From the palatial living room studios of The Corbett Report it’s the 4th Annual Fake News Awards. The boldest lies. The stupidest propaganda. The ugliest presstitution. Join James as he debunks the lies and shames the liars behind the biggest fake news stories of 2020. Who will take the Dino for the worst fake news story of the year? Watch and find out!
In this video you’ll see how people treat free speech these days. Should freedom of speech still be a thing? Of course not! You’ll learn that freedom of speech causes violence and it needs to be censored because it’s highly dangerous. You also learn how depressed freedom of speech feels.
Part of the main duty of OffGuardian is to troll through the masses of media output and try and pick up patterns. Sometimes the patterns are subtle, a gentle urging behind the paragraphs. Sometimes they’re more like a sledgehammer to the face.
This has been face-hammer week. In fact, it’s been a face-hammer year.
From “flatten the curve” to “the new normal” to “the great reset”, it’s not been hard to spot the messaging going on since the start of the “pandemic”. And that distinct lack of disguise has carried over into other topics, too.
We pointed out, a few days ago, the sudden over-use of the phrase “domestic terrorism” preparing us for what is, almost certainly, going to be a truly horrendous piece of new legislation once Biden is in office.
Well, the buzz-phrase doing the rounds in the wake of Donald Trump being banned from the internet is “the new definition of free speech”…and variations on that theme.
Firstly, and papers on both sides of the Atlantic want to be very clear about this, Donald Trump being banned simultaneously from every major social network is not in any way inhibiting his free speech.
Indeed none of the tens of thousands of people banned from twitter et al. have had their free speech infringed either. Neither have any of the proprietors – or users – of the Parler app which the tech giants bullied out of existence.
Free Speech is totally intact no matter how many people are banned or deplatformed, the media all agree on that (even the allegedly pro-free speech think tanks).
They also agree that maybe…it shouldn’t be. Maybe “free speech” is too dangerous in our modern era, and needs a “new definition”.
That’s what Ian Dunt writing in Politics.co.uk thinks, anyway, arguing it’s time to have a “grown-up debate” about free speech.
Thomas Edsall, in the New York Times, wonders aloud if Trump’s “lies” have made free speech a “threat to democracy”.
The Conversation, a UK-based journal often at the cutting edge of the truly terrifying ideas, has three different articles about redefining or limiting free speech, all published within 4 days of each other.
The conclusion could have been written by an algorithm analysing The Guardian’s twitter feed:
the suggestion Trump has been censored is simply wrong. It misleads the public into believing all “free speech” claims have equal merit. They do not. We must work to ensure harmful speech is regulated in order to ensure broad participation in the public discourse that is essential to our lives — and to our democracy.
The attack on the Capitol exposed, in stark terms, the dangers of disinformation in the digital age. It provides an opportunity to reflect on the extent to which certain elements of America’s free speech tradition may no longer be fit for purpose.
Trump’s angry mob was not just incited by his single speech on Jan. 6, but had been fomenting for a long time online. The faith in reason held by Mill and Kant was premised on the printing press; free speech should be re-examined in the context of the internet and social media.
Ives clearly thinks he’s enlightened and liberal and educated, after all he drops references to Kant AND Mills (that’s right TWO famous philosophers), but he’s really not. He’s just an elitist arguing working class people are too dumb to be allowed to speak, or even hear ideas that might get them all riled-up and distract them from their menial labour.
To season these stale ideas with a sprinkling of fear-porn, NBC News is reporting that the FBI didn’t report their “concerns” over possible violence at the Capitol, because they were worried about free speech. (See, if the FBI hadn’t been protecting people’s free speech, that riot may not have happened!)
And on top of all of that, there’s the emotional manipulation angle, where authors pretend to be sad or exasperated or any of the emotions they used to have.
In The Hill, Joe Ferullo is almost in tears that the first amendment has been ruined by the right-wing press continuously “shouting fire in a crowded theatre”, citing the famous Oliver Wendell Holmes quote, which so many use to “qualify” the idea of free speech, without realising it hands over power to destroy it completely.
Up until you can show me the hard-and-fast legal definitions of “shout”, “fire”, “crowded” and “theatre”, this open-ended qualification is nothing but a blank canvas, free to be interpreted as loosely – or stringently – as any lawmaker or judiciary feels is necessary.
As an example:
Twitter is certainly bigger and more populated than a theatre, and spreading anti-vaccination/anti-war/pro-Russia/”Covid denial” news [delete as appropriate] is certainly going to cause more panic than one single building being on fire. Isn’t it?
It’s this potential abuse of incredibly loose terminologies which will be used to “redefine” free speech.
“Offensive”, “misinformation”, “hate speech” and others will be repeated. A lot.
Expressions which have no solid definition under law, and are already being shown to mean nothing to the media talking heads who repeat them ad nauseum.
If “go home in peace and love”, can become “inciting violence”, absolutely everything can be made to mean absolutely anything.
The more they “redefine” words, the further we move into an Orwellian world where all meaning is entirely lost.
And what would our newly defined “free speech” really mean in such a world?
Willem Felderhof w/ Dr. Eric Karlstrom: International Science Frauds, Including Global Warming and COVID Narrative, Usher in the New World Order
[As a service to protect truth from censorship and to share widely, mirrored copies of this video are available at Truth Comes to Light BitChute, Brighteon, Lbry/Odysee channels. All credit, along with our sincere thanks, goes to the original source of this video. Please follow links provided to support their work.]
Quote from J. Edgar Hoover, shared by Willem during the interview:
“The individual is handicapped by coming face-to-face with a conspiracy so monstrous he cannot believe it exists. The American mind simply has not come to a realization of the evil which has been introduced into our midst. It rejects even the assumption that human creatures could espouse a philosophy which must ultimately destroy all that is good and decent.” ~ J. Edgar Hoover
Excerpts from Dr. Eric Karlstrom’s words:
“…power doesn’t care about truth. Power doesn’t need to care about truth. Power wants power. And the CIA has always been all about power and has served the power elite. In realpolitik — okay, what is realpolitik? Realpolitick is Machiavelli — might makes right, the ends justify the means, divide and conquer, you have to lie to the people… Well, the CIA runs America. It certainly has since they killed Kennedy in 1963…”
___
“It doesn’t matter if there’s only one person in the world who understands the truth. The truth is still the truth… The heart of the scientist, the mind of the scientist is fundamentally different from that of the political scientist or the political operative.”
___
“The US military industrial complex is the elephant in the room and, of course, they serve Wall Street and the City of London power structure — who, as we dig deeper, these are the psychopaths, the pedophiles, the people who do all the really rotten things. So, we have a big problem… What they are enforcing now with the vaccines and the mask mandates is slavery — world slavery — which has apparently always been the goal…
And, of course, this has to be resisted at every cost… Better to be dead in a fight than to have a whole series of vaccines which turn your body into something that is connected to the Pentagon cloud — and that your every move and every thought is monitored and controlled by the elite. This is what’s coming down.”
___
“The CIA wrote a memo in 1962 saying we want to control the weather. And, of course, this is what has happened. The geoengineering, weather warfare, weather modification has been a series of black projects to a large extent, but not all black, since WWII — really pioneered by the Brits and America. And the geoengineering allows — and then even Lyndon Johnson, President Lyndon Johnson, said I think in ’64 or ’65: ‘Who controls the weather, controls the world.’
And so, what we have is a push underneath the surface by the CIA, and the military planners and their corporate buddies to control all aspects of humanity, civilization, the external and the internal environments. With the MKUltra – ‘let’s control the internal environment for our advantage’. With the weather control – “let’s control the external environment’.”
___
“The global warming fraud has morphed over time…
We really don’t know the average temperature of the earth because it’s impossible to measure the average temperature of the earth — because it’s always warming and cooling somewhere, and it’s changing every second. But still this whole field is rife for fraud and misrepresentation.”
___
“It became then relevant and obvious to me and my students that what we had here was the political corruption and cooption of a whole body of sciences including biology and climatology and earth science…
In order to believe the man-caused-global-warming fraud you have to basically throw everything we know out about earth science.”
___
“In other words, the computer model becomes the reality in the minds of the politicians and the media — and fuels then these political agendas which, again, tend towards one world government and enslavement — and loss of national sovereignties, individual sovereignties. So, it’s a tragedy. And we saw it with the climate fraud that billions were poured into this fraud over a long period of time…
Why should people trust science — if our science is so bogus, is so bad? And the same thing now is happening with the biosecurity state, the medical emergency — the non-emergency that we have here, listening to people like Fauci and Birx and what not. I mean these people are charlatans. They’re liars. They’re criminals. They’re thieves. “
___
“Our scientists, our psychologists, our cognitive researchers, our neuroscientists — they’re committing crimes against humanity — against us. Their science is being used by the military intelligence corporate complex against humanity.”
___
“Catherine Austin Fitts calls this committee that runs the world ‘Mr. Global’. We have to identify Mr. Global and take him out. Permanently. We have to take out Mr. Global. And, of course, Mr. Global has his fingers in every institution. But we can still do it. As long as there’s life, there’s hope, you know.
And I think, you know, the resistance we saw in Washington, DC yesterday is an indication of what we’re going to see. I think we’re going to see — hopefully, we’re going to see continued resistance.”
Willem Felderhof is a former commercial airline pilot and was a whistleblower on the presence of toxic elements in aviation generally known as “the Aerotoxic syndrome”.
Related Links:
The article/document written by Dr. Eric Karlstrom, mentioned by Willem:
Original video available at AwakenWithJP YouTube channel.
[As a service to protect truth from censorship and to share widely, mirrored copies of this video are available at Truth Comes to Light BitChute, Brighteon, Lbry/Odysee channels. All credit, along with our sincere thanks, goes to the original source of this video. Please follow links provided to support their work.]
You see them everywhere. Men and women walking down the street, all of them with masks on their faces and cell phones in their hands. People jogging, with masks covering their faces and cell phones in their hands. Mothers wheeling their babies with one hand, holding a cell phone in the other hand, with a mask covering their face.
The world has gone insane.
Back in May, the President of Tanzania announced that a goat, a quail, and a papaya had tested positive for COVID-19. People did not stop eating papayas. But when farmed minks began testing positive, the response has been to kill them all.
After a few minks in the Netherlands tested positive in April, 570,000 minks were slaughtered. Minks started testing positive and being killed in Denmark in June, and on November 4, Denmark announced it would destroy the rest of its 17 million minks. Sanity finally broke out in that country, and the eradication campaign stopped after only 2.5 million minks were slaughtered. But minks have also been killed in Spain, Sweden, Greece, France, and the United States.
Lions, tigers and leopards in zoos have tested positive.
This is what you are supposed to do: “Isolate the pet from everyone else, including other pets.” “Keep your pet at least 6 feet away from other pets and people.”
“If you have a private backyard where your dog can go to the bathroom, do not take them for walks.” But, the CDC warns, “Do not wipe or bathe your pet with… hand sanitizer,” and “Do not try to put a mask on your pet.”
It is becoming obvious that no matter what you test — minks, lions, dogs, papayas, people, or anything else — you will get positive results, and that the results mean nothing. Just wait until someone tests a cow. Kill all the cows, and no more meat or dairy products! Vaccinate every pet and farm animal in the world! Do contact tracing for every pet that comes in contact with an infected pet!
We have a pandemic, all right, but it is a pandemic of insanity, not COVID-19. The world — the entire world, not just a few people or a few countries or a few cultures — has forgotten what life is. Life is community. It is social contact, touching, breathing, sharing. It is oxygen. People are dying because their masks are making them hypoxic. Cancer cells thrive in the absence of oxygen.
If you have cancer, and you wear a mask, you are making your cancer grow. And life is bacteria and viruses. Ninety-nine percent of all bacteria and viruses are beneficial and necessary — necessary for life, and necessary for evolution. If you disinfect the surface of the earth, you will put an end to life. We did not disinfect the world for smallpox, influenza, measles, or tuberculosis. But we are doing it for “COVID-19.”
And we are blaming every symptom known to man on “COVID-19.” COVID-19 is a respiratory virus, closely related to the common cold. But we have made a caricature of it. Suddenly a coronavirus is a magical piece of RNA, created by Dracula, that will damage your kidneys or your heart or give you a stroke.
There is another, very real pandemic that is out of control: a pandemic of radiation. A pandemic that does cause kidney and heart damage and strokes, in addition to pneumonia. The radiation is produced by cell phones. The cell phones with which mothers are irradiating their babies, and joggers are irradiating their hearts. The cell phones with which 7 billion people are irradiating the birds, insects and flowers around them. The radiation that will kill all 7 billion of us, unless we put an end to it.
Take Back Your Health Conference, January 23-24, 2021
I will be speaking about these issues at the 2021 Take Back Your Health (TBYH) Conference. This year’s conference, featuring doctors, immunologists, environmental experts, and others, is titled Our Global Microbiome: Understanding Our Relationship with the Viruses, Bacteria and Molds Around Us.
The conference will be held online January 23 and 24. Details and registration information are here: https://conference.tbyhguide.com/.
Even those who aren’t paying attention, probably know by now that access to information is being blocked. Apparently, a handful of people have decided that our new normal does not include the right to speak or hear unapproved facts. To the extent possible, they’re creating a digital echo chamber; where they write the official narrative, and only those who repeat the narrative are permitted to be seen and heard.
There’s a science to making people believe things that are not true. Bertrand Russel, an expert on the topic, argued in the 1930s that “The society of experts will control propaganda…all real power will come to be concentrated in the hands of those who understand the artof scientific manipulation.”[i] He noted that the population will: “not be allowed to know how its convictions were generated.”[ii] Hopefully, this short video will shine some light on how they generate convictions.
For those of us who understand the “art of scientific manipulation,” because we’ve studied the history of those who employ it, the COVID 19 manipulation could not have been more obvious. Once you know the formula, it’s very easy to identify: Use the media to convince the population that it faces an imminent apocalyptic threat, generate as much hysteria as possible, and then implement your desired policies; policies that, without the hysteria, would have been politically impossible.
At this point, they’ve already achieved many of their desires, so let’s turn our attention to one goal that they’ve yet to achieve: Injecting billions of human beings, multiple times, with a rushed, inadequately tested, unproven mRNA vaccine. Fortunately, their propaganda formula is less effective in the age of the internet. Unfortunately, they’ve now identified and addressed this problem by adding censorship to the mix. And it’s not just Facebook, YouTube and Twitter.
When my wife and I moved back to Ohio, somebody invited us to join nextdoor.com. Unlike Facebook, where you see things that your friends have posted, nextdoor.com periodically sends an email digest of posts from people who live in and around your neighborhood. Garage sales, lost cats…recently, somebody found a chicken that flew the coop…stuff like that. In 8 years, I’ve only gone to the site a handful of times to comment. Last week was one of them. The post read: Will you get the COVID vaccine and why?
Clearly, I’m passionate about this topic, so I was one of the first ones to reply. I wrote: “No. You couldn’t pay me enough to take a rushed mRNA vaccine for a disease that, in the vast majority of people, has a 99.98% survival rate. (And that’s IF you catch it. Many seem to already have some form of immunity.) Add in the fact that the vaccine may only reduce symptoms, not prevent infection or transmission, and the idea of injecting billions of healthy people seems downright criminal.”
So, that was my first post. Let me show some references to back up my claims. All links will be available in the description.
*First, my claim that “the vast majority of people have a 99.98% survival rate” is based on information from the CDC and the UN. Some of you might have seen graphics like this that use CDC data to show the survival rate based on age: https://www.mediafire.com/view/74pgutm4b7ee8a5/CDC-Survival-rate2.jpg
However, if you want to confirm this on the CDC website, you’ll notice that the CDC presents their numbers in decimal form, and they focus on the number of people who die instead of the number of people who survive. https://www.mediafire.com/view/xxhg7luan0ukyuy/CDC-Survival-rate.jpg No problem. To confirm the survival rate, you only need to do two things: First, convert the CDC’s decimal format to a percent by moving the decimal point 2 places to the right. You now have your infection fatality percentage. Subtract the fatality percent from 100% to see how many people will survive. In this case, 99.997% survive, and in this case 99.98% survive.
For a little more perspective, 99.98% survival rate translates to 1 death in 5,000 infected people. I emphasize infected because it appears that many people are already immune to this due to exposure to other coronaviruses. It could be that 10,000 need to be exposed for 5,000 to become infected and for 1 of those people die. Bottom line, contrary to what the pharma-funded “experts” and media want you to believe, unless you personally know at least 5,000 people under the age of 50, there’s a good chance you won’t know a single person in that age group who dies from this. How many of the planet’s 7.8 billion people are under the age of 50? According to the UN, about 6 billion.
Here’s that reference. Note that the graph shows figures in thousands, so to get the actual total, you’ll have to add 3 zeros. https://www.mediafire.com/view/ckdntmilk3mvdca/UN-under-50.jpg
You can run the query yourself here: https://population.un.org/wpp/DataQuery/
Last but not least: Listen for yourself as Fauci admits the vaccine might not prevent infection, but that’s OK with him as long as it reduces symptoms. https://youtu.be/xYosU50_E3c
And just for fun, here’s the Nobel prize winning biochemist who invented the PCR test, Kary Mullis, giving his thoughts on Tony Fauci. https://youtu.be/azAeXdIKW3U
It’s a shame Kary died in August of 2019, just before the so-called “pandemic” was announced. I’m sure he’d have had plenty to say about how Fauci and his friends have used the PCR test to “scientifically” create public hysteria.
OK, so when I first replied under the COVID vaccine thread, only a couple other people had posted, and they too responded with an emphatic “No way, I’m not taking it.” However, the next day, somebody responded with a yes. Quoting from his post, under the question will you take the vaccine and why, he replied.
“Yes, the vaccine will be fully vetted. It will not be approved if the side effects are worse than the disease. Some people cannot take the vaccine – babies and those with preexisting conditions. By taking the vaccine you are not only protecting yourself but many other people…3000 people are dying every day from Covid-19, that’s like a September 11th every day!”
I took my time and replied with the following:
I’m not trying to be confrontational; you have the right to believe what you want, but I disagree with your statements. First, the virus poses no significant risk to the overwhelming majority of the population. Therefore, the overwhelming majority of the population is not “protecting themselves” by taking the vaccine. Rather, they’re actually putting themselves at unnecessary risk.
Second, Fauci himself admits that he’ll be happy if the vaccine permits infection, but simply reduces symptoms. That standard does nothing to protect the people who can’t take the vaccine.
Third, more than 160,000 people die globally every day (about 60 million per year.) Approximately 25 million of that 60 million is made up of people over 70 years of age. Many of us suspect that they are “harvesting” from that enormous pool of annual deaths to inflate COVID numbers. Excess mortality data (and diminished mortality in areas like the flu), should hopefully tell the story.
Last but not least, there is no way to fully “vet” or account for potential long-term side effects that this vaccine will cause. That could easily take 5 years or more. If the risk / benefit makes sense to you, that is fine. But the idea of coercing healthy people into taking this vaccine (via restrictions on their movement, employment, insurance, or other means), is criminal.
We’ve already covered the survival rate for 6 billion people, and I’ve already shown Fauci’s statement about whether or not the vaccine will prevent infection, so here’s a graph showing total annual deaths at 7.6 per thousand…multiply the 2020 population estimate of 7.8 billion by .76% and divide by 365 to arrive at 160K+ deaths per day. https://www.mediafire.com/view/ie0vr6cxz7o2ije/UN-Annual-Deaths.jpg/file
Regarding the typical death count in the 70+ age group, this graph from the UN puts the figure at just over 25 million deaths average per year for those over the age of 70. The period in this graph is from 2015 to 2020, so to confirm, add the figures and then divide by 5 to get the total per year. It, too, is displayed in thousands, so you’ll need to add 3 zeros when you’re done. https://www.mediafire.com/view/v22fmjy5vtc0vw1/Deaths-over-70.jpg/file
Now would be a good time to point out that all of the hysteria, censorship, economic destruction, nationwide lockdowns, curfews, privacy violations and threats of mandatory vaccination have been justified based on the world reaching its normal yearly death count on December 20th 2020, instead of December 31st. And again, that assumes the 1.7 million COVID fatalities they’re claiming haven’t been harvested mostly from the 25 million deaths that occur every year in the 70+ age group alone.
Moving on:
After posting my reply, I saved what I wrote to my computer, and I also saved the post that I’d replied to, and I’m glad I did. I’m sure you know where this is going. The entire thread was deleted.
The last time I looked at the thread, approximately 15 people had responded. Only 3 had replied “yes, I’m going to take the vaccine” so it was 4 “no’s” for every 1 “yes.” Just like the first reply that I responded to, the other “yes” replies repeated the standard “messaging” of mainstream news. “We need to trust the science,” and “don’t listen to conspiracy theories,” and “with the vaccine, we’ll be able to get back to normal.” With that said, I want to expose this idea of media-directed messaging, because it is just another term for scientifically crafted propaganda.
The obvious message, drilled relentlessly into our heads, is that we all face an ominous threat. A threat so great, that it warrants 24 / 7 news coverage and unprecedented governmental intervention. Slightly less obvious is the idea that we’re to trust, without question, the corporate-funded, agenda-driven experts that the media puts in front of us. This tiny group of media-approved experts is not superior in any way to the far-larger group of dissenting experts. In fact, you could easily argue that the tiny group is inferior. Because their job, as Kary Mullis noted, is to say what they’re told to say. Their job is to create and maintain the illusion of consensus. If they value their prestigious positions at the WHO, the CDC, the NIH and other institutes, they will not publicly challenge the official narrative. By design, that narrative contains no context that will lead to unwanted conclusions.
In pursuit of “scientific manipulation,” society has been trained to accept media propaganda for reality. The screen says there’s a new killer mercilessly ravaging the earth, and they believe…they’ve lost the confidence to turn their back on that screen and, using their own judgement, compare its claims to the reality that they actually live in. If they could just do that, if they could turn away long enough, they’d realize that the world they live in bears no resemblance to the 24-hour fear porn they’re subjected to.
Right now, we’re at a stage where they want to manipulate you into taking an unproven and inadequately tested vaccine. A vaccine that doesn’t even promise to keep you from becoming infected or from infecting others. How can they possibly manage to pull that off? Well, we’ve already covered that. They intend to manipulate you with a combination of “messaging” and censorship. If want to dig a little deeper, you can read some “messages” that Yale university is testing on the public. I’ll cover a few here. Tell me if they sound familiar:
The Guilt message
This message is about “the danger that COVID-19 presents to the health of one’s family and community. The best way to protect them is by getting vaccinated and society must work together to get enough people vaccinated. Then it asks the participant to imagine the guilt they will feel if they don’t get vaccinated and spread the disease.”
Can you count the manipulations in that short paragraph? First, we’ve already covered that COVID 19 isn’t a threat to the vast majority of human beings, which includes the human beings in your family and community. Second, they claim the best way to protect your family and community is via vaccination. (If out of 10,000 people, 9,990 face no serious risk, then you are only exposing those 9,990 people to unnecessary risk. As for the other 10 who may be at risk, it’s up to them to decide whether, best case, “reduced symptoms” are a sufficient payoff for taking an unproven mRNA vaccine. Especially when other treatments, buried by the media propaganda and censorship, are available…Finally, as with most propaganda, they threaten exclusion from the circle of “good, smart, brave, proud” people, who did as they were told. You’re either with the good guys who are working to get everyone vaccinated, or you’ll be relegated to the status of a filthy / guilt-ridden spreader. https://clinicaltrials.gov/ct2/show/study/NCT04460703
Personal freedom message
“COVID-19 is limiting people’s personal freedom and by working together to get enough people vaccinated society can preserve its personal freedom.” First of all, COVID 19 isn’t limiting personal freedom, rather, it’s being used as a pretext to limit personal freedom, that’s an important distinction. And the idea that vaccination “preserves” freedom is just bizarre. At best, they’re saying that you must surrender your freedom to decide for yourself, then, if you do that, maybe they’ll give back some of what they’ve taken. How is that preserving freedom?
I’ll just cover one more, but I’ll link to the study’s page in the description. Here we have the
The “Trust in science” message
“…getting vaccinated against COVID-19 is the most effective way of protecting one’s community. Vaccination is backed by science. If one doesn’t get vaccinated that means that one doesn’t understand how infections are spread or who ignores science.” Well, you wouldn’t want to ignore “the science!” that our scientific manipulators have chosen to put before us. Pay no mind to the 10’s of thousands of other doctors and scientists who are risking their careers (and of course, being censored), for challenging this insanity.
On that note, let’s wrap this up with a reminder from Robert Kennedy Jr. about the history of those who not only produce these drugs, but fund the only institutions and “experts” that you’re allowed to hear from.
[Truth Comes to Light Editor’s note: Original video is available at Joe Plummer YouTube channel. As a service to protect truth from censorship & to share widely, mirrored copies of this video are available at Truth Comes to Light BitChute, Brighteon, Lbry/Odysee channels. All credit, along with our sincere thanks, goes to Joe Plummer. Please follow links provided to support his work.]
cover image credit mohamed_hassan / pixabay
Dark Journalist Special Report: NORTHCOM [United States Northern Command] COG [Continuity of Government] vs The US Constitution
Dark Journalist Special Report LiveStream: Continuity of Government (COG) Vs. The Constitution Newsweek “Anonymous” COG NORTHCOM General Controversy!
Excerpts from Introduction:
“…This is our special update now and it pertains to the Trump administration and the battle that’s going on there, in a attempt by some continuity of government officials from Northcom who are trying to spread massive fear through a Newsweek article by one of Newsweek’s top writers…”
“…as I’ve discovered in talking with Professor Peter Dale Scott, who knows — really has brought forward the continuity of government program — we’ve had him on this show discussing it — we really have brought that fact through, that the continuity of government program’s a complete usurpation of the constitution of the United States. And it’s still in full effect and, in fact, was invoked on September 11th by Dick Cheney and Donald Rumsfeld.
“This is very serious because we’ve never actually gotten out of that state of emergency that we were put into as a result of the September 11th attacks. And it was September 14th 2001 when they put us in that position. So this underground government, Continuity of Government people, who exist as a counterpart to the regular government in the case of massive emergency, you know, originally were brought on board because of nuclear reasons, because they thought in the 50s ‘hey we’re gonna get nuked potentially and we need a whole underground set up in order to run things after the fact in case it’s a surprise attack’.
“So, in fact, it was again set up with kind of lofty ambitions but got taken over as time went along. And one of the things I want to point out is when we talk about the set up of the continuity of government , it’s gone through these phases. That, you know, something Professor Scott has pointed out that every deep event that has happened in American history, whether it was Watergate or the JFK assasination…”
“…What I see is that when you go through time — September 11 event, Iran Contra — all these various aspects have some Co of G players embedded…”
“…and it involves a communication network which you can not track and it’s outside of the reach of the NSA or any of these things because of the nature of its ultra secrecy. The problem is, when someone gets their hands on that and abuses it, what do we do on the surface here? And that’s the challenge that we’re facing.
“…So this thing is so ultra secret that we, as citizens, have no idea what’s going on…”
[As a service to protect truth from censorship & to share widely, mirrored copies of this video are available at Truth Comes to Light BitChute, Brighteon, Lbry/Odysee channels. All credit, along with our sincere thanks, goes to the original source of this video. Please follow links provided to support their work.]
“There are two ways to be fooled. One is to believe what isn’t true; the other is to refuse to believe what is true.” ~ Soren Kierkegaard
If you wish for freedom, you will never know it—but if you take and protect your freedom, it will be yours. Instead of succumbing to fear, and looking to government for answers, take charge of your own lives, and make all those that would assault you, your mind, your body, or your liberty, know fear. Fear is just a catalyst used by the ruling class in order to frighten and divide the people so as to gain power and control over them. This fabricated fear leads to dependence, which leads to indifference; indifference leads to silence, silence leads to oppression, and oppression leads to slavery. It is better for the people to instill great fear in the minds of any that would choose to rule over them, instead of accepting tyranny from the scourge that is the political class. All of this boils down to the fact that the citizens themselves are entirely to blame for their current lot in life.
Most of the people in this country are fond of claiming that this is a republic, and that the people rule over the government through their alleged ‘representatives,’ not the other way around. The irony is that this belief is ridiculous, while also being partially true, because the people are their own worst enemy. They have voluntarily allowed others to rule over them, and they believe that by voting for their own masters that they have some control over the process, and the policies created therein. This thinking of course is lunacy, but it is the prevalent attitude of the masses. This asinine notion has been instilled in them since birth, and the bulk of society still believes that they are ‘free.’ The people could be fully in charge in that they have the power to accept or deny rule, but in the case of the majority of people in the United States, they have accepted state domination instead of self-rule. In order to reverse this situation, all that is necessary is for the public at large to remove all consent from any claiming authority.
The solution seems simple enough, but the problem lies in how to achieve it given the weakness, cowardice, and gullibility of the herd. In order to regain the upper hand in any quest for freedom, all that is necessary is for a fairly large number of people to disobey any government order, and to deny any support whatsoever for the political class. Disobedience, non-compliance, and self-defense against any aggression by the oligarchic few attempting to gain power and control over you, will end immediately any attempt by the state to acquire that control. So why is this population so seemingly consumed with an attitude of acquiescence? This society continues to wallow in self-pity and such irrational timidity as to allow for its own servitude at the hands of tyrants when simple rebellion would save the day.
The problem once again lies directly with the people themselves. This is one case where redundancy needs to be expressed. To find the problem and the culprits in this debacle we face today, only requires one look into a mirror by most every American. What should be obvious even to the most obtuse individual is that very few in this country are willing to risk anything that could help them regain and protect their own freedom. In fact, they want only to depend on others to either fix the problems for them, or tell them what to do. But even if they are told what is necessary, they have not the backbone to see it through, and instead come up with every manner of questions, and what ifs; and are completely terrified of not fitting in with the crowd. This attitude is one of pathetic apathy by the bulk of society concerning its own defense of life, love, family, and liberty.
