed to: value only what can be gained for themselves through relationships with men, to seek only a man who can “provide for them”. To place obsessive importance on their looks to “lure” a male, to devalue the importance of their own intelligence, to seek money as main value system and to think that “no man is good enough” for them. This false self identified woman is motivated by the psychological desire for attachment and security. “Love” is seen primarily as a form of co-dependent permanence and attachment and a search for an illusionary form of security, rather than a deep autonomic healthy familial bond with another human being. Hence the irrelevant first and foremost question when a woman and a man meet for the first time: “What do you do for a living”?

This search for security in a man with money and/or good looks or the desire to be taken care of by someone else is an integral part of the ego-gratification. And self preservation is the primary pillar of a Satanic mindset. An inconvenient Truth that most will refuse to understand and/or admit. Most people prefer to attribute this to Darwinian logics when in fact this behavior is deeply ingrained social conditioning. The early princess programming, the trauma based outcome based education system, and the (neo) feminist agenda’s have engineered the conditioned woman to love the State and her false self.

The State continually, through mass mind control, positions itself to be psychologically accepted as the provider, protector and husband. Especially the communist, marxist outcome based education slaughterhouse is a primary source of the engineered co dependence towards the State by both genders, partly through the insane prolonged compulsory separation from the parents.

Any parent who still continues to offer their children to these mind destruction factories without any significant resistance, is willfully facilitating the destruction of the authentic true Self of his/her child. The high sensitive, creative, and intelligent potential rebels against the increasing forms of tyranny are having severe problems to adapt to this profound sick system. This highly precious generation for humanity  is being “neutralized” by labeling their entirely normal response to the State run compulsory torture system with ADHD/ADD or other ridiculous “diagnoses”. Engineered computer/gaming addiction and disgusting medication regimes will zombify them further. Ignorant parents and pseudo psychologists, acting as agents for the system, are enforcing the identification of the child with their so-called problem, thereby pushing the child further into an engineered structural state of psychological stress and self loathing.

Marriage with the State

Fake, codependent, and false-self “love”programming through Hollywood love story movies, television series, books, music etc, drive the conditioned engineered man and woman into an obsessive search for the perfect relation and/or marriage. Marriage brings an even deeper personal relationship into union with the state- which has been traditionally used and steered to the benefit of the female, in the case of divorce. Up to 45 % of marriage end in divorce and divorce courts rule drastically in favor of women, feeding the division between man and woman and feeding the female’s craving towards the State. Money and the maintenance of lifestyle is valued above emotions, feelings and moral issues in relationships. This engineered system is structured in such a way that it breaks down both genders, the family tradition, and has a highly destructive impact on future generations as well.

Breeding out the rebel

The war on the genuine authentic men takes form of the emasculation of the human male, a process which breeds out the Sacred masculine dynamic (the willingness to stand up against any form of tyranny or bullies). The long-term agenda is to create a feminized man that will not ever challenge the state and to simultaneously condition women to view the state as a powerful husband/father figure. Rebellion against the state, a reverence for true freedom, and placing high value on personal responsibility and individual rights, are traits that are bred out of humanity through refined eugenics because such traits are undesirable to the ruling class. Socially engineered traits are being bred into the new “man” and include: a fear and disinterest of going against the norm, docility, submissiveness and obedience to authority. Mind control based eugenics are designed to breed compliant slaves and to eliminate raw rebels, independent thinkers, and spiritually aware human beings.

One of the most fundamental aspects of these programs is to influence the vast majority of women to be attracted only to fake men who are the most fitting to perpetuate the system of human slavery in a one world government system. This engineered self obsessed man displays pseudo and feminized masculine characteristics. Although presented as a real man he will most likely be dead-on-day-one in a real survival scenario as he is completely unaware of world issues and of his own enslavement.

Idolized self obsessed sport heroes and “musicians” serve as effective programming tools for pseudo rebellion. If you google the word rebel today, you will see that nothing will pop up that comes near a real rebel. True rebellion against the state and healthy patriotism are being bred out human consciousness and the new socially engineered generations have no intention to search for it anymore, as it is an unknown concept for the disconnected and self centered obedient new world order slaves.

The rise of the engineered millennial human being.

Millennial human beings are the children of the post baby boomer generation and were largely “raised” by the state-run trauma based mind control education factories, television/computer, and pop culture. They have been conditioned by these systems to behave in ways that are complacent, compliant, unquestioning, unthinking, and narcissistic.

They absorb huge amounts of television programming and/or computer gaming, consume poisonous genetically modified foods, are obsessed with escapist pursuits, conduct only vapid, inane conversations, and express an extreme lack of concern or interest in real world issues.

If they are confronted with someone who questions authority or addresses immoral behavior they will react either with apathy, aggressively, or will collectively ridicule the person that is expressing the normal moral behavior. This form of engineered policing of each other emanates from the fear of being expelled from the group. This fear based mind controlled form of self policing is the result of deep self loathing. The fear of being different is partly engineered through the compulsory education system that enforces traumatic abandonment issues by creating further separation from the parents, and through television programming and other media tools.

The millennial human beings are the absolute dream of the social engineers.

Androgenization

Another tactic in the gender war is the deliberate androgenization of society, which slowly homogenizes and gradually erodes the distinctiveness of both genders. When genders and gender roles become skewed and blended, strong men and women sharing cohesive familial bonds become an endangered species.

As a result of the breakdown of the sacred bond between man and woman, society becomes further weakened at a fundamental level and thus easier to control. Besides that it serves the depopulation agenda as well, just like the other tactics in the gender war. And again, anyone who attributes these engineered phenomena as natural and a result of normal evolution is clearly operating from an “owned” mind. People call me a homophobic when speaking out about androgenization being hyped in the media as a tool for social engineering. This is exactly the goal of the social engineers; we should all accept these abnormal tendencies in society as normal;  there is really no such thing as objective standards for right and wrong. Police each other with moral relativism; there is no Universal wrong or right.

Real external change comes ONLY from real change within

While the epitome of narcissistic paranoid psychopathy, embodied by Donald Trump, has been given the power over the controls of the most deadly and advanced nuclear war machinery the world has ever seen, the consensus in the majority of humanity is that we have to wait and see where it will go. Even under the so-called awake people are (or were) large numbers of people who consider the possibility that this time there might be a real chance for external “change”. That apathetic and co-dependent reaction not only reflects a total lack of knowledge of the structures and dynamics of power in society, and the distractive role of the pathetic political arena’s in general. It is also a disturbing indicator of the lack of rulership over, and knowledge of our individual consciousness.