It is horribly upsetting to listen to the comments received from the crowd about the fate of individuals at the hands of the state. At once, they ask for solutions and complain that no one has ‘given’ them any solutions, but this is not true. They have been told the truth, but they “can’t handle the truth!” In other words, they what to be told what to do, but only if all do it at the same time. They need to hide. When the answer is to practice dissent and disobedience, they immediately claim that they are just one, and excuse the solution based on fear of not being a part of the herd. This is no doubt due to cowardice, but it is also due to the fact that they do not think as individuals, and therefore will not act as individuals. Almost all want total anonymity, and desire to be invisible from any view of scrutiny. What is not understood, is that acting as individuals en masse will bring great power to any effort to protect freedom, but almost none are willing to act alone, even with the knowledge that when many act alone, they become one. None can ‘give’ them a solution to this madness because the American population is not willing to take any individual risk for the sake of their own protection, or that of their family, their neighbors, or even their own liberty. Until this attitude changes, we are all doomed to a tyrannical existence based on the collective stupidity and disinterest of the majority.
What is going on today is a psychological experiment by ‘governing’ forces meant to accomplish a global takeover referred to often as “The Great Reset.” This experiment in order to be successful requires that the masses acquiesce to those in power, follow orders, and obey all rules ‘mandated’ by the state. Once this mindset is in place, as is the case now, regulation of every aspect of life becomes evident. Thought is controlled, as is behavior and movement, and the one test of the psyche of this country’s people used to gauge total compliance has already been achieved. That test is the almost universal wearing of useless and deadly masks. Allowance has replaced all freedom, confusion has replaced clarity, and sacrifice by all is expected.
We are now in a time where the people in the name of condemning any that choose to resist and disobey, are justifying evil. Government edicts are being protected by the masses due to false fear of ‘virus’ monsters that do not exist. The American people are being used to solidify their own servitude, and are operating in concert with the ruling class to destroy their own liberty. This is only the beginning of a greater hell on earth. Once the economy is completely destroyed, once the biosecurity state is fully in place, once digital money and tracking are complete, and once this terrible and life-changing ‘covid’ vaccine is widely injected, will there be any way out?
Arguments will continue, and blame will be spread wide, but in the end as Pogo so eloquently put it, “We have met the enemy and he is us.” Collectivism and collective ‘thinking’ are the ruination of man, and can only lead to communal self-destruction.
“Independence is the recognition of the fact that yours is the responsibility of judgment and nothing can help you escape it-that no substitute can do your thinking, as no pinch-hitter can live your life-that the vilest form of self-abasement and self-destruction is the subordination of your mind to the mind of another, the acceptance of an authority over your brain, the acceptance of his assertions as facts, his say-so as truth, his edicts as middle-man between your consciousness and your existence.”
~ Ayn Rand (1988). “The Ayn Rand Lexicon: Objectivism from A to Z”, p.225, Penguin
“The people never give up their liberties but under some delusion.” Edmund Burke, 1784
When are religious leaders going to issue demands to their members? Demands to express a duty to God first; above and beyond the restrictions of the State.
These leaders certainly believe God created humans with the quality of freedom. The Bible irrevocably states it. Therefore, under the cover of COVID, the State cannot remove that freedom.
The religious leaders must order their flocks to rebel.
Not just in order to attend church services; but to live without fear, out in the open, without hiding behind masks, without keeping their distance, without lockdowns, without sacrificing their right to earn a living.
Several Catholic prelates have declared the COVID fraud is being used as a rationale for creating an anti-spiritual new world order.
The next step is telling their Church members and believers to rebel, to choose The Good and God.
Every early story about every religion shows how the State power of the day had to be overcome. Is it now time to develop terminal amnesia about these origins?
Are those stories buried because they are inconvenient?
“By 200 [AD], the [Christian] faith had permeated most regions of the Roman Empire, though Christians were mostly in the larger urban areas (Gaul, Lyons, Carthage, Rome). By 325, an estimated 7 million were Christians with as many as 2 million killed for the faith.”
Among the reasons for this vast persecution: “Christian refusal to worship or honor other gods was a source of great contention.”
“Christians were accused of being atheists because of their denial of the other gods and refusal of emperor worship. Thus, they were accused of treason to the state.”
“For many provincial governors, Christians were considered social radicals, rather than being persecuted specifically for their faith only.”
And now, in 2020, the major religious objection to COVID restrictions concerns the number of worshipers allowed inside a church during services?
Is this the evolution of faith, or its destruction, at the hands of the faithful themselves?
Is conscience “outmoded”?
Is civilization now so “advanced” that suffering and even dying for one’s faith is considered absurd?
Is bargaining with the State over whether 10 or 50 members can enter a house of worship the cutting edge of rebellion?
It seems to me people should renounce their religion, if they’re unwilling to go to the wall for it.
Just admit that what true faith requires is too much.
Jesus endured pain and torture, and surrendered his human form, in order to save humanity, but now faithful followers can declare their loyalty during online virtual services. Or from their cars, in a parking lot. Without feeling a tremor of conscience.
Over the years, I’ve heard many claims that America (and other Western nations) were created on the basis of Christian values. Putting aside counter-arguments, if that is the assertion, then where is the courage to back it up?
What good are these claims, if in a great crisis, there is no mass rebellion, out in the open, against the tyrannical State, on behalf of God?
Again, mass rebellion means the refusal to wear masks, the refusal to maintain distancing, the refusal to obey lockdowns or close businesses. It means reclaiming freedom.
But perhaps some people believe God wants obedience to the State. He wants his loyal followers to submit to the lockdowns. He wants worshipers to surrender to an all-encompassing secular new world order, in which citizens will function as pawns in a Brave New World technocracy. He wants the faithful to be stripped of their humanity.
If so, let’s hear THAT argument.
Months ago, I said pastors and priests and other religious leaders should stand up in their houses of worship and confess their lack of courage and resign their positions. Confess they are unworthy to lead congregations. Ask for the most brave to step forward and take over.
That’s a correct course of action.
Why should these religious leaders make superficial distinctions about the limits of rebellion? In order to maintain their non-profit status with the State? In order to keep their flock comfortable?
Jesus: “Blessed are those who are persecuted because of righteousness, for theirs is the kingdom of heaven.”
But perhaps, in these enlightened times, people should worship a purported virus, and desert God.
[Satire] JP Sears: A Communist Christmas & Instagram’s New Terms of Service
In a CDC document titled, “Coronavirus Disease 2019 (COVID-19) 2020 Interim Case Definition, Approved April 5, 2020,” under the section, “Laboratory Criteria,” we have this: [1]
“Detection of severe acute respiratory syndrome coronavirus 2 ribonucleic acid (SARS-CoV-2 RNA) in a clinical specimen using a molecular amplification detection test.”
The test referred to is the PCR. And as you can plainly see, it is detecting, not the virus itself, but a piece of RNA.
A piece of RNA ASSUMED to come from the virus, SARS-CoV-2.
I say ASSUMED because, where is the actual virus? Where is the virus isolated from all surrounding material?
If you don’t have the virus, you can’t say, with any degree of certainty at all, that you have a piece of it (the RNA).
As I’ve described many times, “isolated” is a term that is tortured by researchers and public health officials, so that it means just the opposite of what it is supposed to mean. [2]
Numerous studies that claim the virus has been isolated actually turn out to mean: “We have the virus in a soup in a dish in the lab. The soup contains various types of animal and humans cells, toxic chemicals and drugs, and other genetic material. The virus is completely surrounded, but it is there. We know this, because some of the cells are dying, and this dying must be the result of infection with the virus…”
This argument not only turns the definition of “isolation” on its head, it reveals, upon a moment’s consideration, that the dying of the cells could come from the action of the toxic chemicals and drugs; and on top of that, the cells are being starved of nutrients, so they could be dying as a result of that deprivation.
Therefore, to say “the virus must be in the soup in the dish in the lab” because is killing cells…well, that’s completely unproven, and therefore…
There is no reason under the sun to claim that the virus is there in the soup at all.
Hence, the claim that the PCR test is detecting a piece of RNA from the virus is unwarranted. Because, again…where is the virus? Where is the truly isolated virus?
Nowhere.
And on that basis alone, the PCR test is irrelevant, useless, and deceptive.
It is set up to look for and detect a piece of RNA material that has never been proved to come from this un-isolated phantom ASSUMPTION, called “SARS-CoV-2.”
A few more moments of clear thought, and you realize the whole string of “science” that leads to the lockdowns and the economic devastation is not science at all.
It is what is called, in the intelligence community, a cover story. A story launched to justify crimes.
So the gov’s latest wheeze in an effort to breathe more life into its dying terror campaign has been to respond to “advice” from “experts” that it should be “worried” and “concerned” the COVID9 bug has developed a mysterious “variant” that has caused it to accelerate the rate at which it is spreading.
Having received their stimuli, Boris and Co have duly reacted in the manner of Pavlov’s dogs, turned up the dictatorship another notch and launched WEDs (Weapons of Economic Destruction) against London, ably assisted by its Mayor, Genghis Khan.
This is all being done according to the scientific methodology known as MSU (Making Sh*t Up) so favoured by oppressive regimes the length and breadth of the United Kingdom.
In line with MSU’s compulsory voluntary guidelines there’s no actual scientific evidence produced unless you count “advice” from faceless subversives, and “concern” or “worry” or Barmy Boris looking mental on TV (or Hatt Mancock looking shifty) as scientific evidence.
The government of course feels that telling everybody repeatedly that it is “following the science” is enough science, especially as science can be inconvenient and time-consuming if you have to spend days or weeks rigging the results or faking the stats – the time after all can be better spent panicking or grinding down small businesses and other government programs.
So what we apparently have is a government “concerned” about an accelerated spread of the bug because of “advice”it has received from somebody or other whose identities must remain secret for reasons of state secrecy.
That’s evidence is it?
Apparently it is at least enough evidence to justify bypassing Parliament (yet again) attacking London and turning various screws (social, economic, Yuletide, patience etc) on the populace.
And who are these freakin’ experts on whose puppet strings Barmy Boris and the rest of his intellectually challenged crew of nation wreckers are so happy to dance?
We are going to leave aside the fact that, by the way, the statistical evidence for the spread of the disease is derived from the ruddy PCR test.
The PCR test has more things wrong with it than Boris’ haircut. One of these is the minor technical point that it does not establish and never hasestablished the existence in anyone who tests positive (even in the minuscule percentage of cases where the positive is not false) of a live infectious virus.
Because of this (along with a host of other reasons) relying on the PCR test to “prove” the spread of the virus is about as sound as referring to the movie “Independence Day” to prove there’s a threat of alien invasion.
You can find out more on why the PCR test is a total fraud here
So who are those very wise but anonymous people with brains the size of a planet?
Well, professor Neil Ferguson for one, as the following article from the Spectator explains.
Leaving aside the fact that he is still advising the government when the government (in YET ANOTHER lie) said he would not be, why the hell does the government insist on using this bloke whose mathematical predictions (not to mention his personal ethics) were utterly, abysmally, horribly, blatantly, glaringly indisputably and undeniably wrong?
With the resources of the entire scientific community at its disposal, virologists, epidemiologists, mathematicians, statisticians and so forth, the gov is still taking advice from Ferguson? Is this indicative of the standards it will accept when the well being of the country is at stake?
Another, deeper, mystery in back of all this of course is this:
Why are we letting ourselves be governed to destruction by people so bereft of common sense, competence, sanity, honesty or even an interest in the survival of our country?
The Spectator at least has sided with the People and its article is well worth a read. Find it here.
A video of a confrontation between Ventura County, California health officials and restaurant owner Anton Van Happen has gone viral. The health officials were ordering Mr. Van Happen to close his business because he allegedly violated California’s ban on outdoor dining. Mr. Van Happen asked the health officials if the government will pay his employees and his rent while his business is indefinitely closed.
Mr. Van Happen is hardly the only small business owner worried about how to pay bills during the lockdowns. Many small businesses operate on a narrow profit margin, so being forced to “temporarily” shut down or limit the number of customers they can serve is a virtual death sentence.
The lockdowns have already caused as many as 200,000 small businesses to permanently close. Lockdowns, by shrinking the number of employers, lead to long-term unemployment or lower wages for many workers.
While governments have terrorized small businesses, they have typically deemed the big chain stores “essential businesses” so they can remain open. The lockdowns are thus another government policy that gives big businesses a competitive advantage over their smaller competitors.
The benefits big businesses get from the lockdowns — including fewer competitors, more customers, and a job market with more workers competing for fewer jobs — may explain why many big businesses are not fighting the lockdowns. Instead, most big retail chains are requiring their workers and customers to wear masks. Many big businesses may soon deny service to those who refuse to receive a Covid vaccine.
One would think that progressives who claim to oppose policies that benefit big corporations like WalMart, Target, and Amazon would oppose the lockdowns. Sadly, even many progressives are unquestioningly parroting the Covid propaganda and demonizing those who dissent.
By slowing down the development of herd immunity among the population, the lockdowns could put those truly at risk in greater danger. Lockdowns have also had negative effects such as increases in drug and alcohol abuse and increases in domestic violence. Meanwhile, many schoolchildren are deprived of the opportunity to interact with their teachers and their peers. Instead, these children are subjected to the fraud of “virtual learning.”
Resistance to Covid tyranny is growing as more people figure out that lockdowns and mandates are both unnecessary and harmful. This resistance was largely started by small business owners faced with a choice between obeying the government or making sure they, and their employees, can feed their families. Small business owners have been leaders in recent anti-lockdown protests across America.
Eventually the resistance will grow to the point where the politicians will be forced to either double down on authoritarianism or admit the lockdowns were a mistake. Either way, those of us who know the truth must resist the Covid tyranny until government officials no longer terrorize small businesses for the crime of serving willing consumers.
By wearing a mask over your face, you conceal your identity. One of the most common forms of human communication is facial expressions. Infants learn identity using facial expressions. Children learn to self-identify by observing body language without words. The ritual of mask wearing heralds in a loss of identity for a whole generation. Why obliterate individual identity for a fusion of identities?
A fusion of identities is part of a One World Order, a Great Reset, that includes:
No individual
No independence
No liberty
No responsibility
No property
No rights
No self concept
What the 4th Industrial Evolution will lead to is a fusion of our physical, our digital, and our biological identities. – Klaus Schwab, The Fourth Industrial Revolution – Founder & Executive Chairman of the World Economic Forum, International Organization for Public-Private Cooperation.
A One World Order by another name is…
The Transhumanist Agenda
The Transhumanist agenda is more than just Artificial Intelligence (AI), self-driving cares, robots taking over American jobs, or transgender restrooms at public facilities to accommodate uniformity among the masses.
Transhumanism is Posthumanism. It is humanism with the optimism taken out. A movement that advocates for the transformation and the “advancement of humanity through technology” that merges humans and machines. Transhumanism runs the gamut from nanotechnology to A.I. This paradigm is not limited to gadgets and medicine but also molds social, economic, cultural, institutional design, language, and the psyche.
Transhumanism is a reality of a perfect “controllable race.” This human race began taking shape in the 1930s under Social Engineers like Edward Bernays who believed that the conscious manipulation of the habits and opinions of the masses is the central feature of a democratic society.
Bernays’ book Propaganda revealed the method of mind control for anyone curious enough to pay attention:
The conscious and intelligent manipulation of the organized habits and opinions of the masses is an important element in democratic society.
Those who manipulate this unseen mechanism of society constitute an invisible government which is the true ruling power of our country. …We are governed, our minds are molded, our tastes formed, our ideas suggested, largely by men we have never heard of.
This is a logical result of the way in which our democratic society is organized. Vast numbers of human beings must cooperate in this manner if they are to live together as a smoothly functioning society.…
In almost every act of our daily lives, whether in the sphere of politics or business, in our social conduct or our ethical thinking, we are dominated by the relatively small number of persons…who understand the mental processes and social patterns of the masses.
It is they who pull the wires which control the public mind.
~ Edward L. Bernays, Master Propagandist
Technocracy is The New Democracy. Why else are democratic governors and legislators changing behavior and opinion through mandates for democrats to obediently fall in line to support them?
Social Engineers have manipulated people/masses through fiction (i.e., Brave New World), non-fiction, film, media, the educational system, politics, religion, sports, Hollywood celebrities, and rigged elections throughout the centuries. And each time people/masses have consented through their silent acquiescence and participation.
Brave New World
Aldous Huxley’s novel Brave New World predicted a world of bio and social engineering controlled by the intellectual elite, of which Huxley was a member. Huxley described a future that had already begun to take shape under his pen. To grasp the Huxleyesque nature of current culture we only need to look at what he predicted: Listen to his 30-minute speech here:
There will be, in the next generation or so, a pharmacological method of making people love their servitude, and producing dictatorship without tears, so to speak, producing a kind of painless concentration camp for entire societies, so that people will in fact have their liberties taken away from them, but will rather enjoy it, because they will be distracted from any desire to rebel by propaganda or brainwashing, or brainwashing enhanced by pharmacological methods. And this seems to be the final revolution ~ Aldous Huxley, 1961
. . .we are in process of developing a whole series of techniques which will enable the controlling oligarchy who have always existed and presumably will always exist to get people to love their servitude. This is the, it seems to me, the ultimate in malevolent revolutions shall we say, and this is a problem which has interested me many years and about which I wrote thirty years ago, a fable, Brave New World, which is an account of society making use of all the devices available and some of the devices which I imagined to be possible making use of them in order to, first of all, to standardize the population, to iron out inconvenient human differences, to create, to say, mass produced models of human beings arranged in some sort of scientific caste system. Since then, I have continued to be extremely interested in this problem and I have noticed with increasing dismay a number of the predictions which were purely fantastic when I made them thirty years ago have come true or seem in process of coming true.
Transhumanism is mind control to shift perception to a hybrid society. As perception shifts, the individual is homogenized into an amorphous “public persona.” The term “Public Health” is a public relations term, created in 1913 by the Rockefeller Institute of Medical Research (RIMR), to convince individuals to give up their identity to an outside, unseen authority.
Inversion Reality
Transhumanism is Inversion Reality to create order out of chaos, where up is down, black is white, sickness is health, male is female, abnormal is normal, and uniformity is unity.
The Transhumanist Movement has been playing out before our eyes under the deception of politics and Hollywood make-up and glamour for more than a century. Transgendered actors have been ‘coming out’ to be recognized as non-gendered. Caitlyn Jenner is a role model for the right to reshape and choose a different identify. These are influencers. However, what happens when true identity is concealed and used for deception?
How many Hollywood actors, mainstream news anchors, super models, leaders and politicians are disguised behind wigs, false eyelashes, or beards to create The Great Deception? What deeper meaning rests behind celebrity worship, the golden idols actors give themselves, or the pentagrams they bow down to on the Hollywood Walk of Fame?
People have been measuring themselves against a standard of beauty and worth based in illusion. Does Hollywood entertainment and its teachings go back to the Freemasons? Back to Babylon and the Sodomites? To the Primordial Man? Have actors been mocking their audiences openly as when Stephen Colbert offered a display on national TV in 2006?
Good Evening Godless Sodomites… …It warps The Minds of Our Children and Weakens The Resolve of Our Allies… By Giving You a Golden Idol To Worship… KNEEL BEFORE YOUR GOD, BABYLON! ~ Stephen Colbert, 2006 Emmy Awards
The Transhumanist-Posthuman agenda is not about the equality of the sexes since the sexes are meant to merge into an androgynous blob. Under the Trans Agenda, an era of social and ecologic inequities are the new standard where nature is unnecessary and human relationships are replaced by sexbots that cook, clean, converse (or not), and provide for physical needs.
The deeper agenda is to weaken the male energy as “protector and defender,” subvert the female essence, and neutralize the divine through technologies such as CRISPR. CRISPR genetically modifies DNA to redesign gender at the level of the human embryo to create an androgyne that cannot reproduce. What if this technology has been seeded in vaccines that has changed the DNA of a whole generation? What if the new genetically modified mRNA COVID vaccine not only changes DNA, but acts as an infertility drug in the same jab?
The Transhumanist agenda offers a radical downgrade of humanity. It suggests we are entering a virtual reality without a discussion of morals or spiritual matters, where we can transcend our biological limitations with implants and injections. Do we extend life, prevent death, or bring the dead back to life even if life is no longer worth living? Are we suddenly convinced that vampires are sexy, and adrenochrome is the latest energy drink? Why else is the BBC writing about blood drinkers?
Do we leave the light behind because the darkness brings a different type of eternity? Do we accept that the Transgender agenda has infiltrated the classroom to indoctrinate children in Kindergarten?
In agreeing to the Trans Agenda, it is important to know the risks and the consequences of accepting a program that was set into motion many decades ago by an elite class. The program to introduce new technology in the 1990s promised to feed the world with genetically-modified foods (GMOS). In 2000, it became the technology of electro-magnetic frequencies EMFs “to download movies faster.” When GMO foods were not enough to feed the world, the message shifted to change behavior. “For every flu shot given at our Pharmacy or The Little Clinic, we’ll donate a meal to Feeding America.”
The message of the Transhumanist Agenda will declare that humanity will go extinct or permanently destroy itself unless Transhumanistic technologies are accepted. Are the adverse health effects of GMOs, EMFs, and vaccine technologies the real reason humans need to find new ways to preserve themselves? Has our participation led us to this point?
Humanity appears to be repeating a process that led to extinction once before, in Atlantis. History wrote that the Golden Age, the Silver Age, the Bronze Age ended at the hand of an “angry god” who destroyed the world because “humans” went astray. Humanity is again at the end of an Age; The Iron Age. Do humans accept the “angry god” story again and follow along with the plan that is laid out?
Post-human World
While you’ll feel compelled to charge forward it’s often a gentle step back that will reveal to you where you are and what you truly seek. ~ Rasheed Ogunlaru
The survival of a Transhumanist world happens at the expense of humans.
The liabilities are unknown. Does the soul remain intact? Can a Posthuman being with increased life expectancy, intelligence, health, and memory cease to exist on a spiritual level?
There is an elite class that exists, from all walks of life, that includes doctors, bankers, lawyers, police, judges, researchers, military, congressmen, senators, groomed for their position. They travel in exclusive circles and are part of prominent, old families that may sacrifice more than their soul to worship an androgynous god. Listen to a 2017 interview with a whistleblower reveal an agenda that could lead to martial law.
Policy guidance, that is not law, is being written by a hidden hand to forge a Brave New Global World. What happens next depends on our mutual cooperation. Those who follow a Trans religion have a right to believe what they want, as long as it does not infringe upon another’s rights. And those who choose not to believe? Their rights must be preserved too. Informed-consent means transparency and accountability, which is something that no longer exists.
Reject Technocracy
We are in a critical time in history. However, no one, and no group of politicians, scientists, priests, or actors can succeed in isolating people, suppressing free speech, and subverting human identity without your consent.
Knowing who you are protects you.Living beings are governed by Natural Law. They have rights. If you are a living being, you are not bound by man-made laws without your consent. United States case law from 1796 that still stands today says:
It is not a rule binding upon mankind in their natural state. There, every man is independent of all laws, except those prescribed by nature. He is not bound by any institutions formed by his fellowmen without his consent.” CRUDEN v. NEALE, 2 N.C. 338 (1796) 2 S.E. 70.
Man-made laws, or statutes, or mandates, apply only to “persons” or “legal entities/fictions.”Are you a living being? If so, statutes have no power over you without your consent. However, do not make a claim of who you are without understanding the fundamentals of law or you may incriminate yourself. There is a process to hold your position. For more information on the fundamentals of law, listen to Tom Barnett.
Technology must serve everyone. We must reject Scientism and be ready to say NO when basic freedoms are threatened. It is time to clean house from the ground up starting with our local governments. Are we humans or robots? Do we own our own thoughts and beliefs, or are our minds the property of a global elite?
As Americans, we must take back the language, take back our morality, and reclaim our true identities. We maintain our humanity by connecting to our true selves and connecting to each other. If not, we enter a world where separation of the self is the new normal.
Welcome to the year-end wrap up! You know, the annual end-of-year stock-taking editorial I write before we all go off to enjoy our Christmas and ring in the New Year?
Now, if this were any other year, I’d make some light-hearted joke about all of this. You know, “Oh, nothing much happened this year, there’s really nothing to write about.” Or: “It’s like the opening of A Tale of Two Cities except without the ‘best of times’ bit.”
But this is not any other year. This is 2020. So I’m resorting to quoting Queen Elizardbeast. Remember what she said about 1992?
“In the words of one of my more sympathetic correspondents, it has turned out to be an annus horribilis.”
Queeny was whining about all the scandals and “tragedies” that befell her poor family that year, of course, like her childrens’ philandering being exposed to the world and Her Majesty herself being pelted with eggs by angry Germans and her multi-million pound castle catching fire.
I’ll cue the world’s smallest violin as you wipe the tears from your eyes.
But here we are nearly 30 years later and this is our “annus horribilis.” As we gather here electronically, millions of people have had their lives thrown into chaos by a scamdemic long in the making. Families have been torn apart. Mom-and-pop business owners have had their life’s work taken away from them. The poorest of the poor have been thrown into even further grinding poverty. Suicides and deaths of despair are on the rise as we enter the biosecurity paradigm and prepare for a new normal of social distancing and mask wearing and lockdowns and misery. And all of this in the name of a disease that even the lying public health officials acknowledge as being harmless to almost the entirety of the population.
This is what a real annus horribilis looks like. So you’ll forgive me if I don’t feel particularly jokey this year.
Yes, 2020 is just about over and, barring the opening of the portal to Hades or whatever is supposed to happen during the coming Grand Conjunction, we’ve made it through to the other side. But what lies there? What event are we living through, and where do we go from here?
To answer that, let’s step back for a bit.
I started The Corbett Report in 2007. As you might imagine, I’ve had cause over the years to wonder how I would have responded if I had been “on air” during 9/11. Well, now I know. And I am pleased to say that I can not only stand behind the work I’ve done this year, but I am confident that I have contributed reports that will be even more relevant years from now than they are today.
Don’t get me wrong: all of that work is important and is destined to become even more important as we are ushered further into the era of Biosecurity and I stand by it 100%. But in the end, I think that all of the work debunking the statistics and numbers and lies of the COVID hysteria miss the most fundamental point about this new era we have entered, a point that I articulated in one of my earliest pieces on the hysteria.
We have been asked to accept that “public health” is not just everyone’s responsibility in some abstract way, but their actual legal obligation. And who gets to decide what “public health” is? Why, the technocrats of the public health industry who just happen to sit on the boards of the Big Pharma companies and receive copious funding from the Bill & Melinda Gates Foundation, the Wellcome Trust, Gavi, and their fellow travelers in the field of “philanthropy.”
And remember: We’re All In This Together so let’s Stay Together Apart so we can Build Back Better toward the Great Reset. And if you mouth those platitudes and believe them then you’re a good citizen, and if you hesitate for a moment to bleat those phrases along with the herd you will be singled out as a crazed conspiracy theorist and censored from the internet.
And suddenly this “conspiracy theorizing” and documenting that I’ve been engaged in for the past 13 years isn’t so abstract anymore. It’s hard to separate yourself from the machinations of the Bilderberg jetset when they have half the human population under lockdown and are rolling out an experimental vaccine on more or less the whole globe.
If you’re not in mourning for human freedom after the events of this year, then you never really knew what this was about. This is what motivated me to write one of the most powerful epistles of my life this year, my Letter to the Future:
Yes, it’s hard to think of 2020 as anything but an annus horribilis for free humanity.
But, as crazy as it may seem, there is something I’m grateful for this year. At least the power-hungry psychopath eugenicists have stated their intentions openly. Take good old Technofascist Overlord Klaus Schwab himself: “At the end, what the Fourth Industrial Revolution will lead to is a fusion of our physical, digital and biological identity.” No pussyfooting around anymore; they’re outright telling us that they’re pushing for the full-on transhuman nightmare future. A future which (in case you didn’t get the memo) doesn’t need us.
In a sense, none of what has occurred this year should be surprising. I’ve been documenting the eugenicists’ plans to implement martial law, erect the ID control grid, transition us into a cashless society, and, ultimately, cull the human population, for a very long time.
No, it is not surprising that they decided to pull the trigger in 2020. It’s only surprising that so many have gone along with the charade.
It would be so easy to give in to the hate. To become cynical. To deride our fellow men as sheeple. To throw up our hands and say the fight isn’t worth it.
But if we do that, the psychopaths have won without even having to fight. Their ultimate victory lies in demoralizing us. They win by making us forfeit our humanity of our own free will.
I refuse.
It may not be trendy, it may not capture the zeitgeist, it may not earn me any street cred or “cool” points, but let me reaffirm that age-old Yuletide declaration: δόξα ἐν ὑψίστοις θεῷ καὶ ἐπὶ γῆς εἰρήνη ἐν ἀνθρώποις εὐδοκίας.
Peace on earth and good will toward men, indeed. We’re going to need it.
Merry Christmas, everyone. Get ready for 2021.
This weekly editorial is part of The Corbett Report Subscriber newsletter.
To support The Corbett Report and to access the full newsletter, please sign up to become a member of the website.
There Is No Covid Health Crisis and There Is No Virus Pandemic: There Is Only Long-Planned Orchestrated Tyranny
The only way to deal with an unfree world is to become so absolutely free that your very existence is an act of rebellion.” ~ Albert Camus
While loyalty to self and truth is not slavery, allegiance to any country, government, or ruling class is slavery. Inherent in this thinking is the fact that believing or trusting any ruling individual or entity without absolute verification at every level, is the basis for societal destruction at the hands of the few due to blind obedience to falsely claimed authority. Lies and deceit are the tools of tyrants, and come in the forms of outright deception to manipulative propaganda. These traits are always evident, but today they are completely overt, as lies and truth are both used in devious ways in order to gain compliance and control.
This can be seen in that a non-existent virus pandemic has been used to instill great fear in the unsuspecting minds of the masses to such an extent, that most have been willing to give up all normalcy and sanity in their lives and the lives of their families. They have due to false trust been duped into behavior that can only be described as psychotic in nature. This has led to voluntary self-imprisonment, isolation, business and job destruction, mask wearing, travel immobilization, and total lockdowns. It has led to greater sickness, death, and economic devastation as well, all in the name of ‘health security’ and obedience to power at the expense of all freedom. This should serve as the final valuable lesson learned by even the most common of men, because it should be obvious that relying on the state in any capacity whatsoever can only lead to an enslaved society dependent on a master class for its very existence and survival. This of course is what is sought; a communistic based technocratic ‘civilization’ controlled by the few.
Everything that happens with governments and the entire state apparatus is planned in advance. Nothing concerning the ruling class is organic or natural in any way. All action and reaction to any event by the government and its controllers is by design. Most everything that happens has been foretold or predicted by the state oligarchic perpetrators. This is usually done by very deceptive means meant either to create a false crisis, or to use indoctrination methods in order to plant in the minds of the people what to expect from some imagined future adversary or terrifying event that has already been devised or created. These tactics of course are psychological in nature, but if the psyche of the majority can be captured to such an extent as to cause the proper desired reaction, then they can be easily controlled. In a world of logic and reason, this current situation should serve as definitive proof of this hypothesis, but sadly, I doubt that any such mass revelation by the people at large will be forthcoming. I base this on Einstein’s statement that doing the same thing over and over again while expecting a different outcome is insanity. This seems to sum up the mentality of the American herd.
This analysis can be supported easily by history, and that may be part of the reason that our real history is being hidden and destroyed every single day at this juncture. This is happening through censorship of course, but also through the physical destruction of historical records including books, the closing off of access to original sources, and elimination of important factual information in every form imaginable.
This current hoax is nothing new, as similar events have happened before, and have been played out over and over again in real life and in staged table top exercises meant to condition the public for future planned actual incidents. This was a way to set up, to promote, and to prepare the public for events that could be used to alter society and change the common mindset from one of individual liberty to one of collective compliance. Of course, this change began very long ago, but it has escalated beyond imagination over the past two decades, and in this past year alone, the idea of a society based on total voluntary servitude has seemingly come to fruition. It is all a set up!
In 2001, an exercise called “Dark Winter,” a favored term of Joe Biden about our current situation, was set up by Johns Hopkins and others to simulate a covert smallpox attack on the U.S., and to see what a government response might look like under those circumstances.
In 2005, “Atlantic Storm,” was organized by the Center for Biosecurity at the University of Pittsburgh Medical Center. This was a simulation about an international smallpox outbreak that turned into a pandemic.
In 2010, a Rockefeller Foundation paper called Lock Step, analyzed a scenario as to how governments would respond with authoritarian measures to react to a worldwide flu pandemic. This is very similar to what is happening today. “During the pandemic, national leaders around the world flexed their authority and imposed airtight rules and restrictions, from the mandatory wearing of face masks to body-temperature checks at the entries to communal spaces like train stations and supermarkets.”
In 2017, a novel coronavirus outbreak was simulated in Minnesota. This exercise was called “The SPARS Pandemic 2025-2028,” and comprised a futuristic scenario that illustrated communication dilemmas concerning medical countermeasures (MCMs) that could plausibly emerge in the not-so-distant future.
The next exercise in August of 2019 was a Trump administration and Health and Human Services major exercise called Crimson Contagion. This simulation was almost identical to the Covid-19 plot today. “It tried to model what would happen if an influenza pandemic that started in China spread through the U.S. with no treatment, leaving 7.7 million Americans hospitalized and 586,000 dead.”
The last exercise that took place was the evil Gates Foundation Event 201 in October of 2019. This was nearly an exact replica of what has happened this past year concerning the response to this fraudulent virus pandemic. The fact that the Gates foundation along with Johns Hopkins were involved in this set-up to prepare the sheep, is damning at every level, and exposes that all government tyranny is planned in advance, and telegraphed in order to condition the public.
What all these simulations, and many others, have in common is that the promoters and preparers of these events all claim to have no foreknowledge of any real future like situations, and allege that these are only done so as to be prepared to help the lowly proletariat in case of some biowarfare or health emergency. This is an outright lie. They are never prepared to stop any risk, but are always prepared to use it in order to gain power and control over humanity. The government and its partners in crime create and publically announce these simulations for the specific purpose of psychological preparedness training of the common people. It is no different than any propaganda campaign that is based on implanting ideas in the minds of its victims through projection and repetition.
It cannot be overstated that every act of government, its controllers, and its partners, is never accidental, or caused by unknown factors; it is always plotted and planned in order to benefit the ruling class. Every claimed emergency, whether national or state, is known about beforehand, and any response will be specifically generated to first benefit the oligarchy. This is true even in the case of natural disasters, as all preparedness first helps those insider entities that stand to gain from disaster.
This specific and purposely-manufactured virus ‘pandemic’ has been in the works for almost twenty years, and situations like this have been discussed for decades by the controlling ‘elites’ and their pawns in government. Because of this, all should understand that this is not over, and will never end without a large and sustained uprising by the citizenry. The escalation of extreme tyrannical measures is only going to dramatically increase in the coming year. Once this ludicrous presidential selection process ends in January, the political class will be completely free to pursue its globalist agendas without restriction. Those agendas, if allowed to go forward, will be the most devastating and draconian that we have ever faced.
The chosen masters that you have voluntarily allowed to rule over you have intentionally created this crisis, and are fully prepared to use it to destroy your life and family. You have suffered for almost a year, and this is only the beginning. The state’s agenda is crystal clear; propaganda is their weapon of choice, and total submission is their goal. Are you prepared to stop them by whatever means necessary, or will you comply and become slaves. Those are the only choices left!
First of all, very high praise goes to Christine Massey, for her work in exposing the coronavirus fraud. In a half-sane world, she would have received many awards by now.
Her latest communication reads: “Freedom of Information reveals Public Health Agency of Canada has no record of ‘SARS-COV-2’ isolation performed by anyone, anywhere, ever” [1]
I urge readers to visit Massey’s site and read her new article and follow all the links. Her findings are stunning. She and her team have made about 40 FOI requests to public health agencies in various countries, requesting proof that SARS-CoV-2 has been isolated. You’ll see from the responses that not one agency has records demonstrating isolation.
This means exactly what it seems to mean: the virus has not been proven to exist.
As for the people who keep chanting that the virus has been isolated, I can keep explaining why this is not so. I can do this forever. [2] [3]
Whether it’s a scientist, a gaggle of scientists, a government official, a person waving a study around like a newspaper with a hot headline from an old movie, my response is the same, and I make it knowing that some people will intentionally refuse to understand it:
ONE: SAYING the virus has been isolated is not the same thing as proving it’s been isolated.
TWO: Researchers routinely twist the meaning of the word “isolated” to mean its very opposite.
Isolation is absurdly taken to mean: “We have the virus in a soup in a dish in the lab. It is not separated out (isolated) from the soup. The soup contains various cells—human, monkey—and an array of (toxic) chemicals and drugs. We know the virus is there, because it is infecting and killing some of the cells.”
A reasonably bright junior high school student would immediately realize this is not a description of isolation.
A reasonably bright high school student would point out that there is no proof the virus is infecting and killing cells, because the toxic chemicals and drugs in the soup are sufficient to do the cell-killing. He might also mention the cells in the soup are being starved of nutrients, and this alone could cause their death.
Therefore, there is no evidence that “the virus” is actually in the soup.
Therefore, there is no evidence in this situation for claiming the virus exists at all.
On to the next factor: the ever-present claims of having “sequenced the genetic structure of the virus.” Again, SAYING the sequencing has been achieved is not the same thing as proving it.
And proving it is impossible, if you don’t already have the virus in a purified and isolated state. Instead of proof, you have shady inference and assumption and guesswork and deception.
How can you sequence something you don’t have? You can’t.
I’ve used several analogies to explain this nonsense. Here is another one:
An art restorer, conservationist, and historian is called to the home of a well-known mob enforcer.
The enforcer tells him he has something to show him in the attic. On the way, they pass through the living room, where several open suitcases are sitting on the floor. They’re spilling over with stacks of cash. Automatic weapons and boxes of ammo are laid out on a long table. In an open closet, the art expert sees a row of jackets with designations indicating: FBI, BATF, Federal Marshal, sheriff, local police.
In the attic, the mob enforcer points to a small pile of tiny chips on the floor.
“These are from a lost Rembrandt self-portrait,” he says. “Collect them, go to work on them, give me a favorable report. Or else.”
Back in his lab, the obedient art expert quickly divides the chips into three groups. The first group is water-color chips from a child’s toy set. The second group is mid-20th-century acrylic chips. The third group is lead white chips, used for a hundred years on either side of the rough date when Rembrandt could have painted the lost self-portrait.
The art expert finds that Rembrandt (and hundreds of other painters) used this general type of lead white.
The expert constructs, from other scholars’ work, an essay claiming there was and is a lost Rembrandt self-portrait. He excludes commentary that denies the existence of this painting.
He “sequences” all this information and conjecture and guesswork (and con) into a convincing report, which points to the small pile of chips in the mob enforcer’s attic.
(It turns out the enforcer intends to accuse a rival mob boss of stealing the “lost Rembrandt self-portrait.”)
The existence of the self-portrait is thus “established,” which is to say, it is put together, cobbled from various sources, concocted, smoothed out by ignoring counter-information—employing a vast generality about lead white paint.
Of course, in all this ridiculous invention, the self-portrait itself is not there, it is not in hand, its existence has not been demonstrated, it is a story, THERE IS NO ISOLATION OF IT from surrounding assumption and gimcrackery.
So it is with SARS-CoV-2. Pieces of data that reference prior supposed RNA sequences in libraries are all strung together, to resemble what is claimed to be a new and unique coronavirus—without having the actual virus, without having shown it exists at all.
In past articles, I’ve quoted two key documents, one from the CDC, and one from “the Drosten group.” These documents were describing how to perform the PCR test for the new virus—and in both documents, the authors state they don’t have the virus.
So…a test for what? The virus you don’t have.
All claims that these authors eventually DID obtain the virus are based on the crooked definition of “isolated” I’ve explained above.
Yes, they got hold of “isolated virus,” meaning the soup in the dish in the lab—and we’re back where we began. Isolation meaning non-isolation.
I’ve explained all this several times, in detail, in past articles, and of course people here and there continue to send me studies claiming isolation.
I can do this forever.
People can say, “Well, we know from photos of Martian soil samples that on the second Tuesday in March, 1843, there was a picnic on Mars attended by three virologists from the Martian Institute of Epidemiology, and they ate baloney sandwiches on rye toast and drank Miller Lite.”
I enjoy these fictional tales in a vacuum. I would leave them alone, except that the failure to prove the existence of SARS-Cov-2 is at the bottom of all the lies that have been used to steal the freedom and assets and livelihoods from at least a billion people.
I won’t leave that alone.
Neither should you.
“…but wait, Mr. Rappoport, here is a study from Outer Mongolia that states the virus has been isolated. This seems to settle the science on this issue, once and for all.”
Sure. Sure it does. And the sun sets every day at noon in Cincinnati.
[As a service to protect truth from censorship & to share widely, mirrored copies of this video are available at Truth Comes to Light BitChute, Brighteon, Lbry/Odysee channels. All credit, along with our sincere thanks, goes to the original source of this video. Please follow links provided to support their work.]
For those of you who have been following my work concerning COVID-19, you know that the entire foundation of the story of the virus rests on whether the novel “corona virus” has been properly isolated and its entire genome characterized. Many of you have sent papers to me that have been published in prestigious peer-reviewed journals that claim to have isolated and characterized this new virus. They are all incorrect.
In fact, the original Corman-Drosten et al paper on which this edifice of viral causation is based states that they used an “in silico” genome of an “in silico” virus. “In silico” is Latin for “theoretical.” In common English, synonyms for theoretical are “imaginary” or “make-believe.”
The CDC in its July 2020 monograph states “no quantified isolated of the 2019-nCov are available.” Again, in simple English, this means they have no examples of an isolated virus in their possession. In Freedom of Information requests, the Canadian health ministry, the Australian health ministry and the governments of many Commonwealth countries admit that they do not possess any studies that show the isolation of this purported virus.
In this interview, and hopefully for the final time, Jon Rappaport and I describe in common language and precise detail the steps that are needed to properly isolate and characterize a virus. We did this so we could empower our readers and listeners to know for themselves how to read and identify fraudulent science. Among the many challenges we face, one is the rampant scientific illiteracy. In some ages this may not have been relevant, but if we are going to live in an era in which “science” is the new religion and its tenets control our lives, we had better understand what its unquestioned “priests” are saying.
I can tell you, the more I look into what passes for “science,” the more I see how rotten it is to the core. If we are to have a new “religion,” let’s have one of truth, freedom, justice and the sense of wonder and awe at the phenomena of life. Let us celebrate what it means to be a human being endowed with a free spirit in a loving relationship with the mystery that is our world. Please join me in this interview.
CNN has the story. And it’s quite a story: “Why vaccinate our most frail? Odd vote out shows the dilemma”, December 4. [1]
“The vote to recommend long-term care residents be among the first to receive Covid-19 vaccinations was not unanimous.”
“Out of a panel of 14 CDC vaccine advisers, a lone doctor said no.”
“’Odd woman out, I guess,’ Dr. Helen ‘Keipp’ Talbot, of Vanderbilt University, told her colleagues. ‘I still struggle with this. This was not an easy vote’.”
“Talbot was worried about whether the vaccine would even work in such frail, vulnerable patients. Even more, she worried about how it might look if the vaccine failed in that group, or how it would affect public perception if residents died soon after getting the vaccine.”
“The Covid-19 vaccines have not been tested in the frail elderly, many of whom are residents of long-term care facilities.”
Let’s stop here for a moment. First, we learn that the clinical trials of the COVID vaccine have not used the frail and elderly as volunteers. Therefore, there is NO evidence that the vaccine is safe or effective in that very large group. If this doesn’t give the frail and elderly and their families pause for thought, nothing will.
Second, Dr. Talbot is worried about “public perception,” when the elderly die right after getting the vaccination.
Well, what would YOU think if your mother died the day after she received the COVID shot?
The CNN article gets worse. Read on. Next up is a comment from Dr. Kelly Moore, “associate director of the Immunization Action Coalition, which is supporting frontline workers who will administer Covid-19 vaccinations.”
“’Since they [the COVID vaccines] haven’t been studied in people in those [elderly] populations, we don’t know how well the vaccine will work for them. We know that most vaccines don’t work nearly as well in a frail elderly person as they would in someone who is fit and vigorous, even if they happen to be the same age,’ Moore said.”
Again—zero evidence the COVID vaccines work in elderly and frail populations. Most vaccines don’t “work nearly as well.”
CNN: “When shots begin to go into arms of [nursing home and long-term care facility] residents, Moore said Americans need to understand that deaths may occur that won’t necessarily have anything to do with the vaccine.”
“’We would not at all be surprised to see, coincidentally, vaccination happening and then having someone pass away a short time after they receive a vaccine, not because it has anything to do with the vaccination but just because that’s the place where people at the end of their lives reside,’ Moore said.”
“’One of the things we want to make sure people understand is that they should not be unnecessarily alarmed if there are reports, once we start vaccinating, of someone or multiple people dying within a day or two of their vaccination who are residents of a long-term care facility. That would be something we would expect, as a normal occurrence, because people die frequently in nursing homes’.”
Right. Don’t be alarmed.
Don’t worry if people who are doing reasonably well suddenly die right after getting the COVID shot. It’s just a coincidence.
Their long-term health conditions just happened to kick in a day or two after vaccination. Nothing to wonder about.
Don’t kick up a fuss if it’s YOUR father or mother who died. Stay calm. You can be sure the doctors will let you know if your mother died from the vaccine. Of course they will.
Even though the vaccine has never been tested on the elderly and frail, the doctors know whether a death occurred from the vaccination or from other causes. And they’ll tell the truth. They always do.
The doctors quoted in this CNN article are obviously worried about people dying as a result of the vaccine. They know it’s going to happen. They’re thinking out loud about what they can do to stem the tide of public outrage—particularly from the families of those who die.
The best idea they can come up with is: “these people die anyway.”
I remind readers that, for months, I’ve been reporting on the huge percentage of all so-called COVID deaths that have been occurring among the elderly in nursing homes, in long-term care facilities, in hospitals, in their homes. [2]
These people were already suffering from multiple long-term serious health conditions. On top of that, they had been treated for years with an array of toxic medical drugs.
And then, they’re absolutely terrified when they receive a diagnosis of COVID. Then they’re isolated, cut off from family and friends.
And they give up and die.
NO VIRUS IS REQUIRED TO EXPLAIN THESE DEATHS.
This is forced premature killing of old people. It’s murder by COVID diagnosis and isolation. [2]
And now, these people will receive an experimental RNA vaccine, whose effects include auto-immune reactions; the body basically attacks itself. [3]
More killing.
And doctors advising the CDC are telling us not to be alarmed.
The deaths are just routine.
Lots and lots of doctors who know what’s going on are thinking, “What if all this comes back on ME?”
Well, it IS coming back on you, Doctors.
You’re killers in white coats who are supposed to be saving lives.
Available at Press for Truth Lbry and BitChute channels.
Informed Consent is the newest film by Jamie Icke that exposes the dangers associated with taking a vaccine.
A global inoculation rollout is currently underway with a rushed Pfizer vaccine that has already proven to be dangerous yet scores of people are willingly lining up to take the experimental jab simply because they are watching far too much mainstream news on the television.
In this video Dan Dicks of Press For Truth speaks with Jaymie Icke about his newest film “Informed Consent” and the balance he hopes to bring to the minds of the masses so that they can truly make an informed decision when it comes to accepting the Covid-19(84) vaccine.
An article by Children’s Health Defense on how the pandemic facilitated a financial, tech, biopharmaceutical and military-intelligence push for centralized, technocratic control has been accepted by the International Journal of Vaccine Theory, Practice and Research.
“Planned Surveillance and Control by Global Technocrats: A Big-Picture Look at the Current Pandemic Beneficiaries,” a peer-reviewed article by Children’s Health Defense, has been accepted for publication in the journal, International Journal of Vaccine Theory, Practice and Research. The journal was launched in 2020 by John W. Oller, Jr., Ph.D. (editor-in-chief) and Christopher A. Shaw, Ph.D. (senior editor) “to make independent research, free from constraints of monetary, political, or any other undisclosed influence, about vaccine theory and practice freely accessible.”
The Children’s Health Defense article, which will appear in the journal by year’s end, assesses how the pandemic has facilitated a financial, tech, biopharmaceutical and military-intelligence push for centralized, technocratic control.
Here’s the article:
Abstract
Global financial patterns and pronouncements point to a seismic overhaul of governance and financial systems that is playing out beneath the surface of the Covid-19 pandemic, reaching far beyond the health domain. Increased centralized control has the potential to create an unbridgeable chasm between a tiny handful of winners and a majority of losers. To foster an integrated analysis of the technocratic and financial forces and agendas at play, this rapid review identifies some of the pandemic’s principal beneficiaries across the interwoven financial, tech, biopharmaceutical, and military-intelligence sectors, assessing developments in the context of the accelerating global push for technocratic consolidation and control. The evidence suggests that Trojan horse coronavirus vaccines may challenge bodily integrity and informed consent in entirely new ways, transporting invasive technologies into people’s brains and bodies. Technologies such as brain-machine interfaces, digital identity tracking devices, and cryptocurrency-compatible chips would contribute to the central banking goal of replacing currencies with digital transaction and identification systems and creating a global control grid that connects the world population to the military-pharma-intelligence cloud of the global technocrats. Moreover, using vaccines as a delivery vehicle for surveillance technologies cancels any legal liability.
Keywords: Biopharmaceuticals; central banks; Covid-19 pandemic; digital identity; Operation Warp Speed; technocracy; vaccines
Introduction
On March 11, 2020, the World Health Organization (WHO) upgraded a reportedly novel coronavirus from a global health emergency (as of January 30) to a global pandemic, having given the name “Covid-19” to the newly minted disease associated with the virus (Forster, 2020; World Health Organization, 2020a). If one examines actions taken both before and since the WHO’s March decree, it seems evident that many highly placed individuals and sectors were able to strategically position themselves to benefit from the declared crisis (Children’s Health Defense, 2020b). At the same time, with a “new form of economic shock” being imposed worldwide under cover of Covid-19 (Lagarde, 2020), it has become apparent that old-fashioned corporate profiteering is far from the whole story.
In fact, global financial patterns and pronouncements point to a seismic overhaul of governance and financial systems that is playing out beneath the surface of the pandemic, reaching far beyond the health domain. These developments highlight a disturbing push for global technocracy — a form of centralized, expert-led control over resource production and consumption that the Wall Street Journal has characterized as “anti-democratic rule by elites who think they know better” (Wood, 2018, 2020; Fitts, 2020a; Schinder, 2020; Schumacher, 2020; White, 2020). In the U.S., many of the actions unfolding behind the scenes are also benefiting from a climate of institutionalized secrecy enabled by the October 2018 adoption of a game-changing policy statement (FASAB Statement 56), which turned financial disclosure rules upside-down to allow the U.S. government and its contractors to maintain secret books (Federal Accounting Standards Advisory Board, 2018; Ferri & Lurie, 2018).
As 2020’s rapid-fire events suggest, substantially increased centralized control and secrecy have the potential to create an unbridgeable chasm between a tiny handful of elite winners and a majority of upper and lower middle class losers. In early June, CNBC’s Wall Street analyst Jim Cramer heatedly pointed out the fact that the pandemic had already produced “one of the greatest wealth transfers in history” (Clifford, 2020). Others have echoed these observations, describing the “monumental transfer of wealth from the bottom of the economic ladder to the top” (Barnett, 2020; Kampf-Lassin, 2020). In comparison to the benefits flowing to large corporations and billionaires, Cramer bluntly observed that pandemic-related restrictions have had a “horrible effect” on America’s small-business economy, with a similar pattern on display outside the U.S. (Clifford, 2020). Even the World Economic Forum — which has promoted many of the structural changes now underway at its annual Davos meetings — acknowledges the “asymmetric nature” of Covid-19-related hardships and the “greater ferocity and velocity” of the pandemic’s impact on populations already under stress before 2020 (World Economic Forum, 2020).
By early fall, fifty million Americans (many with already high burdens of debt) had lost jobs; financial forecasters were issuing warnings about further layoffs; and millions of the still-employed were earning less than pre-pandemic (Andriotis, 2020). In addition, the bulk of the trillions in federal stimulus (which by early May exceeded the gross domestic product of all but six nations worldwide) had made its way to large corporations; Forbes reported that roughly 70 percent of the initial $350 billion intended for struggling small businesses went to large companies (Simon, 2020). Observers suggest that by channeling taxpayer bailouts to the companies that already had the greatest ability to withstand the shutdowns, the largest players have been able to gain even more of a “stranglehold” over the economy (Kampf-Lassin, 2020).
As U.S. billionaires’ wealth increased by almost a trillion dollars (a weekly average of $42 billion), weekly jobless claims, requests for food bank assistance, and reports of addiction, overdoses, depression, and suicide began “shatter[ing] all historical records” (Feeding America, n.d.; Alcorn, 2020; Americans for Tax Fairness, 2020; Baldor & Burns, 2020; Community FoodBank of New Jersey, 2020; Dubey et al., 2020; Ettman et al., 2020; Hollyfield, 2020; Lerma, 2020; Prestigiacomo, 2020; Schwarz, 2020; Sergent et al., 2020; Thorbecke, 2020; Wan & Long, 2020). Outside the U.S., the situation is similar (Bueno-Notivol et al., 2020). As a marker of the global surge in hunger, the Nobel Committee awarded its 2020 Peace Prize to the World Food Programme, prompting the agency’s head to warn that the world is “on the brink of a hunger pandemic” that could result in “famines of biblical proportions” in the coming year (Lederer, 2020).
In November, the Centers for Disease Control and Prevention (CDC) released data identifying over 100,000 excess U.S. deaths “indirectly” associated with the pandemic (Rossen et al., 2020), including a “stunning 26.5% jump” in excess deaths in young adults in their mid-twenties through mid-forties (Prestigiacomo, 2020). Commenting on these mortality data — which reflect “a death count well beyond what [researchers] would normally expect” (Preidt, 2020) — the former U.S. Food and Drug Administration (FDA) Commissioner Scott Gottlieb voiced his suspicion that “a good portion of the deaths in that younger cohort were deaths due to despair,” including drug overdoses (Squawk Box, 2020). University researchers writing about mortality in JAMA concurred that “Excess deaths attributed to causes other than COVID-19 could reflect deaths . . . resulting from disruptions produced by the pandemic” (Woolf et al., 2020), including “spillover effects . . . such as delayed medical care, economic hardship or emotional distress” (Preidt, 2020). Multilateral entities like the Organisation for Economic Co-operation and Development (OECD) emphasize that it will be essential to assess the long-term impact of “confinement and deteriorating financial conditions” on mortality and warn that the social and economic fallout is likely to be “significant” (Morgan et al., 2020).
As an ideology, technocracy is recognized for exalting knowledge and expertise as the principal sources of legitimate power and authority and for asserting that there is “one best way” that only “the experts” (e.g., engineers, scientists, and doctors) can determine (Burris, 1989). However, critics of technocracy have long pointed out that, particularly in crisis situations, the know-how, “discretionary interventions” and seemingly “elastic” power claimed by technocrats can end up blurring the line between useful expertise and “arbitrary rule” (White, 2020). Moreover, technocrats typically resist attempts to make explicit “the non-rational attributes of technocratic decision-making” (Burris, 1989).
With the noticeable absence of any cost-benefit analysis and the increasingly “non-rational” justifications being put forth for Covid-19 restrictions (Handley, 2020; Kristen, 2020; Kulldorff et al., 2020; The Reaction Team, 2020) — as well as the economic, political, social, and cultural changes rolling out at dizzying speed — it is important to try to understand the technocratic and financial agendas at play. Three increasingly interwoven sectors (Big Finance, Big Tech, and Big Pharma) are reaping rewards from Covid-19, benefiting from close relationships with the military-intelligence apparatus (Glaser, 2020; Usdin, 2020). This rapid review seeks to (1) identify some of the pandemic’s principal beneficiaries (financial and otherwise) across these sectors, and (2) assess these parties’ actions in the context of the accelerating global push for technocratic consolidation and control through invasive surveillance.
Methods
Rapid reviews are used to synthesize evidence in a streamlined manner, abbreviating the timeline and requirements of more involved systematic reviews (Ganann et al., 2010). A rapid review is particularly well suited to emerging current event sequences, and the dynamic Covid-19-related situation certainly qualifies. Though not exhaustive, rapid reviews make it possible to quickly summarize available evidence across multiple disciplines, whether for the purpose of informing policy-making and decision-making or to identify patterns and take stock of the bigger picture.
For the purposes of this broad overview of current events, we relied primarily on the so-called grey literature as well as media accounts (from both the legacy media and independent journalists) and various online sources. We also consulted relevant peer-reviewed literature. Notably, while the peer-review process is ordinarily slow-moving, Covid-19-related studies have been making their way through the pipeline at breakneck speed (Packer, 2020).
Examples of sources consulted for this review include conventional and alternative financial commentary; webpages and communications from public health agencies, international organizations, and universities; individual blogs and commentary; and peer-reviewed studies cataloguing the impact of Covid-19 restrictions.
Big Finance
Assisted by the media, commentators have had an easy time framing the events of 2020 principally as a health crisis. With each passing month, however, those claims wear thinner (Barnett, 2020). In a comprehensive analysis titled The State of Our Currencies, former U.S. Assistant Secretary of Housing Catherine Austin Fitts (2020a) offers a broader and more instructive interpretation. Informed by close attention to financial patterns, Fitts asserts that the “shock doctrine” measures being imposed under cover of Covid-19 are helping lay the train tracks for a new global central banking machine and a technocratic “regulatory and economic model that permits far greater central control.”
Fitts calls attention to G7 central bankers’ August 2019 approval in Jackson Hole, Wyoming of a plan called “Going Direct” (Bartsch et al., 2019) that makes the case for a novel “blurring [of] the lines between government fiscal policy and central bank monetary policy” (Martens & Martens, 2020). Drafted months before Covid-19, the plan — co-branded by the World Economic Forum (n.d.) as “the Great Reset” — evokes the prospect of a serious economic downturn and “unusual circumstances” that could be used to justify “unprecedented” global measures (Bartsch et al., 2019).
Fitts (2020a) postulates that central bankers have both a short-term aim (to extend the existing dollar-based reserve currency system) and an ambitious longer-term goal: to implement a “new global governance and financial transaction system, and gather the power necessary to herd all parties into the new system”. Characterizing these aspirations as nothing short of ending currency as we know it, Fitts suggests that the top-down digital-currency-based model being promoted as a replacement could end up sidelining traditional intermediaries and instead directly furnish populations with something akin to a “credit at the company store”. Spelling out the implications of such a model, Fitts notes that with the help of digital surveillance and a social credit system, the central-bank-controlled “credit” could easily be “adjusted or turned off on an individual basis”. General Manager Agustín Carstens of the Bank for International Settlements (BIS) — the central bank of central banks — recently acknowledged as much, stating that in stark contrast to cash, a Central Bank Digital Currency (CBDC) would give central banks “absolute control” over CBDC use “and the technology to enforce” CBDC rules and regulations (International Monetary Fund, 2020). With a vaccine-injected digital surveillance program in individuals, the CBDC would have dictatorial power at the level of individual buying and selling.
Fitts’ analysis suggests that central bankers began laying the groundwork for the desired global transition well in advance of the coronavirus mayhem. In 2019 alone, G7 finance ministers endorsed a cryptocurrency action plan in July; in August, the G7 central bankers approved “Going Direct”; in September, the U.S. Federal Reserve (“the Fed”) started making hundreds of billions of dollars in loans “direct” to Wall Street trading houses; and in October, the BIS issued a major report on global cryptocurrencies (Bank for International Settlements, 2019; Helms, 2019; Fitts, 2020a; Martens & Martens, 2020). In the middle of the frenzy of central bank activity in October, the Bill & Melinda Gates Foundation (along with the World Economic Forum and Johns Hopkins Center for Health Security) held the well-publicized “pandemic tabletop exercise” called Event 201, which played out a global coronavirus outbreak scenario strikingly similar to 2020’s actual events (Center for Health Security, n.d.).
In January 2020, U.S. corporations witnessed a record number of CEO departures (Ausick, 2020; Marinova, 2020) — a mass exodus that strategically allowed over 200 departing executives to sell their stock at or near the market high (see Table 1). Other wealthy and influential insiders also engaged in surprisingly well-timed stock market transactions. For example, following a late-January, behind-closed-doors briefing about the virus (which had yet to affect a single American), certain U.S. senators sold hundreds of thousands of dollars of stock, “unloading shares that plummeted in value a month later” (Lane, 2020). The world’s wealthiest person, Amazon CEO Jeff Bezos, sold nearly $4.1 billion over an 11-day period in early February after having also sold $2.8 billion in shares in August 2019 (Palmer, 2020).