Would it really be possible that the presidency of Trump was unexpected, totally unforeseen and unaccounted for by the genius occultist ruling class who OWN the whole stage for centuries, and are masters of deception for centuries? Most probably not, maybe for a tiny part, I would not bet on it anyway. But the most, if not the only, relevant question here is WHY all this is happening. As stated before we have to understand by experience that this system of chaos, control, fear, and human suffering is manifesting as a direct result of the dynamics of our own individual consciousness.

Real transformation requires TOTAL commitment

The current collectively shared reality, and the ever increasing levels of control that come with it, is the manifest of the aggregate of our individual consciousness. Individual consciousness today is mostly operated by a false ego identified self, driven by fear and ignorance. Engineered fear and ignorance by the occult rulers who have kept the knowledge of human consciousness hidden (Occult) to humanity in order to be able to manipulate and control it. In this unique time of information we have a chance to regain that knowledge and create another external reality which is emanating from a consciousness that is operated by the True Self, driven by Love and true knowledge in accordance with Natural law.

Only with total commitment, deep Self work, time and energy, humanity can turn the tide. We need to radically change the way we think, the way we feel, and above all, the way we behave. True external change comes from within, not the other way around. Instead of focussing on, and trying to change the external, we should change our reality within.

That process requires the willingness for a deep psychological and physical surgery without anaesthesia that includes a slow but certain death.

Death of the engineered false self that operates from fear, and a breakdown of all attachments to the belief systems that caused the identification with it. Only then we can facilitate the rebirth of the genuine True Self that will be able to manifest a different external reality. An emerging external reality that represents anarchy because it is manifested from the vibration of Love and not from fear. Anarchy is the expression of True Freedom. The real fear for anarchy is the fear for True Freedom; the unknown. The social engineers worst nightmare.

Important note: this article is written in generalized terms for convenience, but I am referring to the majority of a gender group or certain engineered group tendencies in society in general. Of course we see also authentic human beings operating from their True Self, but they are very rare in their presence.

To understand more about the war on human consciousness, eugenics, mind control and Natural Law, watch these seminars by Mark Passio. In the first controversial presentation, Mark Passio blows wide open the Dark Occult agenda of Neo-Feminism, which is being used to sow the seeds of discord between men and women in order to weaken the human species and ensure that future generations of humanity lack the traits necessary to resist tyranny. The destruction of gender roles and the familial dynamic are explored as major themes throughout Mark’s hard-hitting lecture.:



On October 19th, 2013 Mark Passio presented his seminar “Natural Law: The REAL Law of Attraction” at the Yale Omni, organized by Arthur Capozzi & Christopher Capozzi, and produced for distribution by Tragedy and Hope dot com. This is the morning session, which will be followed in this playlist by the remaining 2 segments. Take the time to watch, study, and enjoy it.


Check out for more on human consciousness, social engineering and mind control on:

http://www.whatonearthishappening.com/

http://www.michaeltsarion.com/

 

Willem Felderhof is a former commercial airline pilot and was a whistleblower on the presence of toxic elements in aviation generally known as “the Aerotoxic syndrome”.



How to Fake an Alien Invasion

How to Fake an Alien Invasion

by James Corbett, The Corbett Report
February 8, 2015

 

We all know about the crude pie-plate-on-string UFO hoaxes that have been perpetrated in the past. But what if I were to tell you the greatest UFO hoax of all time is being prepared right now, and it has Rockefeller backing and UN/Vatican/presidential support? Join us this week as we peek under the bluebeam curtain at the great alien invasion false flag. – James Corbett

Watch on BitChute / Minds / Odysee / YouTube or Download the mp4

Transcript and Sources:

James Corbett: Welcome back to The Corbett Report ladies and gentlemen, I’m your host James Corbett of corbettreport.com podcasting to you as always from the sunny climes of western Japan, here on this 5th day of February 2015.

Welcome to Episode 301 of the Corbett Report – How to Fake an Alien Invasion.

Now you better be careful who’s watching over your shoulder today because we’re about to broach one of the most top secret, ultra-classified pieces of information in the entire conspiracy pantheon. A subject so sensitive that it’s mere exposure threatens to topple the power-pyramid itself and, as a result, is never talked about in the establishment mouthpiece media. I’m referring of course to the topic of…[whispers] aliens.

“Just what was in the skies over Jerusalem and why did it stop over one of the most treasured sites in Christianity?”

(Source: Female Anchor Scared Of UFO Sighting Over Jerusalem’s Dome Of The Rock – Time Reference: 01:29)

“We bring you this special radio television broadcast in order to give you the very latest information on an amazing phenomenon, the arrival of a spaceship in Washington. The army has taken every precaution to meet any emergency which may develop. Just a minute ladies and gentlemen, I think something is happening…”

(Source: Day the Earth Stood Still Trailer | Time Reference: 01:39)

“What’s hovering over Salt Lake City? Is it a a rocket? A blimp? A UFO?”

(Source: A Giant UFO Over Salt Lake City | Time Reference: 02:06)

PRESENTER: “Former government UFO expert is warning that Britain is wide open to alien visitors and that the consequences of not monitoring extraterrestrials could be huge. Nick Pope, who resigned from the Ministry of Defense UFO Project, says the department looking into UFOs has all but closed down and despite a higher number of credible sightings. Lets speak to Nick Pope, he joins us in the studio…”

(Source: BBC Warns of Alien Invasion | Time Reference: 02:11)

PRESENTER: “…you want to meet this guy. Joining us now are team leader James Fox: one of the nation’s top UFO experts and Erin Ryder who is in charge of tech and recon for this series, good morning to both of you”
This is a ufologist? Is that what the actual…?
So they say” “OK” [laughter]”

(Source: CBS: UFO’s Mounting Preponderance of Evidence & Government Cover Up! | Time Reference: 02:36)

“AWA 517 do you want to report a UFO? over
Negative we don’t want a report.
Aries31 do you wish to report a UFO? over
Negative we don’t want one of those either.
Aries31 do you wish to file a report of any kind? over
I wouldn’t know what kind of report to file, centre
Aries31..me neither. I’ll try to track traffic at destination. over.”