Table 1. U.S. CEO Departures in January 2020
Sources: Ausick, 2020; ChallengerGray, 2020
As the U.S. government turned on the stimulus spigot in March, the Fed sustained its irregular intervention in the U.S. economy. By the summer of 2020, the Fed had expanded its balance sheet by $2.9 trillion — much of it unaccounted for, according to Fed-watcher John Titus (2020) — and financial observers were warning that “the market is no longer the biggest factor in selecting [economic] winners and losers” (Whalen, 2020). Titus (2020) concurs with this assessment, baldly characterizing 2020’s events as a Fed-led “coup d’état”. Titus (2014) has been chronicling major financial forces and legal changes since the 2008 financial crisis, describing how central banks are not only able to “loot” the American people “in broad daylight” but can do so without fear of prosecution — probably because, as Titus and Fitts (2020a) both point out, the Department of Justice depends on Fed member banks for its financial operations.
The coronavirus stimulus has provided abundant financial opportunities advantageous to Fed member banks. Over a two-week period in April, for example, large banks earned $10 billion in fees (ranging from 1 to 5 percent) simply for processing the government’s loans to businesses (Sullivan et al., 2020). Class-action lawsuits subsequently alleged that the banks prioritized larger loans (and larger companies) in order to garner the largest fees, while shutting out “tens of thousands” of eligible but smaller businesses (Sullivan et al., 2020). Serving as lender to the parent company of a national restaurant chain, Fed member bank JPMorgan Chase (the largest and most profitable bank in the U.S.) earned a $100,000 fee for a single “one-time transaction for which it assumed no risk and could pass through with fewer requirements than for a regular loan” (Sullivan et al., 2020).
In September, Senator Marco Rubio (Chairman of the Senate Committee on Small Business and Entrepreneurship) wrote to the JPMorgan Chase CEO expressing “alarm” about allegations that JPMorgan employees “may have been involved in potentially illegal conduct” in the distribution of Paycheck Protection Program and Economic Injury Disaster Loan funds (Rubio, 2020). Bloomberg later confirmed the possibility of Covid-19-related banking abuse on a wide scale (David, 2020). Importantly, this is not a new pattern of behavior for the U.S. banking behemoth. Since 2002 (and primarily since the 2008 financial crisis), JPMorgan Chase has paid out at least $42 billion in settlements for questionable, unethical, or illegal behavior (Fitts, 2019); its public-facing Wikipedia page lists involvement in 22 different “controversies,” including the economically shattering Enron and Madoff scandals (“JPMorgan Chase”, n.d.). Nevertheless, JPMorgan continues to earn glowing accolades from the financial community. In June 2020, Forbes urged investors to “bank on the best” in the uncertain Covid-19 environment (Trainer, 2020), citing JPMorgan’s post-2009 “industry-leading profitability” and asserting that the bank is exceptionally well positioned to expand its market share both during and post-pandemic. In October, JPMorgan rolled out a new smartphone credit card reader designed to compete with Square and PayPal (Son, 2020).
Big Tech
By July 2020, global billionaires’ wealth had surged to an all-time high of $10.2 trillion — an increase of 27.5 percent since April, and a 41.3 percent increase for tech billionaires (Phillipps, 2020). U.S. billionaires accrued a significant share of this pandemic wealth bonus, increasing their worth by $845 billion from mid-March to mid-September and prompting the observation that “for American billionaires specifically, things have never looked better” (Lerma, 2020). As a whole, U.S. billionaires’ wealth reached the equivalent of almost one-fifth of the U.S. gross domestic product, with four tech billionaires (Jeff Bezos, Bill Gates, Elon Musk, and Mark Zuckerberg) plus Warren Buffett seeing their total wealth climb by 59 percent (da Costa, 2020). Calling attention to Bezos, in particular, the Institute for Policy Studies described his surge in wealth as “unprecedented in modern financial history”, requiring “a real-time hour-by-hour tracker” to keep up (Collins et al., 2020).
The companies with which top-tier billionaires are affiliated include Amazon and Amazon Web Services (Bezos), Apple (Tim Cook), Facebook (Zuckerberg), Google/Alphabet (Larry Page and Sergey Brin), Microsoft (Steve Ballmer and Gates), Oracle (Larry Ellison), Zoom (Eric Yuan), and the variety of companies (including Neuralink, SpaceX, and Tesla) spearheaded by Musk (Alcorn, 2020; Collins et al., 2020; Toh, 2020). In July, as Bloomberg described these companies’ “outsized influence on U.S. markets”, it noted that they are as well-situated to profit from the U.S. shutdown as they are to take advantage of a recovering Europe and Asia — a “one-two punch” that has already increased FAANG companies’ market (Facebook, Amazon, Apple, Netflix, and Google, plus Microsoft) by 62 percent (Ritholtz, 2020). Suggesting that Silicon Valley will go down in history as “the standout sector” (Divine, 2020a), a U.S. News analyst unabashedly recommended Facebook as a 2020 “best buy” because “it’s gobbling up the world, and reasonable people could argue that if privacy is dying, individual investors may as well profit alongside Silicon Valley” (Divine, 2020b).
Covid-19 has provided Big Tech (and Big Telecom) with an opportunity to bring a range of controversial technologies further out into the open, despite many unresolved concerns about safety and ethics (Boteler, 2017; Gohd, 2017; Ross, 2018; Boyle, 2019; Feiner, 2019; Markman, 2019; Plautz, 2019; Zhang et al., 2019; Bajpai, 2020; Goodwin, 2020; Gyarmathy, 2020; McGovern, 2020; Novet, 2020; Reuters, 2020; Tucker, 2020; U.S. Department of Defense, 2020). Singly and in combination, the technologies (some of which are listed in Table 2) have the potential to usher in unprecedented societal changes, strengthening technocrats’ ability to control many facets of daily life. Artificial intelligence (AI), 5G, “smart” utility meters, and the Internet of Things (IoT), for example, are rapidly and fundamentally changing the nature of cities, businesses, and homes — what Fitts (2020a) calls the “final mile” — forming an essential part of the strategy to convert the economic model to a technocratic model that uses AI and software to achieve centrally controlled resource allocation.
Table 2. Covid-19 and the Rollout of Control Technologies
In October 2020, the World Economic Forum — the Great Reset’s front-row marketer — released a report on the future of jobs, describing the significant displacement of workers resulting from the pandemic and the related global restructuring that the organization has been taking the opportunity to promote (Petzinger, 2020). With automation and Covid-19 causing a “double-disruption” that is not only accelerating job destruction in the short term but “shrinking opportunities” in the longer term, the report solemnly pronounced a “new division of labour between humans, machines and algorithms” (World Economic Forum, 2020). Well before the pandemic, Amazon had established a robot-centric system at its fulfillment centers, with a process focused on “limit[ing] movement of people [and] let[ting] robots move everything” (Masud, 2019). This downsizing of humans has apparently served Amazon well; by May 2020, Amazon’s e-commerce business had shot up by 93 percent compared to the previous May (Klebnikov, 2020).
A September 2020 survey showed that many other companies plan to substantially boost their spending on AI and machine learning, citing Covid-19 as their rationale for prioritizing “the adoption of new technologies that enhance and enable automation” (Shein, 2020). Observers also predict, however, that the AI gold rush will lead to even more market consolidation and control by Amazon and three other big Covid-19 winners — Alphabet, Facebook, and Microsoft. These four companies, according to Forbes, have the “scale to push the envelope”, the “talent and the technology to perfect [AI]”, and the computing power to dominate the field (Markman, 2019). Amazon already controls nearly 46 percent of the worldwide public cloud-computing infrastructure that is a key backstop for AI functions such as parallel processing and the digestion of Big Data (Atlantic.Net, 2018; Nix, 2019).
Before Covid-19, consumer rejection of 5G wireless technology had been growing (Castor, 2020). However, the imposition of social distancing measures, remote learning, and online work requirements has provided the telecommunications industry with a ready-made pretext to fast-forward 5G’s deployment while attempting to burnish the industry’s unfavorable public image. Taking advantage of virus fears, Big Tech and Big Telecom are claiming that 5G can help enable “a future in which business, health care and human interaction must be at more than an arm’s length” (Wasserman, 2020). Forbes has praised communication service providers for responding to the coronavirus lockdowns “with a sense of urgency, purpose and empathy” (Wilson, 2020). Describing areas requiring more “advanced connectivity”, a technology expert at Deloitte Consulting cited the example of “cameralytics” (video surveillance) “to help worker safety and social distancing” (Howell, 2020). Whatever the rationale, the reality on the ground has been a massive increase in U.S. telecom companies’ capital spending on 5G and a “full steam ahead” rollout of spectrum and infrastructure that has placed the U.S. “ahead of schedule” (Knight, 2020; Ludlum, 2020). The European Commission is now attempting to follow the U.S.’s lead by pushing for the removal of “regulatory hurdles” and making the case that 5G will aid the region’s post-coronavirus economic recovery (McCaskill, 2020).
Covid-19 has also brought another of Big Tech’s interests into sharper focus: food. Billionaires such as Bill Gates and Peter Thiel have, for some time, been investing in biotech start-ups that aim to produce, in a lab, stem-cell-based “meat”, “fish”, “dairy”, and “breastmilk” (Kerr, 2016; Kosoff, 2017; Beres, 2020; Wuench, 2020). These start-ups and their investors have been only too happy to position the burgeoning industry as a partial solution to pandemic-related food insecurity and supply chain interruptions (Galanakis, 2020; Pereira & Oliveira, 2020; Yeung, 2020), welcoming Covid-19 as an “accelerator” as well as an opportunity to overcome consumer skepticism (Siegner, 2019; Morrison, 2020). In addition, as the coronavirus breathes new life into the term “sustainability” — long used by technocrats as a cover term for more centralized control (Wood, 2018) — global partners like the United Nations and the World Economic Forum are making the improbable claim that the complex, high-dollar, lab-created food substitutes (which require genetically stable cell lines, bioreactors, “edible scaffolds”, and cell culture media) are a “sustainable” option (Whiting, 2020). The biopharma giant Merck is also getting in on the “cultured meat” action, offering to make its “extensive knowledge of the relevant science and biotechnology” available to companies seeking to overcome “critical technological challenges” (Whiting, 2020). Merck frequently collaborates with the Gates Foundation, including in the development of Covid-19 vaccines (Lardieri, 2020).
Big Pharma
In September 2019, an annual Gallup poll reported that the restaurant industry was America’s top-ranked and most-liked among the 25 industries regularly assessed by the polling group (McCarthy, 2019). Sadly, less than a year later the Independent Restaurant Coalition predicted the permanent demise of up to 85 percent of independent restaurants (Jiang, 2020). In contrast, the pharmaceutical industry came in “dead last” in the 2019 poll, despite $9.6 billion spent annually on direct-to-consumer advertising and another $20 billion on marketing to health professionals (McCarthy, 2019; Schwartz & Woloshin, 2019). The U.S. is one of only two countries in the world that allows drug companies to market directly to consumers and, in non-election years, roughly 70 percent of news outlets’ advertising revenues come from pharma (Solis, 2019).
The pharmaceutical industry’s history of “fraud, bribery, lawsuits and scandals” is well known (Compton, n.d.), and no less a figure than Bill Gates has suggested that the public perceives Big Pharma as “kind of selfish and uncooperative”; however, Mr. Gates and Fortune magazine propose that Covid-19 may offer the industry an opportunity for “redemption” (Leaf, 2020). The stage may have been set for Big Pharma’s year of opportunity in January, when JPMorgan Chase held its 38th annual invitation-only health care conference. The business press describes the yearly conference as “one of the biggest biotech dealmaking events, often setting the tone for funding rounds, partnerships and mergers and acquisitions” (Leuty, 2020). Thus, just when the coronavirus ball was getting rolling, the conference brought an estimated 20,000 venture capitalists, investment bankers, and drug development executives and entrepreneurs to San Francisco to hear keynote addresses by JPMorgan’s and GlaxoSmithKline’s CEOs and to stoke expectations of a strong year for the biotech-plus-pharma chimera known as “biopharma” (JPMorgan, n.d.; Leuty, 2020; Lipschultz, 2020). In 2014, McKinsey & Company described the investment opportunities in biopharmaceuticals as “big and growing too rapidly to ignore”, with an annual growth rate more than double that of conventional pharma and a 20 percent share of global pharmaceutical revenues (Otto et al., 2014).
A few weeks after the JPMorgan conference — and well before any Covid-19 deaths in the U.S. — the Department of Health and Human Services (HHS) helped ensure that significant pandemic benefits would flow into the biopharma and medical space. HHS did so by issuing a declaration (on February 4) making vaccines and all Covid-19-related medical countermeasures immune from legal liability (HHS, 2020a). On March 6, roughly a week after the first reported coronavirus death, President Trump sweetened the pot by signing into law the first in a series of emergency stimulus packages, earmarking 40 percent of the $8.3-billion bill for vaccines and drugs under terms the pharmaceutical industry openly dictated (Karlin-Smith, 2020).
Following the February 4 HHS declaration eliminating legal liability, Bill and Melinda Gates instantly pledged $100 million in funding for coronavirus vaccine research and treatments, followed by another $150 million in mid-April (Bill & Melinda Gates Foundation, 2020; Voytko, 2020). When Operation Warp Speed followed, making untold billions available for research and development of therapeutics and vaccines at taxpayer expense (see Table 3), dozens of biopharma companies jumped into the fray (HHS, n.d.). Catherine Austin Fitts notes that a system that exempts from liability anything labeled as a “vaccine” amounts to “an open invitation to make billions . . . particularly where government regulations and laws can be used to create a guaranteed market through mandates” (Fitts, 2020b). Moreover, each time the CDC’s Advisory Committee on Immunization Practices (ACIP) adds a given vaccine to the CDC schedule, it is not only the equivalent of a “golden ticket” for the vaccine manufacturer but also directly benefits the CDC, which owns dozens of vaccine-related patents and routinely shares licensing agreements with manufacturers (Taylor, 2017; Children’s Health Defense, 2019).
Currently, there is one injury for every 39 vaccinations administered (2.6%), often resulting in a “disastrous outcome of life-altering iatrogenic illnesses” (Harvard Pilgrim Health Care, n.d.; Kennedy Jr., 2019; Kristen, 2019). A CDC study published in JAMA in 2016 reported that one in five young children (19.5%) under age five who were admitted to emergency rooms for drug reactions were suffering from vaccine injuries (Shehab et al., 2016). Early clinical trial results and Covid-19 vaccines’ use of an array of experimental, never-before-approved technologies suggest that comparable (or worse) levels of injury could follow the rollout of coronavirus vaccines (Children’s Health Defense, 2020a, 2020c, 2020d, 2020e). The Moderna and Pfizer vaccines, for example, feature mRNA molecules that are known to be “intrinsically unstable and prone to degradation”, with an inflammatory component that risks dangerous immune reactions (Feuerstein, Garde, & Joseph, 2020; Jackson et al., 2020; Wadhwa et al., 2020). Assuming the same vaccine injury rate of 2.6 percent, Operation Warp Speed’s projected vaccination of roughly 25 million Americans per month (Owermohle, 2020b) could conceivably result in 3.9 million injuries over just the first six months. (Given that the leading vaccines will require two initial doses and probable boosters thereafter, this figure could even be an underestimate.) If Bill Gates and other technocrats succeed in their declared aspiration to manufacture billions of doses of coronavirus vaccine and “get them out to every part of the world” (Gates, 2020), the scale of injury would not only be unprecedented but could open a lucrative, long-term gateway to the wider drug market to manage the injuries (Kristen, 2019).
*HHS note on Operation Warp Speed funding: “Congress has directed almost $10 billion to this effort through supplemental funding, including the CARES Act. Congress has also appropriated other flexible funding. The almost $10 billion specifically directed includes more than $6.5 billion designated for countermeasure development through BARDA and $3 billion for NIH research.”
By mid-October, 44 candidate vaccines were in clinical evaluation worldwide, with another two hundred or so in the pipeline (Agrawal et al., 2020; World Health Organization, 2020b). Furnishing predictably uncritical coverage ensured by the pharmaceutical industry’s strategic entanglements with the media, scientists, and medical journals, the press has been telling the public that the vaccines will play “an important role in most response scenarios”, including “‘sav[ing] the world’ in worse scenarios” and serving as an “insurance policy against continued health and economic shocks” (Agrawal et al., 2020). Only a handful of journalists have called attention to Big Pharma’s pandemic profiteering, pointing out that “insiders at companies developing experimental vaccines and treatments . . . aren’t waiting until they finish the job to collect their reward” (Wallack, 2020).
An October piece in the Boston Globe cited the example of Moderna (Wallack, 2020). It took Moderna a mere three weeks after Bill Gates’ initial funding installment to send its first batch of experimental vaccine to research and patent partner, the National Institute of Allergy and Infectious Diseases (NIAID), leading to an immediate surge in share price of 28 percent (Lee, 2020; Loftus, 2020). By early April, Moderna’s CEO had become an overnight billionaire; by October, he had sold nearly $58 million in stock, followed by another $2 million in mid-November, just ahead of the company’s intended filing for vaccine Emergency Use Authorization (Nagarajan, 2020; Tognini, 2020; Wallack, 2020). Meanwhile, Moderna’s chief medical officer has been “systematically liquidating all of his company stock” — about $70 million — “in a series of pre-planned trades that have made him roughly $1 million richer each week” (Wallack, 2020). Thus far this year, company insiders have sold $309 million in stock versus under $2 million in 2019, fueling suspicion that they may be “downplaying possible obstacles to goose stock prices — and increase their personal profits” (Wallack, 2020). Also among those selling Moderna stock options is Moncef Slaoui, the former Moderna board member and former GlaxoSmithKline executive who now heads up Operation Warp Speed (Rozsa & Spencer, 2020).
From Moderna’s perspective, the Covid-19 vaccine represents a lifeline, rescuing the company from a shaky bottom line due to its prior inability to bring any products to market (Garde, 2017; Nathan-Kazis, 2020). Other biopharma companies formerly on the skids are likewise poised to make record profits from the coronavirus (Webb & Diego, 2020). Characterizing the business model for Covid-19 (and other) vaccines as a “great scheme” — particularly given the HHS-guaranteed, risk-free environment — a watchdog group spokesman told the Boston Globe, “Taxpayers cover the upfront investment costs and shoulder any downside, while their [biopharma’s] executives and shareholders can capture the upside if their drugs pan out and are shoveling obscene amounts of money into their pockets throughout the process” (Wallack, 2020). In the words of a business school professor, “You announce a sliver of positive hope about a product and your stock price goes up,” even though “the chances of that product panning out might be relatively low” (Wallack, 2020). In 2020, the company Vaxart saw its per-share stock price rise from 27 cents to a high of $17.49 (Wallack, 2020).
Rolling Stone journalist Matt Taibbi (2020) describes Covid-19 as “the ultimate cash cow,” a “subsidy-laden scam,” and a legal opportunity for “giant-scale gouging”, quoting a legislator who admits that while the public is paying for the research and manufacturing, “the profits will be privatized”. Writing in August about how the government-subsidized business model played out for Gilead’s drug remdesivir, Taibbi (2020) recounted: “Gilead, a company with a market capitalization of more than $90 billion, making it bigger than Goldman Sachs, develops an antiviral drug with the help of $99 million in American government grant money. Though the drug may cost as little as $10 per dose to make, and is being produced generically in Bangladesh at about a fifth of the list price, and costs about a third less in Europe than it does in the U.S., Gilead ended up selling hundreds of thousands of doses at the maximum conceivable level, i.e., the American private-insurance price — which, incidentally, might be about 10 times what it’s worth, given its actual medical impact.”
Always a major lobbying presence on Capitol Hill, the pharmaceutical industry has been more lavish than usual with its political spending in 2020, donating over $11 million to individual candidates involved with health care policy and related political action committees (Facher, 2020a). Although the overall amounts represent a pittance for companies earning tens of billions a year, pharma and its lobbying groups recognize that “small chunks of corporate change”, when strategically allocated, “can have a significant impact” (Facher, 2020b). Coronavirus vaccine frontrunner Pfizer, the second-largest drug and biotech company in the world and the fourth-highest earner of vaccine revenues (Statista, n.d.; Hansen, 2020), has been the top political spender, likely laying the groundwork for its November 20 filing for Emergency Use Authorization for its coronavirus vaccine (Chander, 2020; Children’s Health Defense, 2020d). Pfizer has also benefited from repeated endorsements from the financial community and self-proclaimed spokesmen like Bill Gates (Speights, 2020a, 2020b).
The Military-Intelligence Complex
Traditional vaccines have their fair share of safety problems, but coronavirus and other 21st-century vaccines promise to challenge bodily integrity and informed consent in entirely new ways, particularly given their strong reliance on various forms of nanotechnology (Health and Environment Alliance, 2008; Li et al., 2009; Chauhan et al., 2020; Children’s Health Defense, 2020a). Many of the technologies being rolled into Covid-19 vaccines and their delivery systems originated in the military sphere or benefited from Defense Advanced Research Projects Agency (DARPA) funding. DARPA has had a Biological Technologies Office since 2014 and, since the emergence of Covid-19, has specifically directed many of its pandemic-related efforts toward coronavirus therapeutics and vaccines (Gallo, 2020). Far from being suspect, the military’s role has been celebrated. A BioCentury report optimistically suggested in March that as an agency “that specializes in turning science fantasies into realities”, DARPA might offer the “best hopes” for Covid-19 biotech solutions due to its willingness to pursue “high-risk, high-reward technologies”, set goals “that defy conventional wisdom”, and go after its goals with a “laser” focus (Usdin, 2020).
One of the principal DARPA-incubated vaccine technologies to gain prominence in the Covid-19 era are the nucleic acid (mRNA and DNA) vaccines that turn the human body into its own “bioreactor” (Ghose, 2015; Usdin, 2020). Vaccines using mRNA (such as Moderna’s and Pfizer’s) — which developers compare to “software” (Garde, 2017) and praise for their “programmability” (Al-Wassiti, 2019) — target the cell’s cytoplasm and rely on delivery technologies such as lipid nanoparticles to “ensure stabilization of mRNA under physiological conditions” (Wadhwa et al., 2020). DNA vaccines (such as Inovio’s) are intended to penetrate all the way into a cell’s nucleus and come with the risk of “integration of exogenous DNA into the host genome, which may cause severe mutagenesis and induced new diseases” (Zhang, Maruggi, Shan, & Li, 2019). Describing the scientific community’s early doubts about nucleic acid vaccines — arising from the potential for “many things” to go wrong — a DARPA program manager recently noted, “It was something that was much too risky for groups like the NIH to fund” (Usdin, 2020).
Risks aside, DARPA and vaccine manufacturers are attracted to one chief benefit of nucleic acid vaccines: They can be developed much more quickly and cheaply. Other military-initiated technologies are also coming into view with Covid-19 vaccines. These include electroporation, which applies a high-voltage electrical pulse to make cell membranes permeable to a vaccine’s foreign DNA (Inovio Pharmaceuticals, 2020); syringe-injected biosensors that enable continuous wireless monitoring of vital signs and body chemistry (Peer, n.d.; Profusa, n.d.; Diego, 2020b; Tucker, 2020); and the quantum-dot-based infrared detectors that are under discussion as a tool for tracking vaccination status (Johnson, 2011; Trafton, 2019). DARPA has also played a leading role in developing and funding technologies that “blur the lines between computers and biology”, including brain-machine interfaces and neuromonitoring and mind-reading devices (CB Insights, 2019; Gent, 2019; Tullis, 2019).
Some of Moderna’s earliest funding came from DARPA, which awarded the company $25 million in 2013 to develop the mRNA platform that has become a key feature of its coronavirus vaccine (Usdin, 2020). Other DARPA beneficiaries now involved in efforts to develop Covid-19 vaccines or therapeutics include AbCellera Biologics, CureVac, Inovio Pharmaceuticals, Regeneron Pharmaceuticals, and Vir Biotechnology; some of AbCellera’s partners include major players like Pfizer and Gilead (Usdin, 2020).
The Pentagon’s involvement in coronavirus-related efforts goes well beyond DARPA-funded research. Four-star General Gustave Perna is serving as chief operating officer of Operation Warp Speed alongside chief advisor Moncef Slaoui. General Perna, in charge of U.S. Army Materiel Command, oversees the global supply chain for over 190,000 U.S. Army employees (HHS, 2020b). For the first time ever, the distribution of the eventual coronavirus vaccines is being planned as a “joint venture” between the CDC and the Pentagon, with the latter overseeing “all the logistics of getting the vaccines to the right place, at the right time, in the right condition” (Owermohle, 2020a). In a CBS “60 Minutes” appearance in early November, General Perna indicated that Operation Warp Speed already had doses of (currently unapproved) vaccine and syringes stockpiled and protected by armed guards, and intends to get them out the door “within 24 hours” of vaccine approval and delivered “to every zip code in this country” (Martin, 2020).
The Pentagon has indicated that private-sector involvement could be a key feature of the distribution strategy, and the private sector is positioning itself to participate. Merck, for example, is testing drone delivery of vaccines in partnership with Volansi, Inc., a company that provides “on-demand” drone services for the military (Landi, 2020; Simmie, 2020). In July, Merck’s CEO set the stage for its logistics involvement by describing vaccine distribution as “even a harder problem” than the “scientific conundrum of coming forward with a vaccine that works” (Murray & Griffin, 2020).
Outside the pharmaceutical arena, technological transformations that are speeding the world toward more centralized control also reveal the influence of the military-intelligence sector. For example, Amazon Web Services has held cloud-computing contracts with the CIA since 2013, with the original $600 million contract extending to all 17 intelligence agencies (Konkel, 2014). In October of 2019, the Department of Defense awarded the $10 billion JEDI cloud computing contract to Microsoft, a decision that Amazon has unsuccessfully disputed in court (Sandler, 2020). In early 2020, the U.S. Navy awarded a cloud computing contract to Leidos (Leidos, 2020).
5G, too, relies in part on the high-range millimeter-wave spectrum previously used almost entirely by the military for “non-lethal” crowd dispersal weapons (Joint Intermediate Force Capabilities Office, n.d.). In October, the Department of Defense announced it would spend $600 million to test “dual-use” applications of 5G to enhance the U.S. military’s “leap-ahead capabilities”, including applications such as 5G-enabled augmented/virtual reality, 5G-enabled “smart” warehouses, and 5G technologies “to aid in Air, Space, and Cyberspace lethality” (U.S. Department of Defense, 2020).
Both 5G and cloud computing are critical components of the Big Data and IoT build-out that is enabling the conversion of individual data into the “new oil” (Fitts, 2020a), and both have exploded in 2020 (Howell, 2020; Klebnikov, 2020). The technologies are essential to the “centrally controlled digital financial transaction systems” envisioned by central bankers, who plan to rely on seamless data flows to and from “every smartphone, community, and home without exception” (Fitts, 2020a).
Discussion
As more individuals and organizations connect the technocratic dots and look beneath the coronavirus pandemic’s seductively simple surface, it should become increasingly apparent that the pandemic profiteers do not have people’s best interests at heart. In The State of Our Currencies and other pandemic-related writings, Catherine Austin Fitts (2020a, 2020b) strongly emphasizes the importance of accepting that what is transpiring in the financial, tech, biopharmaceutical, and military-intelligence sectors is interconnected. Part of this involves recognizing that the coronavirus vaccines currently dominating the headlines represent something likely to go far beyond the simple health intervention being held out by scientists and officials as a panacea. Instead, the evidence suggests that Covid-19 vaccines are intended to serve as a Trojan horse to transport invasive technologies into people’s brains and bodies. These technologies could include brain-machine interface nanotechnology, digital identity tracking devices, technology that can be turned on and off remotely, and cryptocurrency-compatible chips (Fitts, 2020b).
In Fitts’ (2020a, 2020b) view, this type of intimate access — achieved “without notice, disclosure, or compensation” — represents the “final inch” of interest to technocrats. Together with external technologies to control behavior (Max, 2020), such access could permit the achievement of several goals: (1) replacing currencies with a digital transaction system, digital identification, and tracking (an “embedded credit card system”); (2) creating a global control grid that connects the population to the military-intelligence clouds; and (3) obtaining continuous access to valuable individual data on a 24/7 basis (Fitts, 2020b). Countries in West Africa are already piloting a venture by the Gates Foundation, the Gates-funded GAVI vaccine alliance, and Mastercard that “marks a novel approach towards linking a biometric digital identity system, vaccination records, and a payment system into a single cohesive platform” (Diego, 2020a). As Fitts (2020b) summarizes, “Just as Gates installed an operating system in our computers, now the vision is to install an operating system in our bodies and use ‘viruses’ to mandate an initial installation followed by regular updates”. The “neat trick”, as Fitts sees it, is that the use of vaccines as the delivery vehicle cancels out legal liability.
It is noteworthy that Bill Gates announced that he was stepping down from the Microsoft board of directors on March 13 — the same day that President Trump declared the pandemic a national emergency (Haselton & Novet, 2020). That same month, the Pentagon reaffirmed its intention for the JEDI cloud-computing contract to go to Microsoft (Rash, 2020; Sun, 2020). By distancing himself from the appearance of conflicts of interest with Microsoft’s Defense Department commitments and the Pentagon’s subsequent role in Operation Warp Speed, Mr. Gates had more freedom to make the rounds and begin promoting worldwide vaccination and digital certificates (Haggith, 2020). Gates has been less successful in distracting attention from other potential conflicts of interest. An exposé by The Nation (ironically also published in March) showed that the Gates Foundation gives billions to corporations in which the foundation holds stocks and bonds — including all of the major pharmaceutical companies — creating a “welter of conflicts of interest” (Schwab, 2020). A dozen years ago, around the time of the 2007-2008 financial crisis, the Los Angeles Times outlined the Gates Foundation’s numerous holdings in a number of notoriously “destructive or unethical” companies (Piller et al., 2007).