(Source: Close Encounters of the Third Kind – Indianapolis Air Traffic Control detects the UFO’s | Time Reference: 02:49)

“While the family knows their story sounds of this world, they are convinced they witnessed a close encounter and will be keeping a watchful eye on the sky.

I think we’re definitely believers now.”

(Source: UFO near San Diego – El Cajon, California – CBS News | Time Reference: 03:20)

Sorry my mistake, my mistake, no – this is clearly a subject that is propounded time and again ad nauseam in the establishment mouthpiece media . That same media that we know is lying to us about most major world events, either through direct lying or lying by omission. So why are they not omitting this little idea from the cultural context? Why are they constantly returning to the idea of ‘alien presence’, ‘alien cover-up’, ‘alien invasion’, ‘alien threat’?

Why is this propounded so often, not just in the news media but of course also in those cultural-entertainment productions that I hope we understand are, at the end, a product of the culture-creation industry that has been predictably programming us, again for decades, generations perhaps, to accept various memes and ideas including of course this idea of ‘alien invasion’, ‘alien threat’ and the fallout and consequences thereof, which again is a theme that has been returned to time, and time, and time, and time, and time again for the better part of the century by this point. It’s almost as if the billionaire power players at the top of this pyramid are actually connected to an idea to implant this idea of alien invasion in the public consciousness for the purpose of manipulating public opinion, and that’s because… they are connected to such an agenda, demonstrably so.

“Ladies and gentlemen, here is the latest bulletin from the Intercontinental Radio News. Toronto, Canada: Professor Morse of McGill University reports observing a total of three explosions on the planet Mars, between the hours of 7:45 PM and 9:20 PM, eastern standard time. This confirms earlier reports received from American observatories. Now, nearer home, comes a special bulletin from Trenton, New Jersey. It is reported that at 8:50 PM a huge, flaming object, believed to be a meteorite, fell on a farm in the neighborhood of Grovers Mill, New Jersey, twenty-two miles from Trenton. The flash in the sky was visible within a radius of several hundred miles and the noise of the impact was heard as far north as Elizabeth.”

(Source: “War of the Worlds” 1938 Radio Broadcast | Time Reference: 05:04)

NARRATOR: “Orson Welles’ War of the Worlds.Never before had a radio broadcast provoked such outrage, or such chaos. Upwards of a million people convinced, if only briefly, that the United States was being laid waste by alien invaders, and a nation left to wonder how they possibly could’ve been so gullible.

By a quarter past eight eastern time, telephones were ringing madly all across the country, as concerned Americans tried to determine the whereabouts of relatives, warn friends and acquaintances, and most of all, corroborate what they were hearing.

Man on the phone (archival): City Desk. A what?? Wait a minute.

NARRATOR: For the next several hours, newspapers, radio stations and police precincts from coast to coast would be swamped with calls.

Man on the phone (archival): Well I can’t help that ma’am, we just don’t know anything about it. Did I say something about a quiet Sunday evening?
Second man (archival): What’s going on anyway?

NARRATOR: Soon, strange bulletins began coming in over the press service wires. In Bergenfield, New Jersey, just north of Grovers Mill, some 20 families turned up at a police station, with all of their household possessions piled into their cars. In Indianapolis, a woman rushed the pulpit in a Methodist church, shouting that the end of the world had come. And in Washington state, a spectacularly ill-timed power failure plunged the small town of Concrete into darkness , and sent terrified residents fleeing into the mountains.

Announcer, The War of the Worlds (archival audio): The battle which took place tonight at Grover Mills has ended in one of the most startling defeats ever suffered by an army in modern times; 7,000 men armed with rifles and machine guns pitted against a single fighting machine of the invaders from Mars. One hundred and twenty known survivors…

Seymour Charles Hayden, Sunland, California (actor): Well, my wife she came in, my wife, just wringing her hands and wailing away, her eyeballs about to pop out on to her lap going, “What is it? What is it? What could it be? Is it the Germans?” Well, she hadn’t heard that word ‘Martians’, but I had.

Announcer, The War of the Worlds (archival audio):…a brief statement informing us that the charred body of Carl Phillips has been identified in a Trenton hospital.
David Roepik, Journalist: We think that we’re really smart, but if there’s a cue out there that could possibly be dangerous, we’re going to react to it protectively, autonomically, instinctively, fear first, and reason and fact second”

(Source: War of the Worlds: The Panic Broadcast | PBS America | Time Reference: 05:47)

Now I’m sure that the majority of the listening and viewing audience will be familiar with the story of Orson Welles’ infamous 1938 radio dramatization of the famous H.G. Wells novel The War of the Worlds, and the resulting hysteria and panic that ensued, driving people insane, believing there to be a real alien invasion taking place and farmers running out into the fields shooting at grain silos and the like, and that story is a fascinating one for a number of reasons, namely because it is a confluence of different events in world history at that time, that had an effect on shaping an entire field of study, and of course this relates to the advent of mass-communication technologies like the radio which was still, to some extent, in its infancy as a broadcast medium at that time, capable of reaching a nation as wide and diverse as America and reaching however many millions of people at the same time and inducing this kind of mass panic and psychosis, and it is interesting to study in that regard and so it is not surprising that it was immediately made the subject of such a study funded by, who else, the Rockefellers. And we can take more on this from a very very important article that was published on globalresearch.ca back in 2012 – Early Psychological Warfare Research and the Rockefeller Foundation by Professor James Tracy. Reading from that article:

“The “founding fathers” of mass communication research could not have established their field without Rockefeller largesse. Alongside World War One propagandist and University of Chicago political scientist Harold Lasswell, psychologist Hadley Cantril was a principal contributor to the knowledge and information that helped propel Rockefeller-controlled enterprises, an American empire in the postwar era. Throughout this period Cantril provided the Rockefeller combine with important information and new techniques in public opinion measurement and management in Europe, Latin American, and the United States. A roommate of Nelson Rockefeller’s at Dartmouth College in the late 1920s, Cantril took a doctorate in psychology at Harvard, coauthoring The Psychology of Radio with his doctoral mentor Gordon Allport in 1935. “Radio is an altogether novel medium of communication,” Cantril and Allport observed, “pre-eminent as a means of social control and epochal in its influence upon the mental horizons of men.

The work garnered the attention of Rockefeller Foundation Humanities Division officer John Marshall, commissioned by the Foundation with convincing commercial broadcasters to include more educational programming into their advertiser-driven schedules. To this end Rockefeller was funding fellowships at the CBS and NBC broadcasting networks.

Aware of the Dartmouth connection, Marshall encouraged the enterprising Cantril to apply to the Foundation for support. Cantril’s request resulted in a $67,000 grant for a two-year charter of the “Princeton Radio Project” (PRP) at Princeton University. There Cantril proceeded to develop studies assessing radio’s effects on audiences. In 1938 Cantril also became a founding editor of the Rockefeller Foundation-funded Public Opinion Quarterly, an organ closely associated with US government’s psychological warfare endeavors following World War Two.

When the Princeton venture commenced another trained psychologist close to Rockefeller, CBS Director of Research Frank Stanton, was named PRP lead researcher but took a secondary role of Associate Director due to his position at the broadcast network. At this time Austrian émigré social scientist Paul Lazarsfeld was recruited to join Cantril. Thus Cantril, Stanton, and Lazarsfeld were closely affiliated and ideally positioned to embark on a major study involving public opinion and persuasion.

The opportunity for such an analysis presented itself when CBS broadcast Orson Welles’ rendering of H.G. Wells’ War of the Worlds on on October 30 1938. Lazarsfeld saw the event as especially noteworthy and immediately asked Stanton for CBS funds to investigate reaction to what at the time was the largest immediate act of mass persuasion in human history. Over the next several months interviews with War of the Worlds listeners were collected, provided to Stanton at CBS, and subsequently analyzed in Cantril’s 1940 study, The Invasion From Mars: A Study in the Psychology of Panic”

(Source: Early “Psychological Warfare” Research and the Rockefeller Foundation | Time Reference: 09:46)

A fascinating little tidbit from history I trust that you’ll agree and if you do I hope you’ll go and follow the link in the show notes to that original article so you can continue reading about Hadley Cantril’s adventures providing studies and information about psychological persuasion to the Rockefeller Foundation, and how that developed and contributed to world psychological warfare techniques for the US Army and things of that nature, but again I think it is interesting to see this confluence of HG Wells’ War of the Worlds becoming a radio dramatization which incites this mass panic, the largest immediate act of mass persuasion in human history, that is then studied by the Princeton Radio Project backed up by the Rockefeller Foundation.

But you could argue that that’s a tangential connection or just a coincidental connection, that this doesn’t mean that the Rockefellers are interested in mass-persuasion in terms of alien invasion per se, it’s just that that was the immediate proximate cause of this particular study.

So you might fruitfully ask “Are there any connections between the Rockefellers and this idea of faking an alien invasion or an alien presence of some sort?” and the answer is…yes! Yes there is such evidence…

“Mr. Rockefeller backed many UFO-related projects in the period between the late 80s and 2000, but for the purposes of this Hearing we will concentrate on his political initiatives in these areas. Laurance Rockefeller’s first forays into ufology started sometime in the late eighties through Dr. Cecil B. Scott Jones, a parapsychologist and former U.S. Navy Commander who had worked as Naval Attaché in Asia and at the Naval Scientific and Technical Intelligence Center. Between 1985 and 1991, Jones was Special Assistant to Senator Claiborne Pell (1918-2009), the powerful Rhode Island Democrat Chairman of the Senate Foreign Relations Committee (1987-1994) who was deeply interested in parapsychology, and who many of you met personally. Sen. Pell was also friends with Laurance Rockefeller and both served on the board of the Human Potential Foundation, a small think tank launched in 1989 in Vienna, Virginia, by Jones to conduct “research into all conditions of humankind: physiological, psychological and spiritual”.

Many of the papers released by the White House’s OSTP come from Scott Jones, who knew Dr. John Gibbons, a physicist who worked for many years as Director of the Office of Technology Assessment for the U.S. Congress and was appointed in 1993 by the Clinton administration to direct the OSTP.

What was the exact turning point of Laurance Rockefeller’s evolution from a general interest in consciousness studies into the specific area of UFOs and Extraterrestrial Intelligence is still unclear, but the end of the Cold War and the arrival in Washington of a younger generation represented by Bill and Hillary Clinton are key factors. He felt the time was ripe for a new and fresh approach into an area that had been previously dominated by a Cold War mentality. Rockefeller recruited for this effort a long-time associate, Henry L. Diamond, an environmental attorney from Washington, DC whose links to the family went all the way back to the 1960s when he worked with Laurance in his conservation activities. Diamond also knew John Gibbons and so he was the right person to make the first contact with the OSTP chief when he sent a Memorandum on March 29, 1993 requesting a meeting, and I’m quoting now the first paragraph:

Laurance S. Rockefeller, who is a leading U.S. conservationist, businessman, and philanthropist, is anxious to have a brief meeting with Dr. Gibbons to discuss the potential availability of government information about unidentified flying objects and extraterrestrial life. As one who has had a long-time interest in environmental and spiritual issues, Mr. Rockefeller, with other leading citizens, is planning to make an approach to President Clinton on this subject…”

(Source: The Citizens Hearing on Disclosure April 29th Antonio Huneeus | Time Reference: 14:07)

“I invite all of the political media, all media in general but certainly the political media , to look at the Rockefeller initiative it is one of the stories in American history it’s one of the great political story certainly in this or any other time. It is filled with amazing people who are still around and still very powerful. At the time that Rockefeller approached, through his attorney, President Clinton. Clinton’s key adviser or one of his very key advisors was John Podesta. The Chief of Staff at the time was Leon Panetta. The wife of the president at the time was Hillary Clinton. A good friend of the family at the time, soon to be Clinton’s Secretary of Energy, was Bill Richardson. This Initiative went on for six years. The press completely ignored it, as if What’s the news there? It’s just a billionaire Rockefeller trying to get the President to release all of the files on these phenomena. Possibly put a letter into every newspaper in the country, and release… and basically end the Truth Embargo. There’s no news there.”