Mr. Gates is not the only party strenuously promoting digital IDs and “no-escape” financial tracking (marketed under the benevolent guise of “financial inclusion”). In October, Kristalina Georgieva, the International Monetary Fund’s (IMF’s) Managing Director, evoked “a world in which digital is the way in which financial transactions take place” and made it clear that she views universal digital IDs as a non-negotiable requirement for moving in the “right direction” (International Monetary Fund, 2020). Georgieva has, not unhappily, described Covid-19 as a “once in a lifetime pandemic” (Bello, 2020).
Georgieva’s remarks should be examined in the context of a proposal by the U.S. House of Representatives to bestow the IMF with $3 trillion “no-strings-attached” U.S. dollars as “coronavirus relief aid” (Huessy, 2020; Roberts, 2020). A U.S. taxpayer-funded gift of this magnitude would be unprecedented and would increase the IMF’s lending resources (called Special Drawing Rights or SDRs) by as much as 10-fold (Roberts, 2020). 2020’s events (including global debt entrapment and actual or potential food shortages) and the IMF’s bullying track record (Bello, 2020) suggest that the IMF could then wield the $3 trillion as a weapon, strong-arming countries into accepting an array of unwanted measures such as digital identities, forced vaccination, and eventually (as the World Economic Forum predicts), the relinquishment of private property (World Economic Forum, 2016). As a step in this general direction, the IMF has strongly praised India’s leadership in biometric identification systems. It celebrates the “delivery of social benefits through direct electronic payments to eligible bank account holders”, but glosses over the systems’ vulnerability to “unauthorized access” and the data breaches that are already rampant (Jha, 2018).
While current prospects for ordinary citizens certainly appear challenging, nothing is a foregone conclusion. Large-scale protests against the curtailment of civil rights have occurred and continue to occur in many countries, most notably in Germany (Depuydt, 2020). The Great Barrington Declaration — a statement crafted by public health scientists from Harvard, Stanford, and Oxford — has garnered signatures from over 12,000 scientists, over 35,000 medical practitioners, and nearly 639,000 citizens from around the world, all concerned about “the damaging physical and mental health impacts of the prevailing COVID-19 policies” (Kulldorff et al., 2020). Similarly, an Appeal authored in May by Archbishop Carlo Maria Viganò, former Apostolic Nuncio to the United States, gathered 40,000 signatures within a few days, with the signatories (religious leaders, doctors, journalists, lawyers, and other professionals) all seeking to draw attention to the threats to sovereignty and freedom that pandemic-related mandates have unleashed (Tosatti, 2020). Archbishop Viganò has also penned severe critiques of the Great Reset, describing its architects as “a global elite that wants to subdue all of humanity, imposing coercive measures [and a health dictatorship] with which to drastically limit individual freedoms and those of entire populations” (Viganò, 2020).
One of the signatories of Archbishop Viganò’s Appeal is attorney Robert F. Kennedy, Jr., founder and chief legal counsel of Children’s Health Defense, an organization dedicated to ending childhood epidemics by working to eliminate harmful exposures, holding those responsible accountable, and establishing stronger safeguards. In late October, Kennedy recorded a 19-minute video message to people around the world, describing the “coup d’état by big data, by big telecom, by big tech, by the big oil and chemical companies and by the global public health cartel” (Kennedy Jr., 2020). In his closing remarks, Kennedy also indicated that citizens who wish to maintain their freedoms cannot afford to remain complacent: “You are on the front lines of the most important battle in history, and it is the battle to save democracy, and freedom, and human liberty, and human dignity from this totalitarian cartel that is trying to rob us simultaneously, in every nation in the world, of the rights that every human being is born with.”
Andriotis, A. (2020, September 20). No job, loads of debt: Covid upends middle-class family finances. The Wall Street Journal. https://archive.is/mZAme
Bank for International Settlements. (2019, October 18). Investigating the impact of global stablecoins. G7 Working Group on Stablecoins. https://www.bis.org/cpmi/publ/d187.pdf
Bueno-Notivol, J., Gracia-García, P., Olaya, B., Lasheras, I., López-Antón, R., & Santabárbara, J. (2020). Prevalence of depression during the COVID-19 outbreak: a meta-analysis of community-based studies. International Journal of Clinical and Health Psychology, 2020 Aug 31. doi: 10.1016/j.ijchp.2020.07.007
Chauhan, G., Madou, M. J., Kalra, S., Chopra, V., Ghosh, D., & Martinez-Chapa, S. O. (2020). Nanotechnology for COVID-19: Therapeutics and vaccine research. ACS Nano. doi: 10.1021/acsnano.0c04006
Community FoodBank of New Jersey. (2020, September 30). COVID-19’s Impact on Food Insecurity in New Jersey. Hillside, NJ: CFBNJ. https://cfbnj.org/covidimpact/
Dubey, M. J., Ghosh, R., Chatterjee, S., Biswas, P., Chatterjee, S., & Dubey, S. (2020). COVID-19 and addiction. Diabetes & Metabolic Syndrome, 14(5), 817-823. doi: 10.1016/j.dsx.2020.06.008
Ettman, C. K., Abdalla, S. M., Cohen, G. H., Sampson, L., Vivier, P. M., & Galea, S. (2020). Prevalence of depression symptoms in US adults before and during the COVID-19 pandemic. JAMA Network Open, 3(9), e2019686. doi: 10.1001/jamanetworkopen.2020.19686
Federal Accounting Standards Advisory Board. (2020, October 4). Statement of Federal Financial Accounting Standards 56: Classified Activities. FASAB Handbook, Version 18 (06/19). Retrieved September 26, 2020, from http://files.fasab.gov/pdffiles/handbook_sffas_56.pdf
Ganann, R., Ciliska, D., & Thomas, H. (2010). Expediting systematic reviews: methods and implications of rapid reviews. Implementation Science, 5, 56. doi: 10.1186/1748-5908-5-56
HHS. (2020a, February 4). Declaration Under the Public Readiness and Emergency Preparedness Act for Medical Countermeasures Against COVID-19. U.S. Department of Health and Human Services. Federal Register, 85(52), 15198–15203. https://www.law360.com/articles/1253029/attachments/0
Jackson, N. A. C., Kester, K. E., Casimiro, D., Gurunathan, S., & DeRosa, F. (2020). The promise of mRNA vaccines: a biotech and industrial perspective. NPJ Vaccines, 5, 11. doi: 10.1038/s41541-020-0159-8
Pereira, M., & Oliveira, A. M. (2020). Poverty and food insecurity may increase as the threat of COVID-19 spreads. Public Health Nutrition, 1-5. doi: 10.1017/S1368980020003493
Profusa. (n.d.). Profusa is pioneering tissue-integrating biosensors for continuous monitoring of body chemistries. Retrieved October 26, 2020 from https://profusa.com/
Rossen, L. M., Branum, A. M., Ahmad, F. B., Sutton, P., & Anderson, R. N. (2020, October 23). Excess deaths associated with COVID-19, by age and race and ethnicity — United States, January 26–October 3, 2020. Morbidity and Mortality Weekly Report, 69(42), 1522-1527. doi: 10.15585/mmwr.mm6942e2
Shehab, N., Lovegrove, M. C., Geller, A. I., Rose, K. O., Weidle, N. J., Budnitz, D. S. (2016). US emergency department visits for outpatient adverse drug events, 2013-2014. JAMA, 316(20, 2115-2125. doi: 10.1001/jama.2016.16201
Wadhwa, A., Aljabbari, A., Lokras, A., Foged C., & Thakur, A. (2020). Opportunities and challenges in the delivery of mRNA-based vaccines. Pharmaceutics, 12(2), 102. doi: 10.3390/pharmaceutics12020102
Woolf, S. H., Chapman, D. A., Sabo, R. T., Weinberger, D.M., Hill, L., & Taylor, D. D. H. (2020). JAMA, 324(15), 1562-1564. doi: 10.1001/jama.2020.19545
Zhang, C., Maruggi, G., Shan, H., & Li, J. (2019). Advances in mRNA vaccines for infectious diseases. Frontiers in Immunology, 10, 594. doi: 10.3389/fimmu.2019.00594
Zhang, J., Xu, K., Zhang, S., Wang, Y., Zheng, N., Pan, G. et al. (2019). Brain-machine interface-based rat-robot behavior control. Advances in Experimental Medicine and Biology, 1101: 123-147. doi: 10.1007/978-981-13-2050-7_5
[As a service to protect truth from censorship & to share widely, mirrored copies of this video are available at Truth Comes to Light Brighteon, Lbry/Odysee channels. All credit, along with our sincere thanks, goes to the original source of this video. Please follow links provided to support their work.]
At This Point, Are Americans Anything More Than Lab Animals?
“We slow the progress of science today for all sorts of ethical reasons. Biomedicine could advance much faster if we abolished our rules on human experimentation in clinical trials, as Nazi researchers did.” ~ Paul Nitze
The idea of brutal experimentation on animals has always been justified by claiming that it is necessary in order to benefit the health or mental well being of humans. This propagandist thinking could and would lead to a public acceptance of experimenting and torture of living things in the false name of human progress. But it was also meant to condition man to accept harm to one species in order to better his own. It stands to reason that once this mindset was in place, it could be argued that human experimentation could enhance that ‘progress’ much further, thereby becoming a necessary evil that could be seen as beneficial, especially if it began with psychological experimentation, and not physical. Now that the psyche and body are in many cases being seen as one and the same, why not use medical testing of some humans so as to benefit the collective? In this scenario, the individual would be destroyed in favor of the group, and this could easily lead to sacrificing some for the good of all. The result of this progression would be that we are all lab animals now.
In this era of the fraudulent coronavirus ‘pandemic,’ most are well on their way to becoming a nation of mindless drones that will be accepting of human experimentation. This is in fact already happening, but it seems that it will get much worse very soon. Fear can breed aggression, but considering the herd mentality of the human species, it is much more likely to breed passivity and compliance, both very detrimental to survival in what could be considered any normal way of life. It is not that this government and its controllers have not used its citizens and others for these purposes in the past, but today it is becoming rampant, and is even out in the open concerning current policies in place.
Most all that is now being mandated by the political class is based on experimentation. That experimentation is predicated on compliance testing, this regardless of the gross harm caused. You see, when experimenting with the human animal, it is first necessary to gauge the psyche of the average person in order to know how far the experiment can advance. Because of this, it is crucial to perform psychological experimentation prior to physical experimentation. This of course is not necessary with animals, but is vital with ‘reasoning’ humans. With mass compliance, it becomes evident to the ruling sector of society that the people are prepared to become guinea pigs, and therefore are ripe for abuse. These lockdowns, distancing rules, mask wearing, voluntary business closings, virus testing, and restrictions to liberty at every level, are simply tests to see if the people are willing to follow ludicrous and dangerous instructions in order to gain some sort of false safety due only to pre-planned government propaganda. It has been obvious that Americans in large part have been willing to do absolutely anything they were told to do, including allowing their older family members to be psychologically tortured, and effectively murdered, due to forced isolation by the state.
The ultimate goal of the state here is to first destroy the human spirit, leaving an empty mind and a blank slate so that the people at large are ready and willing to become the test subjects for their claimed masters. The day of the first significant physical experiment on this population is fast approaching, and at this time seems imminent. That experiment will rival many of the heinous and torturous ‘scientific’ persecutions of the past, but will be unique in that it will be made to seem voluntary instead of being done through incarceration and brute force. But there is a sinister aspect of this feigned voluntarism that exposes a heinous psychological manipulation.
I am speaking here of course of the coming poisonous ‘Covid-19’ vaccination. The contradiction and foretelling of doom is obvious, so why are so many already willing to be used as lab animals? The first sign of great danger lies in the fact that the state has exempted the pharmaceutical companies developing these experimental toxins from all liability. The state with your money is also paying for the development of these virulent injections, while allowing unlimited profit to its partners in crime. In addition, the government is claiming to be liable, but that is a lie, as government has nothing, and produces nothing; it only steals from those that do. So each and every citizen guinea pig taking this deadly and experimental vaccine is personally liable for any and all harm. What this means is that vaccine manufacturers, deliverers, and the government have zero risk, while the people retain all the physical, mental, medical, and financial liability. This is a true government coup d’état, in that the human lab animals take all the risk, contract all the sickness, disease and even face death, and also pay for all the damages.
While the political class will crow loudly about this not being mandatory, they will at the same time threaten every single individual that does not bow down to the state and take this vaccine. Those threats will be brutal, and meant to destroy any that do not comply. So this vaccine will really be mandated in that those that disobey will be abused, and attempts by the government to force consent will be completely inhumane. The ability to get daily necessities including food will be eliminated, as will most all travel, working and supporting family without an immunization pass, gaining medical care, access to any service, all public entertainment and activities, and most anything vital to life. Does this sound voluntary to you?
But this experimentation will not end here, but will also continue as long as the people allow it to continue. There will be new experimental vaccines, new updated injections, injectable nanoparticles, chips, property confiscation and redistribution, RNA and DNA experimentation, universal basic income, governmental digital money, tracking devices, and many other intrusions said to be necessary for any citizen wanting to be able to move about or function in any ‘new normal’ manner. So long as the people comply with these orders, the list of demands by the state will be innumerable.
We are all facing one giant experiment where the powerful controlling ‘elites’ and their pawns in government are the mad scientists, and the common masses are the lab animal test subjects.
There is only one answer to this madness: Disobey every government order and be prepared to defend at all costs your life, your family, your property, and your freedom!
“The enrichment center would like to announce a new employee initiative of forced voluntary participation.
If any Aperture Science employee would like to opt out of this new voluntary testing program, please remember; science rhymes with compliance.
“Catherine Austin Fitts… outlines the dangers of the Reset Regime — as they move forward with a transhumanist agenda that sees humanity as a resource to be harvested and is seeking to merge with AI robotics. Catherine tells us the technocrat takeover is here and is using every emergency to prevent the public from waking up to their plans. And those plans call for full spectrum dominance. Are we already at war with a globalist syndicate that’s consolidating power on earth and in space?…”
###
Dark Journalist Daniel Liszt:
“Catherine, it seems like you’re spelling out their end game here. There’s a kind of shock and awe that we’re seeing that’s being deployed by the globalist syndicate. How do you see this all playing out?”
Catherine Austin Fitts:
“Right now we have two different visions. And one vision is a vision of life and living things where we are connecting and resonating electromagnetically with all life — with the birds, with the trees, with each other. Okay?
What they’re trying to implement is a system where there’s no…life is not allowed to resonate. You’ve got to social distance, you’ve got to wear a mask, your body has to be filled with little things that allow you to be a receiver, you’ve got to walk around with your surveillance device, and be mind controlled. And they’re trying to to break all life down into something that can resonate with their machine — and can be hooked up on the AI and software and it can teach the robots how to do all the human jobs. you know.
And basically they’re trying to take all the connections in life and put a toll booth between them and re-circuit the thing into their machine.
Now, if you look at the design of what they’re trying to do, it’s hard for most people because it’s… if you understand life, it’s so psychopathic it’s unbelievable. And you got to give them credit because the hubris is off the charts.
But that’s what it’s about…
Part of the issue of sovereignty is our…not just our physical body sovereign, our mind sovereign, but is our electromagnetic space sovereign. Right? Because a lot of the manipulation is working through this. They are trying to assert electromagnetic control of our body and our intelligence…”
Stopping The Technocrat Takeover & Reset Regime!
***Catherine points out that the number one problem in America today is Mind Control!
Dark Journalist Daniel Liszt welcomes Former Asst. HUD Secretary and Solari Report Publisher Catherine Austin Fitts to the show for a breakthrough Interview of the Globalist Agenda being rolled out through the World Economic Forum.
Catherine sees a totalitarian regime in charge of the “great reset” with the central controllers trying to keep humanity from discovering our personal power to stop them and make our own future.
[As a service to protect truth from censorship & to share widely, mirrored copies of this video are available at Truth Comes to Light BitChute, Brighteon, Lbry/Odysee channels. All credit, along with our sincere thanks, goes to the original source of this video. Please follow links provided to support their work.]
“Look! You fools! You’re in danger! Can’t you see? They’re after you! They’re after all of us! Our wives…our children…they’re here already! You’re next!” —Dr. Miles Bennell, Invasion of the Body Snatchers (1956)
The nation is being overtaken by an alien threat that invades bodies, alters minds, and transforms freedom-loving people into a mindless, compliant, conforming mob intolerant of anyone who dares to be different, let alone think for themselves.
However, while Body Snatchers—the chilling 1956 film directed by Don Siegel—blames its woes on seed pods from outerspace, the seismic societal shift taking place in America owes less to biological warfare reliant on the COVID-19 virus than it does to psychological warfare disguised as a pandemic threat.
As science writer David Robson explains:
Fears of contagion lead us to become more conformist and tribalistic, and less accepting of eccentricity. Our moral judgements become harsher and our social attitudes more conservative when considering issues such as immigration or sexual freedom and equality. Daily reminders of disease may even sway our political affiliations… Various experiments have shown that we become more conformist and respectful of convention when we feel the threat of a disease… the evocative images of a pandemic led [participants in an experiment] to value conformity and obedience over eccentricity or rebellion.
This is how you persuade a populace to voluntarily march in lockstep with a police state and police themselves (and each other): by ratcheting up the fear-factor, meted out one carefully calibrated crisis at a time, and teaching them to distrust any who diverge from the norm.
This is not a new experiment in mind control.
The powers-that-be have been pushing our buttons and herding us along like so much cattle since World War II, at least, starting with the Japanese attacks on Pearl Harbor, which not only propelled the U.S. into World War II but also unified the American people in their opposition to a common enemy.
That fear of attack by foreign threats, conveniently torqued by the growing military industrial complex, in turn gave rise to the Cold War era’s “Red Scare.” Promulgated through government propaganda, paranoia and manipulation, anti-Communist sentiments boiled over into a mass hysteria that viewed anyone and everyone as suspect: your friends, the next-door neighbor, even your family members could be a Communist subversive.
The 9/11 attacks followed a similar script: a foreign invasion mounts an attack on an unsuspecting nation, the people unite in solidarity against a common foe, and the government gains greater war-time powers (read: surveillance powers) that, conveniently enough, become permanent once the threat has passed.
The government’s scripted response to the COVID-19 pandemic has been predictably consistent: once again, in order to fight this so-called “foreign” foe, the government insists it needs even greater surveillance powers.
As we’ve seen since 9/11 and more recently with the COVID lockdowns, those in power have always had a penchant for enacting extreme measures to combat perceived threats. However, unlike the modern America police state, the American government circa the 1950s did not have at its disposal the arsenal of invasive technologies that are such an intrinsic part of our modern surveillance state.
Today, we are watched and tracked 24/7; data is collected on us at an alarming rate by governmental and corporate entities; and with the help of powerful computer programs, American domestic intelligence agencies sweep our websites, listen in on our telephone calls and read our text messages at will.
Now with the COVID pandemic and its offshoots such as contact tracing and immunity passports, the governmental landscape is even more invasive.
Yet no matter the threat, the underlying principle remains the same: can we hold onto our basic freedoms and avoid succumbing to the soul-sucking dredge of conformity that threatens our very humanity?
This conundrum is at the heart of the 1956 classic Invasion of the Body Snatchers, which was based on a 1954 science fiction novel by Jack Finney (and later remade into an equally chilling 1978 film by Philip Kaufman).
Body Snatchers not only captured the ideology and politics of its post-war era but remains timely and relevant as it relates to the worries that plague us today. Filmed with only seven days of rehearsal and 23 days of actual shooting, Body Snatchers is considered one of the great science fiction classics.
Body Snatchers is set in a small California town which has been infiltrated by mysterious pods from outer space that replicate and take the place of humans who then become conforming non-individuals. Miles Bennell, the main character, is a local doctor who resists the invaders and their attempts to erase humanity from the face of the earth.
At the very least, the film conveys a double meaning, serving as both a mirror of a particular moment in history and a compass pointing to a growing societal illness. Following World War II with the emerging military empire, the atomic bomb and the Korean War, Americans were confused and neurotically preoccupied with domestic threats, the polio pandemic and international political events, not much different from today’s populace preoccupied with domestic and international political drama, terrorism and the COVID-19 pandemic.
Yet Siegel’s film delves beneath the surface to confront an even more sinister threat: the dehumanization of individuals and the horrifying possibility that humanity could become infused as part of the societal machine.
Central to the film is one key speech delivered by Bennell while hiding from the aliens:
In my practice, I see how people have allowed their humanity to drain away…only it happens slowly instead of all at once. They didn’t seem to mind…. All of us, a little bit. We harden our hearts…grow callous…only when we have to fight to stay human do we realize how precious it is.
As Siegel makes clear, it is not Communists or terrorists or even viral pandemics that threaten our well-being. The real enemy is invasive governmental measures—something we now see happening across the country—and, thus, totalitarian conformity. And resistance must be against all government measures that threaten our civil liberties and against all kinds of conformity, no matter the shape, size or color of the package it comes in.
When all is said and done, however, the real threat to freedom (in the fictional world of Body Snatchers and in our present-day America) is posed by an establishment—be it governmental, corporate or societal—that is hostile to individuality and those who dare to challenge the status quo.
The mob hysteria, sense of paranoia, fascist police and the witch hunt atmosphere of the film mirror the ills of a 1950s America that is frighteningly applicable to present American society.
Acknowledging that Body Snatchers portrayed the conflict between individuals and varied forms of mindless authority, Siegel stated, “I think the world is populated by pods and I wanted to show them.” He explained:
People are pods. Many of my associates are certainly pods. They have no feelings. They exist, breathe, sleep. To be a pod means that you have no passion, no anger, the spark has left you…of course, there’s a very strong case for being a pod. These pods, who get rid of pain, ill-health and mental disturbances are, in a sense, doing good. It happens to leave you in a very dull world but that, by the way, is the world that most of us live in. It’s the same as people who welcome going into the army or prison. There’s regimentation, a lack of having to make up your mind, face decisions…. People are becoming vegetables. I don’t know what the answer is except an awareness of it.
All of the threats to freedom documented in my book Battlefield America: The War on the American People came about because “we the people” stopped thinking for ourselves and relinquished control over our lives and our country to government operatives who care only for money and power.
While the specific game plan for turning things around is complicated by a police state that wants to keep us at a disadvantage, the solution is relatively simple: Don’t be a pod person. Pay attention. Question everything. Dare to be different. Don’t follow the mob. Don’t let yourself become numb to the world around you. Be compassionate. Be humane. Most of all, think for yourself.
“The timid civilized world has found nothing with which to oppose the onslaught of a sudden revival of barefaced barbarity, other than concessions and smiles.”
~ Aleksandr I. Solzhenitsyn, Anne Applebaum (2007). “The Gulag Archipelago Volume 2: An Experiment in Literary Investigation”, Harper Perennial Modern Classics
It is rather obvious that the wearing of a mask at the demand of the state has become the single signifying behavior that exposes the level of obedience to power that is necessary in order for the ruling class to gain total control. This may seem to be a simplistic analysis, and in many ways it is, but it has served as the most important gauge of the psyche of the average citizen. This gauge has been the basis of many despicable policy decisions made by the rulers and their pawns in government. If the people can be made to obey on command totally ridiculous mandates, orders that are completely illogical on their face, then they can be easily fooled into giving up their freedom. This is done through fear mongering, even in light of the fact that there is nothing to fear. It is all illusion, and therefore it is clear that it is simply a staged ploy meant to gain acquiescence from the masses, so that power can be gained and control solidified.
Just yesterday, the possible new president, Joe Biden, said he would ask all Americans to wear masks for 100 days once elected. This would serve as a federal expansion of the local mask commands to further gauge the public’s obedience level, so as to better understand how far the government could push its agendas. So far, those agendas have advanced almost unimpeded, and at lightening speed, and this is set to continue. With any additional compliance by even more Americans, they would show that they were ripe for even greater and more restrictive tyranny. This sounds almost like a game. Biden told the Communist News Network (CNN) that “he believed there would be a “significant reduction” in Covid-19 cases if every American wore a face covering.” This statement is asinine on its face! He also said he would order masks to be worn in all government buildings. While there is no apparent legal authority for a president to force mask wearing, the consequences of such action as threatened would certainly encourage the useless governors and all other local politicians to expand enforcement. This would serve as a recipe for much additional restriction and regulation.
There is no evidence whatsoever that wearing a mask can protect against any viral agent, and even the evil Fauci stated on 60 Minutes last March that: “There’s no reason to be walking around with a mask. Face masks might make people “feel a little bit better,” but they simply don’t protect people and, instead, bring “unintended consequences.” “When it comes to preventing coronavirus, public health officials have been clear: Healthy people do not need to wear a face mask to protect themselves from COVID-19.” In reality, wearing masks depletes vital oxygen, impedes breathing, increases intake of expelled carbon dioxide, causes extreme stress, harms the immune system, and increases the risk of sickness and the possibility of viral replication in the body. In other words, no healthy person should ever be wearing a mask, especially long term.
Once one has proper and truthful information, it should be abundantly clear that mandated mask wearing is nothing more than a test to determine the weakness and gullibility of the people at large. But this test, insisted on by government agents, and meant only to judge the compliance level of its citizens, does deadly harm. This is and has been known by the government advocates of these policies all along. There is much liability here, and the public should hold these criminals to account. One way to stop tyranny is to reverse the risk by placing it on the perpetrators of this fraud. Many should be jailed!
One way to understand what mask wearing is all about, is to just look around. As I go about my normal business, and travel around the state and country, I see mass acceptance of wearing masks. At times, I am the only one not sporting some sort of face covering. Many have on filthy masks; masks that are very loose, masks worn below the nose and at times even below the mouth. Others have a loose bandana, or one of the wide-open face shields. No one is protected, and in fact is making himself more susceptible to sickness by donning these worthless face diapers. If any actually thought that a contagious and deadly killer virus was evident, they would never leave their house in the first place for fear of death. It is as if most are just trying to fit in, to not rock the boat, and to not have any conflict. They do this with the understanding that there is really nothing to fear, but they take orders anyway because they are terrified to be different. This attitude by the herd is well known to the ruling class, and that is much of the reason that this mask nonsense has been successful.
The next government test to come to gauge compliance will be much more devastating. This publically accepted mask fiasco has given the powerful ammunition to go to the next step. That next step will be the release of a toxic and virulent vaccine. The mask wearing has been very harmful in many ways, but the vaccine will be deadly.
Consider that all the terror inflicted by the claimed ruling ‘elites’ through their pawns in government has been done in steps over a long period of time. Once the general population accepts minor restrictions, more demanding restrictions will always follow. This fake Covid situation began last February in the U.S. with dire predictions. Once fear was more universal, stronger measures were forthcoming. Then a few lockdowns were mandated, and a national emergency was declared. Once this was in place, the state governors began to also declare emergency status, and began to shut down their states. Next, the demand to close small businesses was nationwide. Social distancing mandates began, and schools were closed. As time went by, more demands and restrictions were ordered, and threats of extension of lockdown policies became common. The ‘casedemic’ was then launched in order to create out of thin air another wave of panic. Mandatory mask wearing and testing became rampant, and now the public is ripe for a killer vaccine.
This was all planned for many years, but this “Great Reset” is now getting closer to fruition every day. Once the next mask mandate comes, and acceptance by this pathetic society is evident, the more dangerous plans will be unleashed.
Take off your mask! Do not put it on again. Refuse to be a stooge for the state, and reverse this devastating plot against humanity. When all take off their masks, the state will become impotent, and will be forced to back down. This will happen because it will indicate mass disobedience, and therefore will help nullify all state orders. Those wearing masks will then be in the minority, while the new non-mask wearers will again be the majority, and then they can still be a part of the herd.
Consider masks the sign of things to come. Wearing them means extreme tyranny, and taking them off means freedom. The choice is yours.
“The doctrine of blind obedience and unqualified submission to any human power, whether civil or ecclesiastical, is the doctrine of despotism.”
~ Sarah Grimke, Angelina Grimke (2015). “On Slavery and Abolitionism: Essays and Letters”, p.97, Penguin
A NYU professor has filed a lawsuit against a number of his academic colleagues, alleging libel after an uproar of official reaction ensued when one of his students called for his firing based on in-class comments he had made on the utility of masks.
The pleadings, filed in the Supreme Court of the state of New York on November 30, 2020, stated that a letter signed by nineteen of Professor Mark Crispin Miller’s academic colleagues included “numerous misstatements of ‘fact’ maliciously intended to portray plaintiff in a negative light” and intended to “diminish, if not destroy, his professional reputation and standing.”
In a modern day rendition of the silencing of Socrates, the furor surrounding Professor Miller began shortly into this semester at New York University. Miller has for many years taught a course on propaganda in the Department of Media, Culture and Communication, in which he discusses current events and historical trends in the light of their propagandist purposes. This semester, he states he had encouraged students to research the scientific utility of masks.
One student took public issue with Miller’s mask comments and launched a Twitter campaign against him, stating that he was “spouting dangerous rhetoric that serves to cultivate fear and confusion during a pandemic” and called for his firing.
I hope @nyuniversity, @nyusteinhardt, and @mccNYU agree that this professor should not be trusted with educating and advising students, and I hope they take immediate steps to relieve him of these duties. 8/
First, his department chair, Rodney Benson, tweeted his thanks, saying “We as a department have made this a priority, and are discussing next steps.”
At that point, the University disseminated a cautionary email to Miller’s students, which he states was sent out prior to any conference or consultation as to the veracity of Jackson’s claims. According to Miller, Department Chair Benson then pressured him to cancel the propaganda course for next semester.
A month later, the letter from Miller’s colleagues, condemning Miller’s actions, was sent to Dean Jack Knott and to Provost Katherine Fleming.
And Miller became the subject of a review board hearing.
Professor Miller’s political activities and viewpoints have sparked prior attention from NYU. An effort spearheaded by Miller to stop a physical expansion by NYU ended up in court, several years ago. He is also a named plaintiff in a class action suit concerning NYU’s mismanagement of the faculty’s retirement plans.
Earlier this year, Miller was called in to the Office of Equal Opportunity to explain some comments he had made in articles concerning transgender politics, including this one. Miller has unequivocally stated that he bears no animus towards transgender individuals and that his comments reflected concerns that the transgender movement had eugenics implications. He was quickly exonerated by the OEO concerning these statements.