(Source: Citizens Hearing April 29th Steven Bassett Rockefeller Initiative and John Podesta | Time Reference: 17:07 or Annotated Proceedings of the Citizen Hearing on Disclosure – pdf)

Now for those of you not immersed in the topic of the disclosure movement you may not be familiar with some of these names and faces but some of the main ones to take note of are, of course, Dr Stephen Bassett who founded and ran something called the Paradigm Research Group at paradigmresearchgroup.org. He defines himself as a political activist, lobbyist, commentator, the executive director of Paradigm Research Group and the Extra Terrestrial Phenomena Politicalist Action Committee and executive producer of the X Conference the Citizens Hearing on Disclosure and the Congressional Hearing Initiative and Dr Steven Greer who runs something called the Disclosure Project and he describes himself as the father of the ‘Disclosure Movement’ and the person who presided over the groundbreaking National Press Club Disclosure Event in May of 2001.

So these are some of the biggest names if not the biggest names in this disclosure movement and, well, they don’t really make a secret of the fact that the Rockefellers are, well specifically Laurance Rockefeller was a big help in getting this movement launched back in the mid 1990s and again we can document this and in order to do so let’s turn to a very important website which I will commend to your attention and I hope that you guys out there have… well I know some of you have already found and have emailed me about it. I have found it myself and it seems that myself and the author of this website are in accord on a number of political views especially the overall way in which the the BRICS and China and Russia and other aspects of the ‘new world order’ system are being used as the good cop in a ‘good cop/bad cop’ system, but also on this subject of the UFO ‘disclosure movement’ in a very important article called ‘Why are the Rockefellers and the Jesuits guiding the UFO disclosure movement at redefining god.com, I will put the link in the show notes so you can go and follow it but just reading from that article:

“The Rockefeller role in getting the disclosure ball rolling is something of an open secret among the disclosure people, the disclosuristas as I call them, on Stephen Bassett’s own Research Group website, a specific Rockefeller effort referred to as ‘The Rockefeller Initiative’ is openly touted. The same effort is also touted on Steven Greer’s disclosure project website as ‘Project Starlight’.

This letter from the Project Starlight Coalition was the result of the historic as Asilomar California meeting that Dr. Greer organized and Laurance Rockefeller paid for in June 1995, just before Clinton’s meeting with Rockefeller in August 1995.”

Source: Why are the Rockefellers and the Jesuits guiding the UFO Disclosure Movement? | Time Reference: 20:06)

So who is Laurance Rockefeller ? Well according to Laurance Rockefellers biography, in 1937 he inherited his grandfather’s seat on the New York Stock Exchange. He served as Founding Trustee of the Rockefeller Brothers’ Fund for 42 years from its inception in 1940 to 1982. During this time he also served as president 1958 to 1968, and later its chairman 1968 to 1980, for 22 years, longer than any other leader in the fund’s history. He was also a founding trustee of the Rockefeller Family Fund from 1967 to 1977.

So not only was Laurance deeply involved in the financial industry, but he was also among the founders of the Rockefeller Brothers Fund and the Rockefeller Family Fund. These funds are notorious for advancing globalist aims under the pretense of ‘philanthropy’. Laurance also served on the Rockefeller Brothers Fund’s ‘Special Studies Project’

Now, I’ll let you continue reading about that special studies project and the interesting fact that even now, four decades after the publication of the final report the ‘Prospect for America: The Rockefeller Panel Reports’. Certain sections of that report are still classified, which is interesting in and of itself, but there are also screenshots of some of the pages of this report here in this very important article talking about how they are steering America towards shaping a ‘new world order’ and things that you would expect to find in a typical Rockefeller study.

I suppose the point here is to emphasize that Laurance Rockefeller, of course very much in the heart of the Rockefeller matrix, pushing this global-government agenda which David Rockefeller so gleefully admitted to in his memoirs, as I’m sure we all know or we all should know by now, and I would again suggest you go to see this original article if for no other reason than to click on such things as ‘The Rockefeller Initiative’ or the Disclosure Project’s own ‘Projects Starlight’ page where you can browse through and see all of the main characters who are connected through this initiative, that ran from 1993 to 1996 including of course President Clinton and Laurance Rockefeller along with Hillary and Dr. John Gibbons and John Podesta and vice president Al Gore and all this other cast of Congress critters and very unsavoury characters including of course Dr. Steven Greer, the aforementioned father of the disclosure movement. And again all of these letters are archived here online so you can go and read through them all and the various correspondence between some of the players including Laurance Rockefeller and John Gibbons and Laurance Rockefeller and the Clintons.

I mean this is a pretty interesting and openly admitted non-secret that the disclosure movement was really launched with the aid of Laurance Rockefeller and the Clinton administration, so I think that should at least get our antennas up towards the possibility that this is going to be used towards the furtherance of some sort of staged or faked alien invasion .

Now that again sounds like an outlandish prospect to those poor souls coming in from mainstream-medialand who are just landing on this site randomly. I hope that you will be able to at least appreciate that there might be a reason why the very rich and powerful and well-connected would be interested in doing something as ridiculous and outlandish, I agree with you there, as staging some sort of ‘alien threat’, ‘alien presence’ – whatever it may be. But, there are reasons why this might be done and these aren’t reasons we have to speculate on. We can find all of the usual suspects talking about these reasons in all of the usual places, and of course the big ones: global religion; global finance and global government, uniting the world around this perceived alien threat.

“What is exceptional is that the Vatican was taking very seriously what science might tell us, about the possibility of extraterrestrial intelligent life-forms. That’s what the conference was about. I can’t tell you that the Vatican found any alien life, I don’t think that’s what they were looking for but they were taking very seriously, the issue.”

(Source: Alien Life: Vatican and NASA Now Talking | Time Reference: 24:59)

“We probably won’t be seeing aliens at mass anytime soon, but the Vatican’s chief astronomer does say that there could exist other forms of life outside Earth, and he says if they do exist they are God’s creatures.”

(Source: The Vatican’s Take on Aliens? | Time Reference: 25:22)

INTERVIEWER: “So how does this actually work? When Discovery decided they were going to do a show on alien invasions, your phone rings because you’re on the, sort of, speed dial for theoretical physicists who can help them do the war game for how this might play out?

DR. MICHIO KAKU: Well believe it or not we physicists have actually studied the question of what happens if we do encounter a hostile advanced civilization that space, and Hollywood gets it all wrong. Hollywood assumes that the aliens are maybe a hundred years more advanced than us, and if only we had a secret weapon we could defeat the aliens. Wrong. Either the aliens don’t bother with us because we’re simply too primitive, or if they do invade it’ll be more like Bambi versus Godzilla.”