Interestingly, the letter from the NYU colleagues to the University tries to resurrect these concerns and states that Miller has engaged in “direct mockery and ridicule of trans individuals” as well as “discrimination” and that he has created “an unsafe learning environment.” While paradoxically stating their support for academic freedom, the signers of this letter, all of whom are academics “…call on Steinhardt and University leadership to publicly support the NYU community and undertake an expedited review, as per the Faculty Handbook and Title IV, of Professor Miller’s intimidation tactics, abuses of authority, aggressions and microaggressions, and explicit hate speech, none of which are excused by academic freedom and First Amendment protections.” Curiously, the letter gives no concrete examples to support these allegations.
“When wearing a mask, most of us breathe with our upper chest muscles and with our mouth open,” states Children’s Minnesota on their website. While the hospital admits this can cause “increased stress and anxiety” there are other more long-lasting concerns.
According to a paper, in the peer-reviewed journal General Dentistry, “children’s whose mouth breathing is untreated” may develop the following deformities:
long, narrow faces
narrow mouths
high palatal vaults
misalignment between the teeth of the two dental arches
gummy smiles
As well as “many other unattractive facial features.”
Yet, how many children are being taught how to breathe while wearing a mask? Instead, many (if not most) are sucking in air through their mouth, as an instinctual reaction to the rise in carbon dioxide. This lowers the position of their tongue, which is key factor in normal facial development.
As the author of the paper, Dr. Yosh Jefferson, DMD, states: “If mouth breathing is treated early, its negative effect on facial and dental development and the medical and social problems associated with it can be reduced or averted.”
Instead, face masks may very well exacerbate the problem leading to a generation of deformed children. Because, it’s not just the mouth breathing. How will a growing face and two developing ears respond to a muzzle stretched around it for hours each day?
John C. A. Manley has spent over a decade ghostwriting for medical doctors, as well as naturopaths, chiropractors and Ayurvedic physicians. He publishes the COVID-19(84) Red Pill Posts – an email-based newsletter dedicated to preventing the governments of the world from using an exaggerated pandemic as an excuse to violate our freedom, health, privacy, livelihood and humanity. You can visit his website at: MuchAdoAboutCorona.ca
Lockdowns Are Based on Fraud: Open Letter to People Who Want Freedom
This article is arranged so you see the fraud in more detail as you read further.
QUICK OVERVIEW
The lockdowns are based on high levels of COVID cases.
“We have so many new cases, we have to lock down.”
This claim is based on the diagnostic PCR test.
The more tests you do, the more positive results come up. A positive result is taken to mean: the person is infected with the virus.
But overwhelmingly, these so-called “infected” people have no symptoms. They are healthy. Nevertheless, each one is called a “COVID case.” This is absurd.
A case should mean the person has clinical symptoms; he is sick.
These people aren’t sick, and there is no indication they will get sick.
So…expand testing, test millions of people, obtain results claiming “infection,” call all these healthy people “cases,” and order lock downs.
This is a straight-out con. The real goal is lockdowns and economic devastation.
IS THE PCR TEST DECEPTIVE?
You need one piece of background here.
The PCR test is run in “cycles.” Each cycle is a quantum leap in amplifying or magnifying the original tiny, tiny piece of material taken from the patient’s swab sample. It’s like blowing up a small photo to an amazing size.
The question is: how many cycles should the PCR test be run at? This is vital issue, because the number of cycles changes the result.
July 16, 2020, podcast, “This Week in Virology” [1]: Tony Fauci makes a point of saying the PCR COVID test is useless and misleading when the test is run at “35 cycles or higher.” A positive result, indicating infection, cannot be accepted or believed.
Here, in techno-speak, is an excerpt from Fauci’s key quote (starting at about the 4-minute mark [1]): “…If you get [perform the test at] a cycle threshold of 35 or more…the chances of it being replication-competent [aka accurate] are miniscule…you almost never can culture virus [detect a true positive result] from a 37 threshold cycle…even 36…”
Too many cycles, and the test will turn up all sorts of irrelevant material that will be wrongly interpreted as relevant.
That’s called a false positive.
What Fauci failed to say on the video is: the FDA, which authorizes the test for public use, recommends the test should be run up to 40 cycles. Not 35.
Therefore, all labs in the US that follow the FDA guideline are knowingly or unknowingly participating in fraud. Fraud on a monstrous level, because…
Millions of Americans are being told they are infected with the virus on the basis of a false positive result, and…
The total number of COVID cases in America—which is based on the test—is a gross falsity.
The lockdowns and other restraining measures are based on these fraudulent case numbers.
Let me back up and run that by you again. Fauci says the test is useless when it’s run at 35 cycles or higher. The FDA says run the test up to 40 cycles, in order to determine whether the virus is there. This is the crime in a nutshell.
If anyone in the White House has a few brain cells to rub together, pick up a giant bullhorn and start revealing the truth to the American people.
“Hello, America, you’ve been tricked, lied to, conned, and taken for a devastating ride. On the basis of fake science, the country was locked down.”
If anyone in the Congress has a few brain cells operating, pull Fauci into a televised hearing and, in ten minutes, make mincemeat out of the fake science that has driven this whole foul, stench-ridden assault on the US economy and its citizens.
All right, here are two chunks of evidence for what I’ve written above. First, we have a CDC quote on the FDA website, in a document titled: “CDC 2019-Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic Panel For Emergency Use Only.” [2] See pdf page 38 (doc page 37). This document is marked, “Effective: 12/01/2020.” That means, even though the virus is being referred to by its older name, the document is still relevant as of Dec 2020. “For Emergency Use Only” refers to the fact that the FDA has certified the PCR test under a traditional category called “Emergency Use Authorization.”
FDA: “…a specimen is considered positive for 2019-nCoV [virus] if all 2019-nCoV marker (N1, N2) cycle threshold growth curves cross the threshold line within 40.00 cycles ([less than] 40.00 Ct).”
Naturally, MANY testing labs reading this guideline would conclude, “Well, to see if the virus is there in a patient, we should run the test all the way to 40 cycles. That’s the official advice.”
A disastrous inference.
Then we have a New York Times article (August 29/updated September 17) headlined: “Your coronavirus test is positive. Maybe it shouldn’t be.” [3] Here are money quotes:
“Most tests set the limit at 40 [cycles]. A few at 37.”
“Set the limit” would usually mean, “We’re going to look all the way to 40 cycles, to see if the virus is there.”
The Times: “This number of amplification cycles needed to find the virus, called the cycle threshold, is never included in the results sent to doctors and coronavirus patients…”
Boom. That’s the capper, the grand finale. Labs don’t or won’t reveal their collusion in this crime.
Get the picture?
IS THE PCR TEST USEFUL AND MEANINGFUL?
Now let’s go to published official literature, and see what it reveals. Spoiler alert: the admitted holes and shortcomings of the test are devastating.
From “CDC 2019-Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic Panel For Emergency Use Only.” [2]:
“Detection of viral RNA may not indicate the presence of infectious virus or that 2019-nCoV is the causative agent for clinical symptoms.” (doc page 40)
Translation: A positive test doesn’t guarantee that the COVID virus is causing infection at all. And, ahem, reading between the lines, maybe the COVID virus might not be in the patient’s body at all, either.
From the World Health Organization (WHO): “Coronavirus disease (COVID-19) technical guidance: Laboratory testing for 2019-nCoV in humans”:
“Several assays that detect the 2019-nCoV have been and are currently under development, both in-house and commercially. Some assays may detect only the novel virus [COVID] and some may also detect other strains (e.g. SARS-CoV) that are genetically similar.”
Translation: Some PCR tests register positive for types of coronavirus that have nothing to do with COVID—including plain old coronas that cause nothing more than a cold.
The WHO document adds this little piece: “Protocol use limitations: Optional clinical specimens for testing has [have] not yet been validated.”
Translation: We’re not sure which tissue samples to take from the patient, in order for the test to have any validity.
From the FDA: “LabCorp COVID-19RT-PCR test EUA Summary: ACCELERATED EMERGENCY USE AUTHORIZATION (EUA) SUMMARYCOVID-19 RT-PCR TEST (LABORATORY CORPORATION OF AMERICA)” [5]:
“…The SARS-CoV-2RNA [COVID virus] is generally detectable in respiratory specimens during the acute phase of infection. Positive results are indicative of the presence of SARS-CoV-2 RNA; clinical correlation with patient history and other diagnostic information is necessary to determine patient infection status…THE AGENT DETECTED MAY NOT BE THE DEFINITE CAUSE OF DISEASE (CAPS are mine). Laboratories within the United States and its territories are required to report all positive results to the appropriate public health authorities.”
Translation: On the one hand, we claim the test can “generally” detect the presence of the COVID virus in a patient. But we admit that “the agent detected” on the test, by which we mean COVID virus, “may not be the definite cause of disease.” We also admit that, unless the patient has an acute infection, we can’t find COVID. Therefore, the idea of “asymptomatic patients” confirmed by the test is nonsense. And even though a positive test for COVID may not indicate the actual cause of disease, all positive tests must be reported—and they will be counted as “COVID cases.” Regardless.
From a manufacturer of PCR test kit elements, Creative Diagnostics, “SARS-CoV-2 Coronavirus Multiplex RT-qPCR Kit” [6]:
“This product is for research use only and is not intended for diagnostic use.”
Translation: Don’t use the test result alone to diagnose infection or disease. Oops.
“non-specific interference of Influenza A Virus (H1N1), Influenza B Virus (Yamagata), Respiratory Syncytial Virus (type B), Respiratory Adenovirus (type 3, type 7), Parainfluenza Virus (type 2), Mycoplasma Pneumoniae, Chlamydia Pneumoniae, etc.”
Translation: Although this company states the test can detect COVID, it also states the test can read FALSELY positive if the patient has one of a number of other irrelevant viruses in his body. What is the test proving, then? Who knows? Flip a coin.
“Application Qualitative”
Translation: This clearly means the test is not suited to detect how much virus is in the patient’s body. That’s another indication that the test is useless for determining whether the patient is ill—since millions and millions of virus must be present, in order to produce illness.
“The detection result of this product is only for clinical reference, and it should not be used as the only evidence for clinical diagnosis and treatment. The clinical management of patients should be considered in combination with their symptoms/signs, history, other laboratory tests and treatment responses. The detection results should not be directly used as the evidence for clinical diagnosis, and are only for the reference of clinicians.”
Translation: Don’t use the test as the exclusive basis for diagnosing a person with COVID. And yet, this is exactly what health authorities are doing all over the world. All positive tests must be reported to government agencies, and they are counted as COVID cases.
Those quotes, from official government and testing sources, torpedo the whole “scientific” basis of the test.
CONCLUSION: The PCR test is useless and deceptive. It provides de facto dictators the opportunity to cite “new case levels” and lock down populations, creating economic and human devastation.
RESIST, REBEL, PROTEST, OPEN UP THE ECONOMY ANY WHICH WAY YOU CAN.
For months, I’ve been demonstrating that no one has proved SARS-CoV-2 exists (start here).
Instead, elite planners have been selling A STORY ABOUT A VIRUS.
In covert intelligence operations, this would be called a cover story. It obscures true goals. It justifies crimes that would otherwise be nakedly exposed.
In a really large covert op, the cover story hides a number of goals and justifies a number of crimes.
For example, in my 1988 book, AIDS INC., I showed how the cover story about HIV was used in Africa.
For a very long time, the true causes of illness and death in areas of Africa were: hunger; protein-calorie malnutrition; starvation; poverty; war; good farm land stolen from the people; corporate pollution; toxic medicines and vaccines; toxic pesticides; overcrowding in cities; lack of basic sanitation.
Most if not all of these causes could have been eliminated. But local governments did not want healthy people. Sick and dying people were easier to control.
Colluding with, and paying off, local government leaders, transnational corporations set up shop in these African countries and used the healthier people to work on their giant commercial farms and in their factories.
But in 1984, suddenly, there was a new (cover) story broadcast and sold to the world: what was really decimating Africa was HIV. THIS explained all the illness and dying.
The true causes, listed above, were shoved into the background.
Those true crimes were hidden, were permitted to continue unabated.
Not only that, the HIV cover story paved the way for pharmaceutical companies to rack up profits by selling extremely toxic AIDS drugs (e.g., AZT) to Africa.
The HIV test, which turned out false positives like Niagara Falls, made these drugs seem necessary—as fake case numbers soared.
People dying from the toxic medical treatments were, of course, listed as AIDS deaths.
Sound familiar?
These days, the coronavirus cover story obscures crimes according to the same general pattern.
EVERYONE is considered an agent of potential infection. Therefore, a new Chinese strategy: universal lockdowns.
COVID-19 is essentially an intelligence-agency type covert op.
The short-term goal is wrecking economies. The long-term goal is taking the population into a new world of technocratic control.
Selling this as necessary all comes back to THE VIRUS COVER STORY.
“We’re not forcing technocracy down the throats of the people. Certainly not. We’re simply doing what we must, because of the danger of the virus…”
There is another routine element in covert operations: FALSE TRAILS.
These are embellishments on the basic story, promoted to hide the fact that the cover story is a lie. The aim in 2020 is: get people arguing about the nature and origin and composition of the virus.
Why? Because as long as people are arguing about these issues, they are re-enforcing the idea that the virus exists and is dangerous. Thus, the basic cover story is strengthened.
“Sowing dissension in the ranks” is another aspect of false trails. A classic example is the JFK assassination, and the myriad accusations that have been flung between independent researchers, each of whom has a different explanation for the murder of the president.
This past spring, there was a period when such accusations were breaking out among independent COVID investigators. As a result, there was no unanimity about the tyrannical nature of the lockdowns. Thankfully, that moment of ill-will seems to have passed.
Always identify and return to the cover story. Walk around it. Look at it from all sides. Walk into it from one side and exit from the other. Test it. The vital clues are there.
Another classic example: 2009, La Gloria, Mexico. Smithfield Foods, the largest pork producer in the world, operates a giant pig farm. 950,000 pigs.
The urine and feces from these 950,000 pigs run out into the open air and forms what are called lagoons. They’re so large, you can see them from outer space.
Workers spray the toxic lagoons with a toxic foam. It’s routine.
Workers, and people in the surrounding neighborhood, are getting sick and dying. So new contractors are brought in to spray the lagoons with yet another toxic chemical.
Out of nowhere, guess who shows up? The CDC.
Guess what they conclude? It’s not the urine and feces lagoons or the toxic chemicals causing illness and death. No. Of course not.
It’s a new mysterious virus. H1N1.
And voila, we have a new cover story and a new epidemic, called Swine Flu.
The cover story serves a number of purposes, as time passes. But the most obvious one is: Smithfield Foods is protected. They get away with murder.
And to cap it all off, four years later, in 2013, Smithfield, still protected, sells itself to a Chinese company, Shuanghui International Holdings, for $4.72 billion.
Makes you wonder. I can imagine a few Chinese intelligence professionals sitting in a room in Beijing, in 2013, expressing astonishment. “Can you believe the CDC? They sold a cover story about a virus that was so ridiculous…but it worked. Suppose we followed suit, but on a grand scale? We claim an outbreak is occurring in one of our cities. We invite the CDC and the World Health Organization to come in and help. There is no virus, but we know they’ll ‘find a new one.’ They always do. Then, boom. We do something no one has ever done before. We lock down 50 million people overnight and provide a model to the rest of the world. Other countries line up and lock down their populations, wrecking their economies. Meanwhile, we announce China has ‘recovered,’ we cancel our lockdowns and put everybody back to work. It’s a war with no shots fired, and we win. Do you think we could pull it off? Do you think we could sell it? Maybe we should talk to Bill Gates. He’s a smart guy. He always has interesting ideas…”
To Those Who Are Masking Themselves, Holding Their Breath, Cooperating With Practices That Damage the Brains of Children, Harm Themselves and Break Down Society
And when you wear masks just to be nice, just to go along like the woman in the video, you’re training everybody, you’re training the next generation. And, therefore, the controllers, the ones that know all of these experiments and understand human nature because it’s been there whole job for 70, 80, a hundred years to study human nature, they will count on you to train the next generation. There won’t even have to be a law or a rule. It’s just what people do. We just wear masks for some reason. We don’t get to see each others faces. We don’t get to breathe healthy air. We stew in our own juices. We compromise our immune system. You see whay they’re not bringing in actual laws about this. They don’t need to. You will train the next generation.
And you might be saying to yourself “Well, no, no, listen. There is a bad virus and people have a right to be safe from it.” You might be thinking that way in a collectivized, hive mind, mind set. You think to yourself, “Well, you know, I don’t know. I don’t know what to believe, so better safe than sorry. Plus it’s really just no big deal to me. I’ll just slap on this mask when I run into the store. That way I don’t have to argue with anyone. That way the people who really are scared aren’t scared of me.” … This is what you’re saying to yourself. I know. But what about the people who aren’t scared, the people who know the facts? Don’t we get any shake in this society anymore? Are we going to just change everything we do to please people who are of X, Y, Z? What’s next? What is next? What else will you do for people who are afraid? They’ve already conditioned us for this — through myriad of means…
###
Somehow, we flipped everything on its head… We can’t make all of society change their habits for your weakness. Otherwise, we have to do that for everyone.
If you want a future for yourself or your children, stop wearing the masks.
I go over the experiments they have run on us vis a vis social conformity and I try to show that even science has been corrupted by the force of “group consensus.”
You have to stand on your own two feet and not cave to the pressure of what everyone else is doing. It’s too important.
[As a service to protect truth from censorship & to share widely, mirrored copies of this video are available at Truth Comes to Light BitChute, Brighteon, Lbry/Odysee channels. All credit, along with our sincere thanks, goes to the original source of this video. Please follow links provided to support their work.]
[As a service to protect truth from censorship & to share widely, mirrored copies of this video are available at Truth Comes to Light BitChute, Brighteon, Lbry/Odysee channels. All credit, along with our sincere thanks, goes to the original source of this video. Please follow links provided to support their work.]
The year 2020 has been exemplary for those that believe obedience is a high virtue.
The go-along-to-get along sentiment that began as a seemingly innocent response to an unknown viral enemy in late winter, began to take on a new tone by early spring.
Two weeks to flatten the curve in order to give hospitals a chance to organize for what was projected to be an overwhelming number of patients, turned into something more permanent.
Unprecedented lockdowns, heeded by the urgent warnings and pressure from China, were mimicked first in Italy, and then spread, like a plague, to the rest of the western world.
These draconian measures usurped the global population, as we were told that this was for the greater good, and the only way to end the restrictions was to obey the contradiction; to adhere to them at all costs, without exception.
Men of all ages and occupations, educations and backgrounds were recruited into the experiment.
Men in white coats stepped onto the podium, former strangers who did not bother to introduce themselves, but instead began by telling us to be comforted by their presence.
We assumed they were the experts.
We were soon divided into two groups, the teachers and the learners.
The teachers were given clear instructions by the Whitecoats as to what they needed to do next, but not before they were given a small taste of the punishment that those on the other side would receive. They were introduced to a small dose of pain that would stimulate in them the seed of fear, as to what could happen to them if they were to get it “wrong”.
They dutifully followed the instructions of the Whitecoats, and began to adjust to the strange experiment.
(IMAGES of the new normal, masks, etc)
It was hard to tell the teachers apart from the learners at first, since they had no prior reasons not to get along. But gradually, something began to change.
The teachers, like a good pupil, adhered closely to the words of the Whitecoats, and looked to them reassuringly to keep doing what they were doing. They proudly played their part, conforming to the rules and regulations set by the whitecoats.
They adapted to their new positions as educators to their counterparts, and continued to point out, with ever-increasingly painful punishments, when the learners said the wrong things.
The learners began to protest the injustice and the suffering. They wanted out of the experiment. They knew at this point, that there was nothing normal about it. Things had gone too far.
Some of the teachers wanted out too. They never wanted things to go this far, but they didn’t know how to get out of the situation they were in.
Despite knowing that something didn’t sit quite right with them, they still felt compelled to listen to instruction, and carry on obeying, in hopes that it would soon be over.
They deceived themselves into abdicating responsibility to the ones handing down orders. They lost sight of their individual choices in life, instead mindlessly doing as they were told, becoming complicit in the whole affair.
Becoming more emboldened with their unprecedented new reign of authority, and the consent of the majority, the Whitecoats pushed on harder. They kept the narrative going, imposing harsher conditions on all involved in the experiment, and encouraged the teachers to punish the learners if they continued to get it wrong.
At this point, the atrocious results of this experiment were impossible to ignore.
The learners began to protest more loudly, their suffering having become unbearable. They were fighting for their livelihoods, their freedom, their pulse.
But the louder their cries, the more their counterparts turned a blind eye. At this point, they had given up all responsibility for the outcome of their involvement, becoming completely submissive to authority as their fellow man’s cries became inaudible to them.
With the new normal affirmed by the consent of the majority, the Whitecoats successfully created a cognitive dissonance so strong in the population that they could no longer clearly see the difference between right and wrong. With a distorted sense of reality and loss of ownership over ones own identity, it was now easy to suggest that what was true yesterday, was no longer allowed to be remembered today.
With all of the old systems being replaced by the use of masks, social distancing, the new normal, bubbles, online classrooms, isolation and fear, snitching and social unrest, it would leave this traumatized control group reeling from something they did not sign up for.
What was happening to society? What was wrong with these people? How did things completely and inexorably fall apart in such a short amount of time?
Were the teachers evil? Were the learners deserving to be punished? Was there something wrong with either group? Or were they purposefully manipulated like puppets in order to play out a scenario that they were not psychologically prepared to handle?
The momentum of 2020’s psychological experiment combined with what Carl Jung might have referred to as the collective unconscious shadow of contemporary society, bring to mind a quote by Aleksandr Solzehnitzen, Nobel author of The Gulag Archipelago:
“If only there were evil people somewhere insidiously committing evil deeds, and it were necessary only to seperate them from the rest of us and destroy them. But the line dividing good and evil cuts through the heart of every human being, and who is willing to destroy a piece of his own heart?”
Is it possible that a malevolent authority could exist, not only in the history books, but in the very present times? Is it possible that you might not know what was actually going on, that you might have the wool pulled over your eyes, and that perhaps the trust in higher authority you took for granted might be wielded as a weapon against you?
“Disobedience is the true foundation of liberty. The obedient must be slaves.” ~ Henry David Thoreau (2006). “Thoreau and the Art of Life: Precepts and Principles”, p.23, Heron Dance Press
There is one thing that is perfectly clear about this predicament we are in today concerning the tyrannical takeover of this country and the world by the controlling few. That is that the people of this country are their own worst enemy, and have no claim to the ‘victim’ argument, because all their problems are self-induced. Every order taken has been voluntary, and that idiotic behavior has led to disaster and death. The powerful have not used guns and bombs to gain the submission of the American people; the people simply did as they were instructed, down to destroying their livelihoods, harming their own families, hiding under their beds, wearing deadly masks, and allowing their lives to lose all meaning. Cowardice at this level is so pathetic as to border on insanity. What happened to this society to make the inhabitants act in such a pitiful and sorry manner? Is it simply fear? I think not, as real fear drives people to protect themselves, not voluntarily allow for their own slavery and death.
But there is much more to this mob reaction than meets the eye. Most of the people in this country not only comply with every single draconian mandate, but also demand that others do so as well. This means that most of the citizenry are not only destroying themselves, but also wish to inflict the same result on everyone else, especially those courageous dissenters with brain cells and the ability to see through this deception. This gives new meaning to the idea of the herd choosing ‘equality’ by wanting everyone to be slaves, so that they can continue to wallow and complain about their chosen lot in life while hoping for their rulers to save them by dominating them. What this exposes is that many of your neighbors are your enemy more so than any government. The people themselves are to blame for this travesty.
It is brutally obvious that this general population cannot see past a television screen locked on to CNN or Fox, and since both sides of the political spectrum believe almost identically, what chance is there of any awakening by large numbers of people? It seems that the ruling members of society have carte blanche in their efforts to complete this communistic and technocratic takeover, because not only is there little if any real resistance to autocratic rule, but the sheep are actually helping those that wish to control them. They have become the state, as they promote tyranny against all, and are willing to monitor and surveil their neighbors on behalf of the government. This country has become a breeding ground for state sponsored stooges. The term that “people are basically good” has been turned on its head!
The lockdowns alone are responsible for massive death and destruction, and are now being ramped up around this country and the world in gleeful anticipation of the coming flu season. The upcoming holidays will be used as fodder to blame all those who wish to be with family and friends for causing new outbreaks of a fake virus, this while the state’s favored donors like Walmart, Costco, Amazon, and many other claimed ‘essential’ businesses, will welcome millions into their stores while commoner’s businesses will be closed due to the bogus risk of spreading a fake virus. New orders, mandates, sanctions, and decrees are coming very soon, and any that wish to enjoy the holidays will be cursed for their selfish desires by the state and their neighbors as well.
The state and every single person supporting the state are fully responsible for all the carnage happening today. Massive poverty is upon us, as purposely-created food shortages are causing great havoc. Loss of income due to shutdowns is literally taking food out of the mouths of children worldwide. Government lockdowns have devastated most of this population, and caused job loss, destruction of livelihoods, and tremendous psychological damage. Suicides are completely out of control, and getting worse every day, all caused by the response to this false flag coup called Covid.
We are living in a time of madness, of murder, of brutality, of indifference, and of the planned destruction of this country and the human spirit. Those involved in this fraud should be held accountable, and this includes not only the self-claimed ‘elite’ controllers, but also the government at every level, and all those that are supporting or calling for lockdowns, mandated vaccines, or any isolation measures whatsoever. Any defending, justifying, and assisting government in these efforts are promoting the deaths of millions of people around the world. Their blood is on your hands!
I will never forget those that are responsible for this carnage, or any citizen that assists the state in its efforts to destroy humanity. As children starve, as suicide explodes, as poverty consumes the world, as poisons are forcibly injected into the innocent, as economies are purposely decimated, and as millions die, those that are responsible, those that assist and support this travesty, and those that stand silent, are all to blame, and are guilty of allowing murder, genocide, and abomination. The depth of this evil is limitless.
“Every time I hear a political speech or I read those of our leaders, I am horrified at having, for years, heard nothing which sounded human. It is always the same words telling the same lies. And the fact that men accept this, that the people’s anger has not destroyed these hollow clowns, strikes me as proof that men attribute no importance to the way they are governed; that they gamble – yes, gamble – with a whole part of their life and their so called ‘vital’ interests.” ~ Albert Camus (1978). “Notebooks, 1935-1942”, Harcourt
Is it any wonder that the entirety of our current predicament rests on the lies of the governing system and its ruling accomplices? American governance, all governance in fact, is and has always been susceptible to seeking power and control by means that prove very harmful to the general population. Conspiracy is always evident, and has led to abuses that have included theft, war, killing, imprisonment, torture, and in many cases genocide. In the U.S. today during this false flag event called a ‘virus pandemic,’ we have already seen massive theft in the form of multi-trillion dollar money printing, imprisonment of much of the country through lockdown and isolation mandates, killing of the old and innocent through criminal medical care or lack of medical care, medical martial law, and torture in that many died horrible deaths due to state regulations and procedures. This is a war, but in this case the war is openly being waged against the American public by the very government that most support. Americans have voluntarily allowed its existence, and this is a travesty.
What is likely unknown to most is that this nightmare is just beginning, while the average citizen is still thinking about or hoping for a return to ‘normal.’ Hope and prayer without action will accomplish nothing, but little if any mass dissent and disobedience are evident at this time. The reinstating and acceleration of the tyrannical measures we have seen to date are just around the corner, and with the ‘perfect storm’ of a very weak and unhealthy society with highly compromised immune systems, during what will probably prove to be an especially severe flu season, the sickness and death will all be blamed on a virus that has never been shown to exist. This is astounding, because this information is readily available for any that choose to see, but mass blindness seems to be a real risk we face today. This public blindness is due to ignorance and indifference, and that combination is a recipe for disaster.
There are many agendas being pursued by the self-claimed elites, but the core element of this takeover of society is based on centralizing all power in the hands of the few so that the masses and the world economy can be controlled from the top. This has always been about power and control, and has never been about any risk due to any virus. The fact that no such thing as ‘Covid-19’ has ever been isolated or identified, is staggering to say the least, but this ruse has been fully accepted by the herd, so much so that their very lives and livelihoods have been purposely destroyed due to voluntary compliance. Most have concentrated on being obedient slaves, while becoming fearful of their own family, friends, and neighbors in order to protect themselves from a ‘deadly virus’ that according to the perpetrators of this fraud has a stated survival rate of over 99.8%. In other words, there is no virus threat.
This conspiracy has but one main goal, and that is securing the centralization of power and control over all people and economies in order to achieve global dominance. It is being labeled as ‘The Great Reset,” as described by the very evil Klaus Schwab who is the founder and Executive Chairman of the World Economic Forum. He is tied to Bill Gates, George Soros, and the rest of these inhuman monsters. His and the ruling class ‘elites’ plans for our future are ominous, and currently being accepting by the bulk of this pathetic society. Here are some of his predictions for 2030, which include the United States surrender to the United Nations:
“You’ll own nothing” — And “you’ll be happy about it.”
“The U.S. won’t be the world’s leading superpower”
“You won’t die waiting for an organ donor” — They will be made by 3D printers
“You’ll eat much less meat” — Meat will be “an occasional treat, not a staple, for the good of the environment and our health.”
“A billion people will be displaced by climate change” – Soros’ Open Borders
“Polluters will have to pay to emit carbon dioxide” – “There will be a global price on carbon. This will help make fossil fuels history”
“You could be preparing to go to Mars” — Scientists “will have worked out how to keep you healthy in space.”
“Western values will have been tested to the breaking point.” – “Checks and balances that underpin our democracies must not be forgotten”
He is also a proponent of transhumanism, and has said that nothing will ever return to the ‘broken’ sense of normalcy that prevailed prior to the crisis because the “coronavirus pandemic marks a fundamental inflection point in our global trajectory.” Schwab stated this even though admitting that: “Unlike certain past epidemics, COVID-19 doesn’t pose a new existential threat.” Covid-19 never existed, and never was a threat, but has been the tool used to advance a new world order, or as he calls it, the “Fourth Industrial Revolution.”