(Source: Dr. Michio Kaku: How to Survive an ALIEN INVASION | Time Reference: 25:34)

“Now the United Nations is getting ready for contact with aliens from outer space . This is Mazlan Othman. She’s out of Malaysia. She will be plant earth’s first interstellar diplomat.”

(Source: UN Appoints Ambassador for Aliens | Time Reference: 26:14)

MAZLAN OTHMAN: “First I have to categorically deny that I was appointed or will be appointed the ambassador for aliens, the ambassador for the United Nations for aliens.
No, the committee is not discussing this very… this subject matter but yes I was in the UK to attend a meeting which I can quote to you called ‘Towards a Scientific and Societal Agenda on Extraterrestrial Life ‘which is why this whole thing came about, because the British press caught hold of the fact that I was going to be at this meeting, and I was on a panel that was discussing… they call it the Great Panel Debate. I like that name, it’s extraterrestrial life and arising political issues for the UN Agenda””

(Source: Ambassador” Rumour not True says Scientist | Time Reference: 26:26)

PAUL KRUGMAN: “It’s very hard to get inflation in a depressed economy but if you had a program of government spending plus an expansionary policy by the Fed you could get that. So if you think about using all of these things together you could accomplish a great deal.

If we discovered that, you know, space aliens were planning to attack and we needed a massive build-up to counter this space alien threat and really that inflation and budget deficits took secondary place to that, this lump would be over in 18 months, and then if we discovered “Woops we’ve made a mistake there actually aren’t any..”

PROF. KENNETH ROGOF: We need Orson Welles is what you’re saying…

PAUL KRUGMAN: No there was a Twilight Zone episode like this in which, er, scientists fake an alien threat in order to achieve world peace, well this time we don’t need it we need it in order to get some fiscal stimulus.”

(Source: Krugman calls for space aliens to fix U S economy | Time Reference: 27:18)

RONALD REAGAN: “Perhaps we need some outside universal threat, to make us recognize this common bond . I occasionally think how quickly our differences worldwide would vanish if we were facing an alien threat from outside this world.”

(Source: Reagan’s ALIEN speech to UN | Time Reference: 28:02)

“And should we win, the day the 4th of July will no longer be known as an American holiday but as the day when the world declared with one voice ” We will not go quietly into the night, we will not vanish without a fight, we’re going to live on we’re going to survive. Today we celebrate our independence day.””

(Source: Independence Day | Time Reference: 28:22)

JIMMY KIMMEL: “If you saw there were aliens there would you tell us?

BILL CLINTON: Yeah.

JIMMY KIMMEL: You would?

BILL CLINTON: I think, look. What do we know? We know now we live in an ever-expanding universe. We know there are billions of stars and planets literally out there. And the universe is getting bigger. We know from our fancy telescopes that just in the last two years more than twenty planets have been identified outside our solar system that seem to be far enough away from the sun and dense enough that they might be able to support some form of life so it makes it increasingly less likely we are alone.

JIMMY KIMMEL: Oh, you’re trying to give me a hint there are aliens.

BILL CLINTON: No, I’m trying to tell you I don’t know but if we were visited someday, I wouldn’t be surprised. I just hope that it’s not like Independence Day. That it, you know.. a conflict. Maybe that’s the only way to unite this increasingly divided world of ours. If they’re out there we’d better think of how all the differences among people on earth would seem small if we felt threatened by a space invader that the whole theory of Independence Day – everybody gets together and makes nice and you know…

KIMMEL: You and Bill O’Reilly would be hiding in a bunker together…”

(Source: Bill Clinton Talks About The Coming FAKE Alien Invasion – April 1st 2014 | Time Reference: 28:54)

What an interesting milieu of characters we have floating around there. We have the Vatican and the U.N. and Nobel prize-winning economist/Keynesian wing-nut Paul Krugman and multiple presidents of the United States and all of these people, all talking about the same thing: ‘Wouldn’t it be great if we had this idea of an alien threat that would unite us all behind ..fill in the blank…World Government or world financial system or baptizing the aliens wouldn’t that be wonderful!” and it’s interesting to look at this, I mean I didn’t fall off the turnip truck yesterday, I understand and can smell a public preparation for some sort of staged event when I see one, and well if it looks and smells and quacks like a false-flag operation – it probably is one. And again being supported by some of the most prominent and powerful and well-connected political and financial elites, clearly there is something very very stinky here, and in order to really understand this stink, again we know why this would potentially be a valuable thing for the power elites to consolidate their power in a world government or what have you, but the question is could they do it, and if so how could they do it? These are important questions that we need to address if we want to really broach the subject and, I guess if we’re going to address it we have two different routes we can take. We can go down the unverifiable, unsourceable, unfalsifiable, undocumented route, or we can go down the sourced, verified, falsifiable documented route, and me being me I’m going to go down the sourced, falsifiable, documented route. But if you want to go down that unsourced, unknowable, unverifiable route you can go, for example, with something called Project Blue Beam.

Now this is something that I’m sure most of the listeners out there have heard of at some point, at least in a vague sense, as some sort of plan that was uncovered there must be documents backing this up ,and about staging an alien invasion with holograms in order to create a world government, something along those lines.

Well, if you really want to open Pandora’s box of Project Blue Beam it’s much more specific than that and well, somewhat more outlandish and much less documented than you might expect.

This really all dates back and sources back to one particular French Canadian journalist Serge Monast who was talking in the mid 1990’s about this Project blue beam, this NASA project that he had uncovered and was unveiling to the public, that had a multiple-stage process for creating a: world religion; world government; world tyranny, and this involved the induction of earthquakes in order to expose archaeological finds – manipulated, planted archaeological finds – that would change our view of human history and a staged extraterrestrial invasion, and the appearance of a new Messiah to be the head of this world religion, and the imposition of UN World Government etcetera , so this is a detailed plan that was talked about, but again there is literally no documents behind this, there is no NASA secret paper that was ever exposed about this. It really all sources back to this Serge Monast and a couple of interviews that are available online. There’s a transcript of a speech. There’s a translation of what I guess is some sort of summary of a book that apparently he wrote on this subject. He did write a book, apparently in French, on this subject but it’s never been reprinted and its basically unobtainable so there’s a couple of different translations of something that may have sourced from this book more or less, but that’s basically it. I mean there’s just a few scraps, and from those scraps there’s been a lot of talk, and a lot of people have run with this idea but I think not a lot of people know where it actually sources from so I will put some links in the shownotes so you can actually follow them and read about them and come to your own conclusion: ‘Is this worth following?’, and ‘Why should we believe this particular piece of information?’. Call me a doubting Thomas. I’ll believe it when I see…something, anything documentable and verifiable in terms of this plan.