Concerning the melding of machines and humans, transhumanism, Schwab spells it out in more detail in “Shaping the Future of the Fourth Industrial Revolution:”
Fourth Industrial Revolution technologies will not stop at becoming part of the physical world around us—they will become part of us. Indeed, some of us already feel that our smartphones have become an extension of ourselves. Today’s external devices—from wearable computers to virtual reality headsets—will almost certainly become implantable in our bodies and brains. Exoskeletons and prosthetics will increase our physical power, while advances in neurotechnology enhance our cognitive abilities. We will become better able to manipulate our own genes, and those of our children. These developments raise profound questions: Where do we draw the line between human and machine? What does it mean to be human?
“We the people” are not a part of this agenda, and are not included in this planning of a new society. We are simply the cattle being prodded and used to sustain the masters. The public makes no decisions, as this plot for gaining technocratic control over all of us has been in the works for many years, but is now going forward at an unimaginable pace, all due to the Covid lie. Everything was planned long ago in secret, but now is being completed and telegraphed out in the open for all to see. This is due to the fact that these manipulating rulers have no fear of the people at large, and believe them too lazy and ignorant to grasp the scope of this totalitarian takeover. Schwab admits this when he writes:
“We must re-establish a dialogue among all stakeholders to ensure mutual understanding that further builds a culture of trust among regulators, non-governmental organizations, professionals and scientists. The public must also be considered, because it must participate in the democratic shaping of biotechnological developments that affect society, individuals and cultures.”
This fake pandemic has supplied what the ruling class calls an opportunityfor a reset of society. When the chosen masters call what they claim to be a deadly risk to all mankind an opportunity, one should stand up and take notice, and should immediately understand that we are all the victims of a terrible coup meant to enslave humanity.
Lockdowns, isolation, masks, economic destruction, digitized monetary restructuring, deadly vaccines, gene-controlling technology, transhuman experimentation, total surveillance, and a totalitarian police state are what the masters you have chosen want for all Americans. They are blatantly claiming that this is the new normal they have chosen for you, but you have a choice. Accept all you are being told and become a slave, or realize that the only pandemic is this claimed “Great Reset” that is being used to eradicate you. Acceptance can only lead to hell in a world consumed by evil.
Available at Computing Forever YouTube and BitChute channels.
Truth Comes to Light editor’s note: Below you will find a transcript of this powerful video by Dave Cullen. The notes in brackets are my description of clips that were not transcribed. Images are screenshots of Dave’s artwork from the video.~ Kathleen
As we’ve previously discussed, you can never appease narcissists. And there’s no amount of appeasement or acquiescing to covid mandates that will satisfy the bully-boy elites in charge of your country.
If you keep playing along with their demands, you can expect more demands. It all comes to a halt when you refuse to comply.
Many people believe that, after the vaccine, life will just return to normal. I’ve been saying for quite a while now, normality was never supposed to return and that an entirely new dystopian normal was being created –through fear, coercion and the slow boiling frog effect — where people are gradually acclimatized over time, through prolonged exposure and adaptation, to a new way of living.
People actually believed that if they did what they were told by the government and the media like good little children then one day they wouldn’t have to wear face masks and do social distancing anymore.
[Here you’ll see a video clip of Fauci interview.]
So there you have it. Social distancing and masks are supposed to continue forever apparently. How did humanity ever exist prior to the implementation of these stringent and totally unnatural and anti-human public health measures?
Now, recently Professor Luke O’Neal spoke to a group of school children.
[Video clip of Professor O’Neal speaking gobbledygook to young captive audience.]
So was that clear? Kind of? Even if you’re vaccinated, you probably will have to wear your mask and social distance for six months until some “r” number thing comes down, but you still might have to wear masks in shops every winter. Okay? Yeah, that was that was clear. Right? Sure.
[More drivel from Professor O’Neal.]
Unbelievable. So he talks about the health passport app to prove that you’re vaccinated, which is basically “show me your papers, please”. And he talked about a wristband alternative. A wristband that can’t come off. And then he makes some remark about how people will complain about their civil liberties. No shit! — considering a person’s right to free movement will be infringed upon. Because if they refuse to take an unnecessary and experimental vaccine, I would imagine there will be quite a few people complaining about their fundamental human rights.
It’s unbelievable but I have been talking about this crap for months now and it seems that some of our worst concerns with respect to rising authoritarianism are actually on the horizon here.
Luke O’Neil also says that students may not be able to go to their debs (for those of you in America that’s the prom here in Ireland) if they aren’t vaccinated.
[More of the same video with innocent children being subjected to the authoritative stupidity of Luke O’Neill.]
So there you have it. You thought your life was going back to normal if you just surrendered all your rights, freedoms and bodily sovereignty for however long the lying government demanded it. Well it depends what you mean by normal. If by normal we mean the mandates and control measures will largely remain in place and everyone has to be vaccinated every year, then yeah, I guess it’s normal. Right?
[Luke O’Neil, ad nauseum.]
Whatever happened to the human immune system? Seriously. Did it just stop working in 2020 or something? What did we do before the pharmaceutical industry came along?
[World Economic Forum’s Klaus Schwab rambles some sort of nonsense.]
So, if you have to get a freedom pass, it means that you’re not free. And they’re admitting that you’re currently not free. Okay? So, that’s not a free society.
A hall pass for life basically. A hall pass to live your life. It is hoped the scheme could allow Britons to go back to a relatively normal life. Relatively meaning not normal. To earn a freedom pass people will need to get a negative test twice a week.
How far away are we from the hunger games at this stage?
Pass will allow you to mix with friends and family without distancing or masks. Again, this has been made possible by the fact that the general public were so utterly terrified, traumatized and bamboozled by fear-mongering for so many months that they actually started to believe that their rights and freedoms come from the government — when, in fact, they don’t. They areinalienable.
So, the government takes everyone’s fundamental rights away and then, in order to get the public to comply with the new abnormal, they tease them by offering to give them back tiny little bits of scraps of their freedom.
You know, they’re kind of bribing them. And the public, being so desperate for a reprieve from all of these oppressive measures, might actually see such freedom passes as a way out.
You can see where this is leading people. They are slowly being conditioned to accept having to negotiate for the right to do things that they previously understood to be indisputable freedoms that the government couldn’t touch. They just took them for granted. Now they’re basically being told to ask the government for permission to just spend time with their friends and family, or being allowed to just forgo social distancing, or masks for a little while.
The general adult population, globally at this stage, appears to have been reduced to an infantilized state — like children having to ask if it’s okay for them to hug their grandkids or visit their neighbor. Perfectly healthy people are being told that they’re sick due to a highly questionable PCR test, all the while actual sick people who are in need of hospital care are being denied that care. They’re being denied their necessary treatments.
“COVID-19, the virus so deadly you have to be tested to know you have it,” as the meme goes.
And this argument, that asymptomatic carriers (which is to say healthy people) could get someone sick, is the most outrageous premise because it’s basically a recipe for permanent lockdowns and restrictions. If the government, with their so-called expert scientists, can simply call a pandemic at any time, and then claim that people who feel healthy are potentially sick (with a deadly virus that could get some vulnerable person killed somewhere) then it’s essentially the perfect excuse to rob everyone of their rights and freedoms — at any time and forever.
The reality is, this is not how a society that values individual civil liberties functions because the burden of proof must fall on the person making the claim about the deadly virus and they must prove that the health recommendations are proportionate to the level of the danger. Even then, I would only accept any health measures as recommendations, as advisory and not mandatory, even in a serious outbreak.
And I know some of you disagree with me on that, but you got to understand that the price of freedom is simply too high.
And you can’t just trust that, even after a genuine pandemic, that your government is going to just give your rights back to you. That’s very naive. And that’s what people have done in this case.
Now, under the spanish flu, when people were living in an actual pandemic, there was evidence all around them of this sickness. Everybody knew someone who died from it or at least had been sick from it, you know. You could see examples of sickness in the streets. Not so much with covid. Right?
The article continues:
“To earn the freedom pass people will need to be tested regularly and ,provided the results come back negative, they will then be given a letter card or document they can show to people as they move around.”
Oh boy.
“The certificate would be stored on a phone…”
I just want to point out, I said this stuff months ago. I was called a conspiracy theorist. It’s happening, so you know…
“The certificate would be stored on a phone, according to sources, and will allow people to live a relatively normal life until the government’s vaccination program gets up to speed.”
So there you go. Next up, the vaccine.
“It would even allow Britons to get away without wearing a mask, it is thought, and visit family and friends without the need to socially distance.”
Freedoms and rights we previously took for granted now coming with qualifiers and conditions. Even in your own home. Right?
It’s like the public are all prisoners being temporarily released under bail conditions.
“A source told the Telegraph: ‘They will allow someone to wander down the streets, and if someone else asks why they are not wearing a mask, they can show the card letter or an App.’
I preferred life before, when you could just walk around freely and you didn’t have to show anything to anybody. In other words, people have to show their papers. Right?
“Show me your papers, please!”
This is leading to mass medication of the populace by state coercion.
What could possibly go wrong?
This same strategy will be used for the vaccine. It almost makes you wonder why they’re pushing the vaccine so much. I wonder what’s in it?
The government will not concede any liberties to you until you conform to their medical tyranny. The governments of this world are merely puppets of the globalist interests in the World Economic Forum, The United Nations, Big Pharma — and they are at war with humanity.
This Fox News article talks about Greece. Coronavirus lockdown in Greece requires people to text authorities before leaving home.
“Under a second nationwide coronavirus lockdown in Greece, people will need to text authorities if they want to leave their homes.
“The lockdown will start at daybreak Saturday and last until the end of the month. With infections surging across the country, Prime Minister…
— let me see if i can pronounce this —
“Kyriakos Mitsotakis…
— probably not pronouncing that correctly–
“said he acted before patients overwhelm hospitals.”
Where have we heard that before?
Oh yeah, for the last eight months. All the time.
“We must stop this wave,” he said Thursday. I chose once again to take drastic measures sooner rather than later.
“As part of the lockdown, all retail stores except those selling essential items such as food, medication, and fuel will be closed.
“Travel inside the country will be severely restricted.
“People will only be allowed to leave their homes for work, physical exercise or medical reasons, and only after sending a text message to authorities.
“In the texts to the five-digit number, people will have to provide their name, address and the reason why they need to leave their home.
Unreal.
Where is the outrage?
Honestly. Like, what is wrong with…
Does anybody value freedom anymore? Except, you know, a handful of us at this point.
Moving on. Dan Price tweeted the following:
Indeed.
And that’s essentially what The Great Reset is all about.
Now imagine if Ireland’s Leo Varadkar… had given a speech to the people that went a little something like this:
“Listen guys, I’m afraid you’re gonna have to shut down your businesses forever. And there’s a virus. And it’s going to be here for ages. And the whole world is going to be thrown into one crisis after another.
“Uh, nothing we can do, guys. The rest of your life is just going to be unending misery and upheaval. Uh, new normal on the way. Sorry about that.
“Uh say goodbye to your livelihoods and social lives, the SME sector [Small Enterprise in Ireland with fewer than 50 employees] is finished. Prepare for mandatory face masks forever in order to be able to just go into the shops or go on public transport.
“Also there’s this thing called social distancing where people treat each other like pariahs. Basically, it’s the presumption of being an asymptomatic carrier of a deadly contagious disease.
“So stay apart. And also we’re going to be essentially undermining your property rights and right to the sanctity of your homes by, uh, being able to enact legislation on how many people are permitted in your home.
“We’re gonna cancel religious services and holidays. And in the long run, uh, there’s gonna be mandatory vaccinations, guys, with, uh, digital immunity passports (which is an app on your phone that shows if you’re vaccinated) or otherwise you won’t be able to go about your life or leave your home.
“Big corporations are going to make a fortune. And more power and wealth will be transferred from you plebs to the one percent of the one percent.
“Uh, small businesses are finished.
“Shut them down. That’s an order.
“Uh, don’t make us send in the guards.”
But, you see, you can never be quite so honest with people in the beginning, when you’re trying to alter human behavior. It takes time. And the conditioning is very gradual, very subtle.
If small business owners, for example, were told in the beginning that they would have to shut down forever, there would have obviously been huge backlash and people would have twigged that something was very seriously wrong.
They would want proof that they were living in an actual pandemic, beyond some scary graphs on a television.
So Varadkar, like any other political puppet, has to follow a similar plan that’s been given to him. The public and small businesses weren’t initially told that the virus was going to be a problem for a very long time. They were told that it was just a few weeks to flatten the curve — in order to avoid the terrible grim reality of a worst case scenario of 85,000 deaths in Ireland by covid.
That’s what he suggested back in March. It seems absurd to read this headline again now in November.
Anyway, the frog in the pot has to be boiled slowly or otherwise it won’t have time to adapt to the increase in temperature and it will jump out of the water.
So to keep people under control they have to be gradually primed for the new abnormal world, with promises about how it’s all going to eventually end and go back to normal — in just a few weeks. The behavior modification narrative has to, ever so slightly, be tweaked periodically so as to be almost imperceptible by the general public.
“Two weeks to flatten the curve” becomes “it’s just a few more weeks to stop the hospitals from being overrun”.
Then it’s “the next two weeks are crucial”.
And then it’s “we have to get the ‘r’ number down”.
And then it’s “experts are concerned about worrying spikes” or something.
And then it’s “just a few more months”.
And then it’s “just until we get a vaccine”.
Eventually, it’ll be “it’s just until the next vaccine”, and then the next one after that, and so on and so on .
Mandatory masks and social distancing signs and stickers were initially suggested as being only temporary until, of course, a sufficient amount of time has passed — and the general public have been so utterly broken and demoralized that they adapt to these things as part of their daily routine. Then they become the new normal.
From the government’s perspective, there’s no need to definitively come out and say when these policies will ever go away because, if the public are so compliant, why would the government surrender their new powers?
The increased draconian airport security measures after 9/11 weren’t temporary, though many people thought they were at the time.
So, why should any government relinquish these new covid control measures?
What I couldn’t get through to people back in March and April is that, when people surrender some of their rights, governments don’t voluntarily give them back. And that has been a clear thing. That’s been a clear pattern throughout history.
Freedoms are trampled on and our lives are slowly changed bit by bit. They rob the people of their liberties, a piece at a time and all, of course, under the guise of public safety.
So, anyway, a few months go by and, sure enough, the hoodwinked, compliant public — who’ve consumed constant fear propaganda from every conceivable angle — they’re now wearing their masks like slaves of the past. They’re even wearing them walking down the street and they haven’t been told to do that.
They know to stand on the circles, follow the arrows, queue outside the supermarket, wear the masks, use the hand sanitizer, and keep their distance .
The Pavlovian dog training is complete. They’ve now been placed into a state of such brainless docility that they are ready for more arbitrary instructions.
The globalists knew that they had to get SMEs out of the way in order to create their wealth transfer to big businesses. So small business owners were told to hang in there. And eventually they were fed scraps of hope.
A new reopening plan was unveiled where restaurants, shops, hair salons, gyms and pubs, etc. would remodel and reorganize their premises and means of operating to comply with social distancing guidance. No doubt they were desperate to comply. Limits were placed on the number of people permitted into the premises. Plexiglas screens were installed. Face coverings or visors became commonplace. Time limits were put in place. Bookings and names and numbers had to be taken by pubs in order to comply with contact tracing.
All of these things were nothing more than a charade — obstacles to be put in place to obstruct and damage the businesses — part of the slow boil process. Make small businesses think that the government wants them to survive and that there’s light at the end of the tunnel.
And the SMEs fell for it, hook line and sinker. The daft regulations that were meant to undermine their business models and reduce their profitability and slowly make them unworkable, the powers-that-be knew that if they didn’t offer SMEs this false dawn of hope that they would likely become fed up and revolt against the summer lockdown.
The summer reopening was, therefore, simply all part of the narcissistic strategy of “love bombing” after an abandonment phase. It was about trying to keep the SMEs sweet.
False hopes of returning to normal would later be dashed by another second lockdown, designed to finish off the SMEs and put them out of business for good.
You cannot appease your oppressor.
Complying with one mandate will inevitably lead to another and then another and another until your life is nothing like it was before — until your life is unrecognizable and you’ve lost all your freedoms, and everything that meant anything to you.
One of the biggest challenges we face in waking people up is their flat refusal to believe in the concept of evil, and that evil is very much at work in the world right now.
But just like a viral transmission, evil needs a host to survive. Its power comes by spreading through fear and intimidation among a compliant public.
If you refuse to comply, the power of evil disappears.
Please stop complying.
COVID 19: Mounting Evidence of International Fraud
COVID 19, and the subsequent governmental responses, appear to be part of an international conspiracy to commit fraud. It seems there is no evidence that a virus called SARS-CoV-2 causes a disease called COVID 19.
Sometimes you have to go with your gut. I am not an expert in genetics and, as ever, stand to be corrected. However my attention was drawn to some research published by the Spanish medical journal D-Salud-Discovery. Their advisory board of eminently qualified physicians and scientists lends further credibility to their research. Their claim is astounding.
The genetic primers and probes used in RT-PCR tests to identify SARS-CoV-2 do not target anything specific. I followed the search techniques outlined in this English translation of their report and can corroborate the accuracy of their claims about the nucleotide sequences listed in the World Health Organisations protocols. You can do the same.
D-Salud-Discovery state there are no tests capable of identifying SARS-CoV-2. Consequently all claims about the alleged impact of COVID 19 on population health are groundless.
The entire official COVID 19 narrative is a deception. Ostensibly, there is no scientific foundation for any part of it.
If these claims are accurate we can state that there is no evidence of a pandemic, merely the illusion of one. We have suffered incalculable loss for no evident reason, other than the ambitions of unscrupulous despots who wish to transform the global economy and our society to suit their purposes.
In doing so this “parasite class” have potentially committed countless crimes. These crimes can and should be investigated and prosecuted in a court of law.
Identification of What Exactly?
The World Health Organisation (WHO) classified COVID-19 (COronaVIrus Disease 2019). They declared a global COVID 19 pandemic on March 11th 2020.
“The etiologic agent [causation for the disease] responsible for the cluster of pneumonia cases in Wuhan has been identified as a novel betacoronavirus, (in the same family as SARS-CoV and MERS-CoV) via next generation sequencing (NGS) from cultured virus or directly from samples received from several pneumonia patients.”
The WHO’s claim is that the SARS-CoV-2 virus causes the disease COVID-19. They also allege this virus has been clearly identified by researchers in Wuhan.
“The Chinese authorities identified a new type of coronavirus, which was isolated on 7 January 2020……On 12 January 2020, China shared the genetic sequence of the novel coronavirus for countries to use in developing specific diagnostic kits.”
These two statements from the WHO clearly suggest the SARS-CoV-2 virus was isolated (meaning purified for study) and then genetic sequences were identified from the isolated sample. From this, diagnostic kits were developed and distributed globally to test for the virus in towns, cities and communities around the world. According to the WHO and Chinese researchers, these tests will find the virus that causes COVID 19.
Yet the WHO also state:
“Working directly from sequence information, the team developed a series of genetic amplification (PCR) assays used by laboratories.”
The Wuhan scientists developed their genetic amplification assays from “sequence information” because there was no isolated, purified sample of the so called SARS-CoV-2 virus. They also showed electron microscope images of the newly discovered virions (the spiky protein ball containing the viral RNA.)
However, such protein structures are not unique. They look just like other round vesicles, such as endocytic vesicles and exosomes.
Virologists claim that it is not possible to “isolate” a virus because they only replicate inside host cells. They add that Koch’s postulates do not apply because they relate to bacteria (which are living organisms). Instead, virologists observe the virus’ cytopathogenic effects (CPE), causing cell mutation and degradation, in cell cultures.
When Chinese researchers first sequenced the full SARS-CoV-2 genome they observed CPE in Vero E6 and Huh7 cells. Vero E6 are an immortalised monkey cell line and Huh7 are immortalised cancer (tumorigenic) cells. Meaning they have been maintained in vitro (in petri dish cultures) for many years.
Central to the official SARS-CoV-2 story is the idea that it is a zoonotic virus, capable of bridging the species gap from animals to humans. When scientists from the U.S. CDC“infected” various cells with the novel virus they noted the following:
“We examined the capacity of SARS-CoV-2 to infect and replicate in several common primate and human cell lines, including human adenocarcinoma cells (A549) [lung celles], human liver cells (HUH7.0), and human embryonic kidney cells (HEK-293T), in addition to Vero E6 and Vero CCL81 [monkey cells]……No cytopathic effect was observed in any of the cell lines except in Vero cells [monkey cells]…….HUH7.0 and 293T cells showed only modest viral replication and A549 cells [human lung tissue cells] were incompatible with SARS-CoV-2 infection.”
The CDC did not observe any CPE in human cells. They saw no evidence that this alleged virus caused any human illness. Nor did this supposed human virus show any notable replication in human cells, suggesting human to human infection would be impossible.
Noting this problem, a team of Polish scientists introduced this sequenced “virus” to human epithethelium (airway) cells. They observed the effects on these HAE cultures for 5 days. They noted much greater replication than the CDC scientists but ultimately stated:
“We did not observe any release of the virus from the basolateral side of the HAE culture.”
Meaning they did not see any evidence of the supposed virions breaching the cell wall membrane. Again suggesting this so called virus isn’t infectious in human beings.
It is not clear that SARS-CoV-2 is a human virus capable of causing illness. It may not even physically exist. Is it nothing more than a concept based upon predictive genetic sequences?
Voyage Of Discovery
The Wuhan Center for Disease Control and Prevention and the Shanghai Public Health Clinical Centre published the first full SARS-CoV-2 genome (MN908947.1 ). This has been updated many times. However, MN908947.1 was the first genetic sequence describing the alleged COVID 19 etiologic agent (SARS-CoV-2).
All subsequent claims, tests, treatments, statistics, vaccine development and resultant policies are based upon this sequence. If the tests for this novel virus don’t identify anything capable of causing illness in human beings, the whole COVID 19 narrative is nothing but a charade.
The WUHAN researchers stated that they had effectively pieced the SARS-CoV-2 genetic sequence together by matching fragments found in samples with other, previously discovered, genetic sequences. From the gathered material they found an 87.1% match with SARS coronavirus (SARS-Cov). They used de novo assembly and targeted PCR and found 29,891-base-pair which shared a 79.6% sequence match to SARS-CoV.
They had to use de novo assembly because they had no priori knowledge of the correct sequence or order of those fragments. Quite simply, the WHO’s statement that Chinese researchers isolated the virus on the 7th January is false.
The Wuhan team used 40 rounds of RT-qPCR amplification to match fragments of cDNA (complimentary DNA constructed from sampled RNA fragments) with the published SARS coronavirus genome (SARS-CoV). Unfortunately it isn’t clear how accurate the original SARS-CoV genome is either.
In 2003 a team of researchers from from Hong Kong studied 50 patients with severe acute respiratory syndrome (SARS). They took samples from 2 of these patients and developed a culture in fetal monkey liver cells.
They created 30 clones of the genetic material they found. Unable to find evidence of any other known virus, in just one of these cloned samples they found genetic sequences of “unkown origin.”
CHART: E Gene target sequence
Examining these unknown RNA sequences they found 57% match to bovine coronavirus and murine hepatitis virus and deduced it was of the family Coronaviridae. Considering these sequences to suggest a newly discovered SARS-CoV virus (new discoveries being ambrosia for scientists), they designed RT-PCR primers to test for this novel virus. The researchers stated:
“Primers for detecting the new virus were designed for RT-PCR detection of this human pneumonia-associated coronavirus genome in clinical samples. Of the 44 nasopharyngeal samples available from the 50 SARS patients, 22 had evidence of human pneumonia-associated coronavirus RNA.”
Half of the tested patients, who all had the same symptoms, tested positive for this new alleged virus. No one knows why the other half tested negative for this novel SARS-CoV virus. The question wasn’t asked.
This supposed virus had just a 57% sequence match to allegedly known coronavirus. The other 43% was just “there.” Sequenced data was produced and recorded as a new genome as GenBank Accession No. AY274119.
The Wuhan researchers subsequently found an 79.6% sequence match to AY274119 and therefore called it a novel strain of SARS-CoV (2019-nCoV – eventually renamed SARS-CoV-2). No one, at any stage of this process, had produced any isolated, purified sample of any virus. All they had were percentage sequence matches to other percentage sequence matches.
Isolate Nothing
Scientists are very annoyed because they keep saying the virus has been isolated but no one believes them. This is because, as yet, no one has provided a single purified sample of the SARS-CoV-2 virus. What we have instead is a completed genome and, as we are about to discover, it isn’t particularly convincing.
Investigative journalists Torsten Engelbrecht and Konstantin Demeter asked some of the scientists who said they had images of SARS-C0V-2 virions to confirm these were images of an isolated, purified, virus. None of them could.
“The reliability of COVID-19 tests is uncertain due to the limited evidence base…There is limited evidence available to assess the accuracy and clinical utility of available COVID-19 tests.”
In The UK, in July, a group of concerned academics wrote a letter to the UK Prime Minister Boris Johnson in which they asked him to:
“Produce independently peer reviewed scientific evidence proving that the Covid-19 virus has been isolated.”
To date they have not received a reply.
Similarly, UK researcher Andrew Johnson made a Freedom of Information Request to Public Health England (PHE). He asked them to provide him with their records describing the isolation of a SARS-COV-2 virus. To which they responded:
“PHE can confirm it does not hold information in the way suggested by your request.”
Canadian researcher Christine Massey made a similar freedom of information request, asking the Canadian government the same. To which the Canadian government replied:
“Having completed a thorough search, we regret to inform you that we were unable to locate any records responsive to your request.”
“…No quantified virus isolates of the 2019-nCoV are currently available……..Detection of viral RNA may not indicate the presence of infectious virus or that 2019-nCoV is the causative agent for clinical symptoms.”
Last updated on 13th July 2020, the CDC are yet to obtain any pure viral sample from any patient said to have the disease of COVID-19. They openly admit their tests don’t necessarily show if SARS-CoV-2 is either present or causes COVID 19.
We are told that none of this matters. That we are ignorant and just don’t understand virology. Therefore, we must except pictures of things we know could be something else and genetic sequences (which could be anything else) as conclusive proof that this virus, and the disease it is supposed to cause, are real.
Testing For Nothing
The WHO, and every government, think tank, policy steering committee, government scientific advisor, supranational institutions and others who promote the official COVID 19 narrative, assert that SARS-CoV-2 causes COVID 19. While no one has ever produced a sample of this supposed virus, the alleged SARS-CoV-2 genome has been published. It is in the public domain.
Key genetic sequences, in the SARS-CoV-2 genome, are said to have specific functions. These are the target proteins that scientists test for to identify the presence of the “virus”. These include:
RNA-polymerase (Rd-Rp) gene – This enables the SARS-CoV-2 RNA to replicate inside the cytoplasm of COVID 19 diseased epithelial cells.
S gene (Orf2) – this glycoprotein forms the spike on the SARS-CoV-2 virion surface which supposedly facilitates SARS-CoV-2 binding to the ACE2 receptors on cells, allowing the RNA inside the virion protein shell (capsid) to pass into the now infected cell.
E gene (Orf1ab) – small membrane protein used in viral assembly
N gene (Orf9a) – the nucleocapsid gene which binds the RNA in capsid formation
The WHO maintain a publicly available record of the RT-PCR primers and probes used to test for SARS-CoV-2. The primers are specific nucleotide sequences that bind (anneal) to the antisense and sense strands of the synthesised cDNA (called forward and reverse primers respectively.)
The cDNA strands separate when heated and reform when cooled. Prior to cooling, nucleotide sequences called probes are introduced to anneal to specific target regions of the suspected viral genome. During amplification, as the regions between primers elongate, when a primer strikes a probe, the probe decays releasing a fluorescent or dye which can then be read by researchers.
It is the identification of these markers which scientists claim to prove the presence of SARS-CoV-2 in a sample.
Something else which is publicly available is the Basic Local Alignment Search Tool (BLAST). This allows anyone to compare published nucleotide sequences with all those stored by the U.S. National Institutes of Health (NIH) genetic database called GenBank. Therefore we can BLAST the claimed SARS-CoV-2 primers, probes and target gene sequences.
The WHO’s forward, reverse primers and probe protocols, for the alleged SARS-CoV-2 viral genome, are based upon RdRp, Orf1, N and E gene profiles. Anyone can run them through BLAST to see what we find.
The vital RdRP nucleotide sequence, used as a forward primer is – ATGAGCTTAGTCCTGTTG. If we run a nucleotide BLAST this is recorded as a complete SARS-CoV-2 isolate with a 100% matched sequence identity. Similarly the reverse E gene primer sequence – ATATTGCAGCAGTACGCACACA – reveals the presence of the Orf1ab sequence which also identifies SARS-CoV-2.
However, BLAST also enables us to search the nucleotide sequences of the microbial and human genomes. If we search for the RdRp SARS-CoV-2 sequence it reveals 99 human chromosome with a 100% sequence identity match. The Orf1ab (E gene) returns 90 with a 100% sequence identity match to human chromosomes.
Doing the same for these sequences with a microbial search finds 92 microbes with a 100% match to the SARS-CoV-2 E gene and 100 matched microbes, with a 100% sequence identity, to the vital SARS-CoV-2 RdRp gene.
Whenever we check the so called unique genetic markers for SARS-CoV-2, recorded in the WHO protocols, we find complete or high percentage matches with various fragments of the human genome. This suggests that the genetic sequences, which are supposed to identify SARS-CoV-2, are not unique. They could be anything from microbial sequences to fragments of human chromosomes.
So called fact checkers, like Reuters’ Health Feedback project, have been quick to dismiss the claims of those who have noticed the apparent lack of specificity in the supposed SARS-CoV-2 genome. Using a slew of strawman arguments like, “this claim suggests every test should be positive,” (which it doesn’t) their debunking attempt runs something like this:
Primers are designed to bind to specific nucleotide sequences that are unique to the virus. The forward primer may bind to a particular chromosome but the reverse primer doesn’t bind to the same chromosome and so the chromosome is not present in the SARS-CoV-2 virus. Moreover because the forward and perverse primers envelop the sequence to be amplified the cDMA sequence between primers is unique to the virus.
This seems to deliberately misrepresent the significance of these findings by forwarding an argument that no one, other than the fact checkers themselves, are making. BLAST searches show that these target sequences are not unique to SARS-CoV-2. Nor do all targets need to be found for a result to be deemed positive.