Now if we want to go down the other route and look at actual verifiable sourced and knowable technologies that we know exist, let alone those technologies that we don’t know exist that are being worked on in the skunkworks of DARPA, down in the bowels of the Pentagon, and for more on DARPA I’ll direct you to a previous Corbett Report radio episode where we talked about DARPA and its various projects, but for some of the technology that we do know about we can source that in a number of different ways, from a number of different seemingly disparate threads, but definitely technologies that we now know exist. One place to start – we can get the clue from the book by previous Corbett Report guest James Perlof: ‘Truth is Lonely Warrior’ where he talks about a airforce military publication that is or was available on the Air Force website. You can still access it through there on the Wayback Machine, and again the link will be in the show notes, and this is about an airborne holographic projector which this, again this af.mil website notes is:

“…a three-dimensional visual image in the desired location, removed from the display generator. The projector can be used for psychological operations and strategic perception management. It is also useful for optical deception and cloaking, providing a momentary distraction when engaging an unsophisticated adversary.”

(Source: Airborne Holographic Projector | Time Reference: 35:33)

You can see the unsophisticated visualization that is accompanying this on the website itself, but yes very crudely, it’s a plane projecting an image of another plane elsewhere in the sky. Now that, of course is a very crude implementation of this type of holographic technology that, at the very least, would be required for making the world believe we were under some sort of alien invasion threat or what-have-you, but that, again, is twenty years old now and sources from an airforce military website. I’m thinking that the actual technology would be somewhat more advanced, but again we don’t have to speculate about that we can take a look at the very real developments in technology including such incredible things as beaming sound directly into people’s ears, touchable holograms, and being able to manipulate people’s perceptions and incite fear and panic through brain wave technology.

PRESENTER: “The ultimate weapon in the infowar would be so secret, so invisible, so undetectable you would never know your mind was under attack. At Laurentian University in Ontario, Canada a young student is about to undergo one of the strangest experiences of her life. They’re hooking Denise’s brain up to an electroencephalograph or EEG machine. For 30-40 minutes this will monitor her brain waves, while these electric coils attached on either side of her head will immerse her brain in an electromagnetic field. Her brain actually completes the circuit between the two coils. The field pulsing through her brain is less powerful than one given off by a digital clock radio, but acutely controlled and focused on specific parts of the brain, it will open Denise’s mind to outside suggestion by this man. Dr. Michael Persinger is a professor of psychology and neuroscience. He is designing ways to put the power of mind-control to good use. Dr. Persinger’s research focuses on brain trauma, and he uses carefully controlled doses of electromagnetic radiation to induce relaxation and alleviate pain.

DR. PERSINGER: So what Sandra did was to initiate a opiate releasing pattern that’s a burst-firing field that is stimulated once every 4 seconds and that produces relaxation and a very pleasant sensation. Similarly using the appropriate field we can induce fear and apprehension but clearly that would be unethical in that setting.”

PRESENTER: Dr. Persinger’s tests suggest that carefully programmed electromagnetic frequencies can tap into individual brains and influence people’s emotions.

DR. PERSINGER: The cognitive processes of the human brain are really quite simple and if you understand how they work you can make entire populations think and decide in the manner of which you wish.”

PRESENTER: Many experts are skeptical of such an Orwellian scenario but Persinger thinks the implications are chillngly real.

DR. PERSINGER: Suppose you generate a field that produces fear, fundamental fear, in large numbers of people and then over the television or in traditional ways you say “The reason we’re having this fear is because of this particular group.” so now you start to move the population, believing in a direction that you wish.”

PRESENTER: To influence 250 million people, the equivalent of the entire population of the United States, may not be that difficult. According to Dr. Persinger we already have the technology, satellites and television and radio transmitters. Mind control may already be happening. We know the mysterious psyops plane can beam persuasive sounds and pictures into people’s television sets. Will it someday beam disturbing frequencies directly into the mind.”

(Source: UltraScience ’97 Electronic Mind Control | Time Reference: 36:54)

DR. JOSEPH POMPEI: “First your voice is transformed into high-frequency ultrasound, a sound so high that no-one can hear it. Sound is highly directional, so like a torch it can be pointed at someone standing a long way away. Although they can not hear the ultrasound it causes secondary vibrations in the air around them and it’s that sound the person hears. So, if you imagine you’re in a room and I shine a flashlight at you it’s very bright for you but it’s very dark for everybody else. In much the same way the audio spotlight creates a very narrow beam of sound that can shine at a listener. They hear it very clearly and it doesn’t create noise that might bother other people in the same space.”

(Source: Voice to Skull Time | Time Reference: 40:12)

PRESENTER: “Researchers at Tokyo University have come up with the technology that is a first and significant step away from the mouse and keyboard, touchable holograms.

HIROYUKI SHINODA (translated): Up until now holography has been for the eyes only. If you tried it touch it, your hand would go right through, but now we have the technology that also adds the sensation of touch to holograms.”

(Source: Japanese Scientists Create Touchable Holograms | Time Reference: 40:51)

Now look I’m not necessarily saying that there’s going to be a staged alien invasion tomorrow and that we should all be concentrating on this, nor am I saying that there is no such thing as alien life in the universe. I would be shocked, flabbergasted if there was not, and whether or not it’s visiting Earth well, what do I know? How do I know? I mean I haven’t seen it myself but does that mean it doesn’t exist? Well of course not. Again I’ll let you guys, you’re grown up boys and girls out there I’m sure, I’m sure you can decide for yourself on things like that but we should know that there is a coordinated plan or an agenda in place, to capitalize on such things as fake alien invasions that is being funded and promoted by the financial power elite, at the top of the pyramid, and is being promoted and pushed out into the cultural sphere by the politicians and economists and the Vatican and the UN, and then underneath them the culture- creators in the entertainment industry, to prepare the public for such a possibility and we should be on guard against such manipulations.

And again these technologies that are now coming together, again the ones that we know about, let alone the ones that her secretly in development that we don’t have access to, are clearly along the path towards making such an event possible ,and again you can look at something like the Norway spiral and believe the official response that this was a Russian ICBM test that went awry and if you believe that I have a bridge on the moon to sell you, but again all of these are just different pieces of the puzzle and I think they add up towards something very interesting and something that is potentially coming sometime in the future, but even if this particular instantiation this fake alien invasion or what-have-you doesn’t come together, still the concept of psychological manipulation through manipulated events in manipulated reality is an important one, and obviously one that we have to continue to keep in mind and now that the technology for making these events possible is more and more a documentable reality I think, again we should have our mental guards up for such eventualities.

So that’s, I think, where we’re going to leave things today.

Once again this is an open-source investigation and I invite and encourage and applaud the input of all of you out there so if you are a Corbett Report member please do leave your comments on the website with any relevant links or information. Any comments, questions, complaints, criticisms, concerns or otherwise all invited as usual there at corbettreport.com.

Once again I’m your host James Corbett of corbettreport.com thanking you for joining me for this edition of the Corbett Report podcast and inviting you to join me again next week.

 

Connect with James Corbett



Project Blueballs — Fulford, Wilcock and the False Hope Energy Heist

Project Blueballs — Fulford, Wilcock and the False Hope Energy Heist

by Zen Gardner
April 21, 2012

 

They’re all doing it.

From religious spewing to the political realm to phony financial prognostications and alternative community advantage-takers, inadvertently or not, it’s an easy sell that goes down smooth.

False Hope Sells

Obama’s wrecking crew is the perfect example as they finish what the last several Presidents started.

Their bullshit “Hope and Change” campaign was disgusting in its pandering to a teed-up America whose anti-war-and-everything angst was deftly fanned into a bonfire by the complicit media.

Hence the emotional fawning over Obummer that was enough to make anyone half awake puke.

I’m more concerned about the alternative research community. I think it’s time to caution the sincere against these false hope snake oil salesmen that are bleeding the energy out of the goodhearted “wanting to believe something good” folks.

And that includes the ‘Fulford / Wilcock‘ preacher types and their cultish half-baked unsubstantiated claims of deliverance into a “new mafia” of all things.

No thanks.

Fulford-Wilcock Leads to Nowhere

There’s not a lot that needs to be said about the Fulford-Wilcock affair.

 It may mean well but it’s spun around a very strange dynamic of secretive information and supposed interpretation. What I resent is being tooled along with it all, as if it’s real information and something to pin my hopes on.

And many sincere folks are falling for it because it brings hope. It’s much like new age or religious info where you are strung along on supposed “facts” from doctrinal or channeled information and etherial suppositions.

Sorry, I’ve been tooled before. No longer.

This just smells completely wrong. The “dragon family” will supposedly replace the Bavarian Illuminati and all will be well? Hello? Anybody home? Millions of ninjas and Asian mafiosos will scour the existing power structure and bring harmony to the good of all?

Are we in a comic book?

Don’t need this kind of disinfo, however “well meaning”. Get your facts straight first, then report to us. We’re busy here trying to survive and help others transcend in a very real matrix-ruled world and working our way around and beyond it. Don’t screw with us.

Don’t you get that?

Another Example – The Ron Paul Bus to Nowhere

Sorry, and I don’t mean to make a blanket assessment on this issue, but it will seem that way. I like activism, I like to encourage participation, and I love to see people expressing their passion for freedom and a better world.

As long as it’s going somewhere – most of all towards a fully conscious awakening to the big picture which I believe is the litmus test.

But U.S. Presidential politics is a complete scam.

Like they say,

“Don’t vote, it only encourages them.”

It’s sickening-mostly that there are so many that don’t see it. Plain and simple.

More than that, to grasp that this crossroads of understanding is a place of decision that has everything to do with your spiritual outlook and overall perspective, that’s profound.

But few will get that.

The Big Issue – The Energy Vampires

Where is all this energy going? These are perfect examples.

We all know Ron Paul would never get in. They’d assassinate him if they had to, but it won’t get near that. It is a good background with which to contrast the shallow insanity of the mainstream press and all, and might be leading to further wake ups.

To have any hope that this current system is reformable is ultimately a distraction and energy zapper. It may be building community with common thinkers which can be real good, especially to help each other prepare for the coming chaos that’s unfortunately right around the corner.

But to give so much attention and energy to something we know isn’t going to come to fruition should be giving people pause to think.

Can we afford to really stop and think? I just hope they translate over to conscious awareness of the big picture.

Religion Preys on False Hope

We all wish something would work in our favor in the horrific situation we appear to be in. But we can’t pin any energy on false hopes.

This is exactly how religion operates. Anyone who has had a conscious awakening and come through some of these paradigms can smell these things when they come around.

And it’s a lot healthier to be skeptical than a dumb sheep “believer” in something you have zip evidence is true. Only hope. And that’s where it takes root in your heart. Be careful.

It’s the same as “belief”. Know, or don’t know. It really is that simple. But the matrix programming will fight that. Learn this precept. Have a good heart, be intuitive, but don’t be misled.

They are completely different frequencies.

When Hope is Right

Yes, there’s hope. In fact in reality everything is just fine right now. Death isn’t going to change a damn thing. We are eternal beings on a journey here and our main purpose is to discover who we already are.

The most wonderful thing there is in the Universe!

But we’re not here to invent a new belief system that feels comfortable and “seems” to explain things around us… oh, and by the way, will save you at the eleventh hour when things turn nasty… and bring you new adherents, and to pad your ego and account balance. Sorry, bastards.

Damn that.

I do believe we’re in a time of serious change, including esoteric influences that can be used in our favor, but I’m very skeptical of sweeping promises that are not consciousness based. I know from personal experience that conscious awareness, our oneness, our inter-connectivity and being a part of the Source… call it God or whatever… is our essence.

I feel I know very little about it but I know it. Period. I’m just sharing my heart on all this. Hope it helps.

Be awake. Keep questioning.

Don’t believe… just know what you know!

 

 

Zen Gardner is an impactful and controversial author and speaker with a piercing philosophical viewpoint. His writings have been circulated to millions and his personal story has caused no small stir amongst the entrenched alternative pundits. His book You Are the Awakening has met rave reviews and is available on amazon.com. You Are the Awakening examines the dynamics of the awakening to a more conscious awareness of who we are and why we are here – dynamics which are much different from the programmed approach of this world we were born into.