Moroccan researchers investigated the epidemiology of Moroccan alleged cases of SARS-CoV-2. Nine percent were positive for three genes, eighteen percent were positive for two genes and seventy three percent for just one. As we have just discussed, many may have been positive for none.
“An optimal diagnosis consists of a NAAT [nucleic acid amplification test] with at least two genome-independent targets of the SARS-CoV-2; however, in areas where transmission is widespread, a simple single-target algorithm can be used……One or more negative results do not necessarily rule out the SARS-CoV-2 infection.”
Regardless of the spurious arguments of well funded fact checkers, if the forward and reverse primers identify junk, perhaps one being the fragment of a chromosome and the other a microbial sequence, then the amplified region between them is probably junk too.
The argument that RT-PCR only finds RNA is specious. Natural transcription (the separation of DNA strands) occurs during gene expression. No one is saying whole chromosomes or microbes are sequenced in the alleged SARS-CoV-2 genome. Though they may, for all we know. They are saying the alleged markers, used to test for this supposed virus, are not fit for purpose.
RT-PCR tests do not sequence the entire genome. They look for incidents of specific probe florescence to indicate the presence of sequences said to exist. These sequences are defined by MN908947.1 and the subsequent updates. These primers and probes could reveal nothing but RNA matches extracted from non-coding, sometimes called “junk,” DNA (cDNA.)
For example the SARS-CoV-2 S gene is meant to be highly specific to the SARS-CoV-2 virus genome. The target sequence is – TTGGCAAAATTCAAGACTCACTTTC. A microbial BLAST search returns 97 microbial matches with 100% identity sequence match. The lowest identity percentage match, within the top 100, is 95%. A human genome BLAST also finds a 100% sequence match to 86 human chromosome fragments.
No matter where you look in the supposed genome of SARS-CoV-2, there is nothing in the WHO’s test protocols that clearly identifies what it is. The whole genome could be false. The tests do not prove the existence of SARS-CoV-2. All they reveal is a soup of unspecified genetic material.
If so, as there are no isolates or purified samples of the virus, without a viable test, there is no evidence that SARS-CoV-2 exists. Therefore, nor is there any evidence that a disease called COVID 19 exists.
This infers that there is no scientific basis for any claims about COVID 19 case numbers, hospital admissions or mortality figures. All measures taken to combat this deadly virus are quite possibly founded upon nothing.
“Some deceitful practice or willful device, resorted to with intent to deprive another of his right, or in some manner to do him an injury.”
The Legal definition of a conspiracy is:
“A combination or confederacy between two or more persons formed for the purpose of committing, by their joint efforts, some unlawful or criminal act”
It seems, those who claim we face a pandemic have not provided any evidence to show that a virus called SARS-CoV-2 causes a disease called COVID 19. All of the information strongly suggesting this possibility is readily available in the public domain. Anyone can read it.
For there to be a fraud the deceit must be wilful. The intention must be to deliberately deprive others of their rights or injure them in some other way. If there is evidence of collusion between individuals ad/or organisations to commit fraud, then this is a conspiracy (in Common Law jurisdictions) or a Joint Criminal Enterprise (JCE) under International Law.
It seems COVID 19 has been deliberately used as a casus belli to wage war on humanity. We have been imprisoned in our own homes, our freedom to roam restricted, freedom of speech and expression eroded, rights to protest curtailed, separated from loved ones, our businesses destroyed, psychologically bombarded, muzzled and terrorised.
Worse still, while there is no evidence of unprecedented all cause mortality, there were unseasonable spikes in deaths. These correlate precisely with Lockdown measures which saw the withdrawal of the health services we pay for and a reorientation of public health services to treat one alleged disease at the exclusion of all others.
Further, it is proposed by those who have forwarded the COVID 19 story, that this alleged disease provides justification for the complete restructuring of the global economy, our political systems, societies, cultures and humanity itself.
To be allowed to participate in their so called “new normal,” which is the wholesale transformation of our entire society without our consent, they insist we submit to their conditions.
These include, but aren’t limited to, bio-metric surveillance of everyone, the centralised control and monitoring of all of our transactions, oppressive business and social restrictions and an effective demand that we have no right to sovereignty over our own bodies. This constitutes the condition of slavery.
There is no doubt that we have been deprived of our rights and injured. In Common Law jurisdictions innocence is presumed, but the evidence that harm has been deliberately caused by an international conspiracy is overwhelming. Destructive policies, enacted by governments across the world, clearly originated among globalist think tanks and supranational institutions long before the emergence of this non existent pandemic.
In Napoleonic Code jurisdictions, guilt is presumed. In order for the accused conspirators to prove their innocent they must show that, despite their immeasurable resources, they have collectively been unable to access or understand any of the freely available evidence suggesting COVID 19 is a myth.
Those responsible for the crime of conspiracy to commit global fraud should be tried. If found guilty they should be imprisoned while the rest of us get on with trying to repair the damage they have already inflicted.
Author Iain Davis is an independent researcher and short filmmaker and the author of the new book, A Dangerous Ideology. See more of Iain’s work at his blog site In This Together and follow him at Twitter & Steemit & MINDS.
It functions like a cult, totalitarianism. It creeps up on you, little by little, little lie by little lie, accommodation by accommodation, rationalization by rationalization … until one day you find yourself taking orders from some twisted little narcissistic nihilist on a mission to remake the entire world. You don’t surrender to it all at once. You do it over the course of weeks and months.
Imperceptibly, it becomes your reality. You do not recognize that you are in it, because everything you see is part of it, and everyone you know is in it … except for the others, who are not part of it. The “deniers.” The “deviants.” The “foreigners.” The “strangers.” The “Covidiots.” The “virus spreaders.”
Break out the Wagner, folks … the Germans are back! No, not the warm, fuzzy, pussified, peace-loving, post-war Germans … the Germans! You know the ones I mean. The “I didn’t know where the trains were going” Germans. The “I was just following orders” Germans. The other Germans.
Yeah … those Germans.
In case you missed it, on November 18, the German parliament passed a law, the so-called “Infection Protection Act” (“Das Infektionsschutzgesetz” in German) formallygranting the government the authority to issue whatever edicts it wants under the guise of protecting the public health. The government has been doing this anyway — ordering lockdowns, curfews, travel bans, banning demonstrations, raiding homes and businesses, ordering everyone to wear medical masks, harassing and arresting dissidents, etc. — but now it has been “legitimized” by the Bundestag, enshrined into law, and presumably stamped with one of those intricate official stamps that German bureaucrats like to stamp things with.
Now, this “Infection Protection Act,” which was rushed through the parliament, is not in any way comparable to the “Enabling Act of 1933,” which formally granted the government the authority to issue whatever edicts it wanted under the guise of remedying the distress of the people. Yes, I realize that sounds quite similar, but, according to the government and the German media, there is no absolutely equivalence whatsoever, and anyone who suggests there is is “a far-right AfD extremist,” “a neo-Nazi conspiracy theorist,” or “an anti-vax esotericist,” or whatever.
As the Protection Act was being legitimized (i.e., the current one, not the one in 1933), tens of thousands of anti-totalitarian protesters gathered in the streets, many of them carrying copies of the Grundgesetz (i.e., the constitution of the Federal Republic of Germany), which the parliament had just abrogated. They were met by thousands of riot police, who declared the demonstration “illegal” (because many of the protesters were not wearing masks), beat up and arrested hundreds of them, and then hosed down the rest with water cannons.
The German media — which are totally objective, and not at all like Goebbels’ Ministry of Propaganda in the Nazi era — dutifully reminded the German public that these protesters were all “Corona Deniers,” “far-right extremists,” “conspiracy theorists,” “anti-vaxxers,” “neo-Nazis,” and so on, so they probably got what they deserved. Also, a spokesperson for the Berlin police (who bear absolutely no resemblance to the Gestapo, or the Stasi, or any other notorious official-ideology-enforcing goons) pointed out that their water cannons were only being used to “irrigate” the protesters (i.e., not being aimed directly at them) because there were so many “Corona Denier” children in their ranks.
According to the government, the German media, the intelligentsia, and, basically, anyone in public life who wants to remain there, these “Corona Deniers” are becoming a problem. They are spreading baseless “conspiracy theories” that are threatening the public health and causing distress to the German people (e.g., that the vast majority of those infected suffer only mild to moderate flu symptoms or, more commonly, no symptoms at all, and that over 99.7% survive). They are walking around without medical-looking masks, which is making a mockery of the government and media’s efforts to convince the public that they are under attack by an apocalyptic plague. They are posting scientific facts on the Internet. They are staging these protests and otherwise challenging the government’s right to declare a “health emergency,” suspend the German constitution indefinitely, and rule society by decree and force.
Despite the German government and media’s efforts to demonize anyone not obediently parroting the official “New Normal” narrative as a “dangerous neo-Nazi Corona Denier,” the “Corona Denialism” movement is growing, not just in Germany, but all throughout Europe. Clearly, the time is coming for Germany to take stronger measures against this threat. The health of the Vater … uh, the nation, is at stake! Fortunately, this “Infection Protection Act” will provide the government with the authority it needs to conceive and carry out some kind of … well, you know, solution. Allowing these degenerate anti-social deviants to run around challenging the German government’s absolute power is not an option, not in a time of national health emergency! These “Nazi-sympathizing Corona Deniers” must be rooted out and dealt with, mercilessly!
But seriously, I don’t mean to pick on the Germans. I love the Germans. I live in Germany. And they’re hardly the only ones implementing the new pathologized totalitarianism. It’s just that, given their not-too-distant history, it is rather depressing, and more than a little frightening, to watch as Germany is once again transformed into a totalitarian state, where the police are hunting down the mask-less on the streets, raiding restaurants, bars, and people’s homes, where goose-stepping little Good German citizens are peering into the windows of Yoga studios to see if they are violating “social distancing rules,” where I can’t take a walk or shop for groceries without being surrounded by hostile, glaring, sometimes verbally-abusive Germans, who are infuriated that I’m not wearing a mask, and otherwise mindlessly following orders, and who robotically remind me, “Es ist Pflicht! Es ist Pflicht!”
Yes, I am fully aware that it is “Pflicht.” If I had any doubt as to whether it was “Pflicht,” the Berlin Senat cleared that up when they commissioned and ran this charming advert instructing me to fuck myself if I don’t want to follow their “Corona orders” and profess my belief in their new Big Lie.
And OK, before the Literalist Society starts flooding me with outraged emails, no, I’m not calling these Germans “Nazis.” I am calling them “totalitarians.” Which, at this point, given everything we know, if you’re still pretending that this coronavirus in any way warrants the increasingly ridiculous “emergency measures” we are being subjected to, I’m sorry, but that is what you are.
You may not believe that is what you are … totalitarians never do, not until it is far too late.
It functions like a cult, totalitarianism. It creeps up on you, little by little, little lie by little lie, accommodation by accommodation, rationalization by rationalization … until one day you find yourself taking orders from some twisted little narcissistic nihilist on a mission to remake the entire world. You don’t surrender to it all at once. You do it over the course of weeks and months. Imperceptibly, it becomes your reality. You do not recognize that you are in it, because everything you see is part of it, and everyone you know is in it … except for the others, who are not part of it. The “deniers.” The “deviants.” The “foreigners.” The “strangers.” The “Covidiots.” The “virus spreaders.”
See, although the narratives and symbols may change, totalitarianism is totalitarianism. It doesn’t really matter which uniform it wears, or which language it speaks … it is the same abomination. It is an idol, a simulacrum of the hubris of man, formed from the clay of the minds of the masses by megalomaniacal spiritual cripples who want to exterminate what they cannot control. And what they want to control is always everything. Everything that reminds them of their weakness and their shame. You. Me. Society. The world. Laughter. Love. Honor. Faith. The past. The future. Life. Death. Everything that will not obey them.
Unfortunately, once this kind of thing gets started, and reaches the stage we are currently experiencing, more often than not, it does not stop, not until cities lie in ruins or fields are littered with human skulls. It might take us ten or twelve years to get there, but, make no mistake, that’s where we’re headed, where totalitarianism is always headed … if you don’t believe me, just ask the Germans.
How does a “mask” prevent a person who isn’t sick from distributing a sickness he does not have? A full Moon Suit connected to a closed-circuit oxygen rebreather system would not “stop the spread” if the “spreader” hasn’t got anything to spread.
The Coronamonomaniac’s answer, of course, is that the “mask” protects against the possibility that you might be sick and not realize it – i.e., “asymptomatic” – and their fear of this possibility – no matter how unlikely it may be in fact – obliges you to wear the “mask.”
One might ask, in that case, whether the possibility that someone might be a thief obliges the suspected person to keep their hands in plain sight at all times – so as to assuage the fear of theft?
If not – and most reasonable people would probably agree that it does not – then why must a person who isn’t sick be made to pretend – eternally – he is sick because other people are afraid he might be?
The answer to that should be obvious: He shouldn’t have to pretend he is sick. Ever. Nor be made to appear to agree with the tenets of the Sickness Cult, which the wearing of the “mask” implies he does.
There is something very wrong with this business of insisting that people alter their behavior in degrading ways – as by walking around in fear of other people, avoiding proximity, wearing a silly “mask” over their faces – because some people are afraid.
Why doesn’t their fear oblige them to deal with it rather than others to accommodate it?
Without regard to the impact on others of their insisted-on accommodations?
The mental disease of Coronamonomania requires that everything – and everyone – be subordinated without limit to the unlimited fear some people have of a sickness that by any fact-based metric poses far less threat of actual harm to almost everyone than the impositions being insisted upon.
This is a sound working definition of mass hysteria, an extremely dangerous phenomenon when allowed to run amok.
The question becomes – how to stop its spread?
The difficulty is the natural – and reasonable – aversion most people have for conflict. Their desire to not make others feel bad, if they can avoid it. We say nice things about people’s bad haircuts – or don’t say anything about them at all. We refrain from criticism we know will not be well-received.
We seek to live – and let live.
This decent instinct is being used against decency – by making good people feel bad about not deferring to the rabidized fear of others.
This is a hobble which must be overcome and the way to overcome it is to realize you are not a bad person for not submitting to emotional blackmail. To being made to actually say that a bad haircut is the best one you’ve ever seen and to agree with viewpoints you disagree with.
You know you are not sick. Therefore, decline to pretend you are sick.
If someone else dreads the possibility that you might be sick, that is their problem to deal with. It is not your obligation to accommodate and if they insist it is, then it is time to tell them no.
Firmly.
Just as you would tell a screaming, foot-stomping child attempting to make you bend to his wishes no. That it’s not going work. Scream and stomp your feet to your heart’s content. We’re not buying that toy to get you to calm down.
And we’re not going to wear a “mask” to get you to calm down, either.
There will of course be screaming and foot-stomping. There already has been. And it is precisely because of the deference of good people to this noxious foot-stomping and screaming that the emotional blackmail for more “masking” has been increasing.
We endure what we tolerate.
Let’s stop tolerating it.
There is, unfortunately, no other way to deal with foot-stomping, screaming emotional blackmail. Let them scream and stomp. Let them see that their emotional blackmail no longer has power over us; that our willingness to put up with it and give in to it at any cost is over.
When someone says, “we’re all in this together” – point out that “we” aren’t in this together. Don’t presume to speak for me.
When someone says, “stay safe” – tell them you’d rather stay free. Walk confidently into stores that aren’t enforcing “masking” bu
If you own a business, let your customers know you don’t expect them to “mask” and maybe even consider placing a sign to that effect on your front door. This may draw down the Sickness Polizei upon you but so be it. Put them in the position of having to charge you with a violation of law – as opposed to “not following guidelines” – and place the onus on the courts to prove you guilty under the law.
Stop backing up. Stop giving in to get along.
This whole show is utterly dependent on acquiescence to emotional blackmail. It can be halted and dialed back if people decide to stop giving in to it for the sake of not making the blackmailers upset.
t depending on emotional blackmail to get you to put one on.
A false flag operation is an action that is carried out in such a way as to make it look like it was done by someone other than the real perpetrator. Taking its metaphor from naval warfare, where ships would sometimes fly false flags as a ruse du guerre in order to sneak up on their enemy, its use has been expanded to include military actions, intelligence operations and even political subterfuge.
It is not difficult to see how governments can use this tactic to whip the public into war hysteria against their political enemies. By staging an attack and blaming their opponents, governments can dupe their population into going along with whatever policies they wish to enact in the name of “fighting the enemy.” It’s a childishly simple tactic but, as we shall see, it has worked for hundreds of years to lead populations into war against targeted groups.
For the past twenty years, the world has been in the midst of a so-called “war on terror” set in motion by a false flag attack of spectacular proportions. And now, the stage is being set for a new spectacular attack to usher in the next stage in that war on terror: the war on bioterrorism.
GATES: We can’t predict when, but given the continual emergence of new pathogens, the increasing risk of a bioterror attack, and the ever-increasing connectedness of our world, there is a significant probability that a large and lethal modern-day pandemic will occur in our lifetime.
As the world begins to lose its collective mind over the threat of viruses, the idea that biological agents and infectious pathogens will be the weapon of choice of the terrorists is being seeded in the public imagination. As in every such false flag event, the coming bioterrorist attack will be blamed on a convenient scapegoat: the “invisible enemy” of a deadly new pathogen and the shadowy terror groups who, we will be told, are responsible for releasing it.
But, as history shows, it is the people who are claiming to “predict” this attack in advance, and who are in positions to dictate the world’s response to it, who should be considered the prime suspects in the wake of any such event.
This is an exploration of False Flags and the Dawn of Bioterrorism.
Although the term “false flag” has been used in a figurative sense since the 16th century to refer to some person or group disguising their true nature or intentions, its modern use derives from the annals of naval warfare, where ships would literally fly the flag of a different nation, pretending to be allies in order to slip past enemy defenses.
The ruse was successful enough that it was adopted for land and air warfare. No longer were literal flags necessary in order to carry out these “false flag” operations. Any use of deception in order to conceal the true origins and perpetrators of an attack could, by extension, be counted as a false flag operation.
It’s a simple idea, but, to those not versed in the art of deceit, it can be devastatingly effective. Unsurprisingly, rulers have used the tactic for hundreds of years to rally their own populations for war against an enemy target.
Take the case of Swedish King Gustav III. In 1788 he was looking for a way to unite an increasingly divided nation and raise his own falling political fortunes. Like many a ruler before and after, he decided that launching a war against his old rivals, the Russians, would be the perfect vehicle for rallying the public around his government. But the king had a problem: there was no appetite among the Swedish public for such a war, and he didn’t have the authority to declare war unilaterally. So he arranged a false flag operation. Gustav dressed up his own soldiers as Russian troops (complete with Russian coins in their pockets) and ordered them to attack a Swedish garrison stationed in Finland. The Swedish public, believing it to be a genuine Russian attack, were outraged, and the Russo-Swedish War of 1788-1790 began.
Or take the case of Seishirō Itagaki, a general in the Imperial Japanese Army who, by 1931, had risen through the ranks to become the Chief of Intelligence in the Kwantung Army, Japan’s largest army group. Itagaki had a problem: he wanted to invade Manchuria, but the Japanese Minister of War wouldn’t allow it. So the general took matters into his own hands by organizing a small cadre of rebels within the Japanese Army and launching a false flag attack. They detonated some explosives on a railway track near a Chinese garrison and blamed the incident on the Chinese themselves. The next day, the Japanese began their attack in response to the “Chinese” provocation and Itagaki got his Manchurian invasion.
Or take the case of the Manning memo. This document records the discussions that took place between US President George W. Bush and UK Prime Minister Tony Blair at the White House on January 31, 2003. They were committed to starting a war with Iraq, but they had a problem: they didn’t have any actual reason for invading Iraq. As the memo reveals, Bush proposed a false flag solution: painting a U2 spy plane in United Nations colours and flying it low over Iraqi airspace in the hopes that it would be shot down by Iraqi air defense. The outrage, it was assumed, would give the leaders the blank check they needed to wage their war. Blair reportedly balked at the idea, but the pair did agree that the invasion would go ahead regardless of whether or not any weapons of mass destruction were ever found, war crimes be damned.
There are many such examples of false flag operations being used throughout history. But the tactic isn’t an old, dusty relic of the distant past. It very much pertains to the world of the 21st century . . .
2. False Flag Terrorism
It seems inevitable, in hindsight, that the idea of a “false flag” attack would be adapted from its literal use in naval warfare to a more general tactic of deception in military engagements. So it’s not surprising at all, then, that the concept was further abstracted from a stratagem of warfare to a tool of spy craft.
With the rise of the age of terrorism came the rise of false flag terrorism: spectacular acts of violence designed to look like they were the acts of shadowy terror groups. Once again, the trick is simple but effective.
In the early 1950s, the Israelis were concerned that the British would withdraw their forces from the Suez Canal zone, strengthening Egyptian President Gamal Abdel Nasser and his quest to form an alliance against Israel based on Pan-Arab nationalism. Realizing that the only thing that would keep Britain committed to the region was an ongoing state of emergency, they hit upon a simple solution: a false flag terror operation.
Officially codenamed Operation Susannah (but today known as the Lavon Affair), Israeli military intelligence staged a number of bombings around Egypt, hoping to blame the acts on communists, the Muslim Brotherhood, malcontents, or other convenient scapegoats. But the plan was foiled by Egyptian authorities. Several members of the Israeli cell were captured and the Israeli defence minister was forced to resign over the incident. It was never officially admitted until 2005, when Israel formally honoured nine of the spies that had helped carry out the bombings.
But the era of false flag terrorism kicked off in earnest on September 11, 2001, when the neocons in the Bush administration and their accomplices in the military-industrial complex and the intelligence services of multiple countries found an excuse for their longed-for invasion of Afghanistan and the fulfillment of long-standing Zionist plans for carving out a Greater Israel and redrawing the map of the Middle East.
Prized as a pipeline corridor, Afghanistan was also the linchpin of the global heroin trade and an important base of operations for the forthcoming War on Terror. In fact, so important was the country to the Bush administration that it made the full-scale plan for invading Afghanistan the subject of its first national security directive, NSPD-9. The plan was ready and awaiting presidential approval on September 4, 2001, one week before the events that would supposedly justify such an invasion.
RUMSFELD: By the first week of September, the process had arrived at a strategy that was presented to principals and later became NSPD-9, the President’s first major substantive national security decision directive. It w as presented for a decision by principals on September 4th, 2001, seven days before the 11th, and later signed by the President, with minor changes and a preamble to reflect the events of September 11th, in October.”
9/11 was the foundational event of the 21st century, an excuse for numerous items on the checklist of the neocon cabal at the heart of the Bush administration: The creation of the homeland security state. The murderous wars of aggression to reshape the Middle East. The expansion of the military-industrial complex even beyond its Cold War excesses. The formation of the information-industrial complex. We have all watched these events unfolding like a nightmare over the course of the past two decades.
But now, just as the 9/11 myth has finally begun to relinquish its grasp on the public psyche, another event has come along to send the world back into a state of irrational fear. This time, the emergency is predicated not on the Muslim bogeyman but on the invisible bogeyman: SARS-CoV-2.
As we have already seen, the advent of new forms of warfare inevitably brings with it new opportunities for war planners to adapt the false flag strategy for new battlegrounds. And so it is that we find ourselves on the cusp of a new era of false flag operations.
3. The Anthrax False Flag
As it turns out, 9/11 may not prove to be the most long-lasting and world-changing false flag event to have taken place in the fall of 2001. Although largely forgotten today, the anthrax attacks that followed on the heels of “the day that changed everything” have had a profound effect in shaping public policy and setting the stage for the biosecurity state that is emerging today.
The week after September 11, 2001, a series of letters containing anthrax spores were mailed to various media outlets and, later, to two US Senators, Tom Daschle and Patrick Leahy, who had raised concerns about the Patriot Act which the Bush regime was attempting to rush through Congress. The anthrax-laced letters—which caused the shut down of Congress and lead to the emergency passage of the Patriot Act before legislators even had a chance to read the bill—would go on to kill five and injure 17 others.
In those first chaotic days of the attack, ABC’s Brian Ross began reporting from his anonymous “well-placed” sources that the anthrax spores contained traces of bentonite, a “troubling chemical additive” that just happened to be a “trademark of Iraqi leader Saddam Hussein’s biological weapons program.”
BRIAN ROSS: Peter, from three well-placed but separate sources tonight ABC News has been told that initial tests on the anthrax sent to Senator Daschle have found a tell-tale chemical additive whose name means a lot to weapons experts. It is called bentonite. It’s possible other countries may be using it, too, but it is a trademark of Saddam Hussein’s biological weapons program.
Of course, this turned out to be a complete lie (a lie that Ross has never clarified or retracted to this day).
As was later confirmed, the spores in question were actually derived from the Ames strain, a strain of anthrax whose virulence makes it the “gold standard” for research into the bacterium by the biological warriors at the United States Army Medical Research Institute of Infectious Diseases. Unsurprisingly, once the anthrax was found to have sourced from the US government’s own biological research labs and not an Iraqi weapons program, coverage of the affair in the mainstream media became less frequent and less detailed.
After years of floating the name of bioweapons expert Steven Hatfill as a “person of interest” in the investigation, the FBI pinned the blame on Bruce Ivins, a “lone wolf” who allegedly orchestrated the entire attack himself because of mental instability. Hatfill successfully sued the FBI for nearly $6 million for undue harassment and Ivins conveniently killed himself before ever being charged with any crime. In the end, not a single person was arrested or indicted for their participation in one of the highest profile attacks in American history.
The anthrax false flag killed multiple birds with one stone:
It associated the terror attack of 9/11 with a subsequent bioterror attack that was quickly connected to Saddam Hussein and Iraq. That association was still strong in the minds of many Americans (some who may still have erroneously blamed Iraq for the attack) during the build up to the Iraq War in 2002 and 2003.
As Whitney Webb points out in her exhaustive report on the event, the anthrax attack also saved Bioport, the crony-connected DoD contractor that supplied the US military with the highly controversial anthrax vaccine. Facing growing concerns about the safety and efficacy of its vaccine, Bioport faced financial ruin . . . until the anthrax attacks happened and demand for their questionable product skyrocketed. Later rebranding as Emergent Biosolutions, the company benefited from the largesse of the Gates-backed Coalition for Epidemic Preparedness, and, as Webb notes, the company “is now set to profit from the Coronavirus (Covid-19) crisis.”
The anthrax attack also gave an excuse for the creation of a wide-ranging legislative and institutional framework for implementing medical martial law in the event of a subsequent bioterrorist attack, including the wide-scale adoption of the Model State Emergency Health Powers Act authorizing forced quarantines and forced vaccinations in the wake of a declared health emergency.
The anthrax false flag also gave a gigantic shot in the arm to another major wing of the military-industrial complex: the “biodefense” sector. Before anthrax entered the public consciousness as a weapon of terror in the fall of 2001, bioweapons research had been sidelined and shrouded in secrecy. After the attacks, however, the US government—and, indeed, every government in the world—had a perfect excuse to vastly expand its biological weapons programs in the name of “biological security.” As Jonathan King, a professor of microbiology at MIT, explains:
“[The] response to the anthrax attacks and the bioterrorism initiative has been to launch a nationwide, billion-dollar campaign to ‘defend us’ from unknown terrorists. But the character of this program is roughly as follows: You say, ‘Well, what would the terrorists come up with? What’s the nastiest, most dangerous, most difficult-to-diagnose, difficult-to-treat microorganisms that we can think of. Well, let’s go bring that organism into existence so that we can figure out how to defend against it.’ The fact of the matter is, it’s indistinguishable from an offensive program in which you would do the same thing.”
And now, two decades later, that massive billion-dollar campaign made to “defend us” from the anthrax threat has led to the creation of a vast biosecurity infrastructure. From biological labs conducting gain-of-function research to government offices conducting bioterror “simulations” to legislation granting extraordinary powers to unelected health “authorities” in the wake of the next attack, the groundwork has been laid for the next stage of government-sponsored false flag terrorism.
4. False Flag Bioterrorism
Ever since 9/11 and the anthrax attacks of 2001, the public has been told that the next spectacular terror attack would involve biological agents engineered by shadowy terror groups.
REPORTER: At a Tucson gymnasium, people wait their turn for life-saving pills to be taken after an outbreak of a smallpox virus. Scenarios like these are taking place across the United States. Thankfully, they’re only simulations.
MR. LYNCH: Although we are fortunate not to have experienced a biological attack here in the United States since the anthrax attacks, post-September 11th the threat remains very real. Foreign adversaries have already demonstrated an interest in developing genetic and biological weaponry.
JEANNE MESERVE: GNN has just learned a group calling itself A Brighter Dawn, or “ABD,” is claiming responsibility for the creation and intentional release of the Clade X virus. In a youtube video, a spokesman for the group says the goal is to reduce the human population to pre-industrial levels. That, he says, will bring the world back into balance and prevent the destruction of the planet.
REPORTER: The Center for Disease Control is one of only two labs in the world which officially holds samples of the smallpox virus. The other is in Moscow. But now, bioterror experts fear many other countries may have the virus, and there are concerns it could be used as a weapon. Bioterrorism experts envisage grim scenarios where a suicide terrorist contagious with smallpox walks through a busy airport, infecting hundreds of others who spread the virus to their destinations.
Those warnings have only increased in urgency in this age of COVID.
GATES: We also face a new threat that the next epidemic has good chance of originated [sic] on a computer screen of a terrorist intent on using genetic engineering to create a synthetic version of the smallpox virus or a contagious contagious and highly deadly strain of flu.
RICK BRIGHT: There will be likely a resurgence of COVID-19 this fall.
It’ll be greatly compounded by the challenges of seasonal influenza. Without better planning, 2020 could be the darkest winter in modern history.
Statements like these not only implant in the public mind the idea that the next spectacular terror attack is likely to be biological, but that when such an attack occurs, we should immediately pin the blame on the shadowy terrorists who (we will likely be told) cooked the pathogen up in their bioweapons lab in the caves of Tora Bora.
But, just as anyone with national security experience immediately recognized that 9/11 was not the work of 19 men with boxcutters but in fact bore the hallmarks of a precisely coordinated intelligence operation, so, too, should the public be aware that those with the means, motive and opportunity to create and disseminate a globally spreading infectious pathogen are not cave-dwelling terrorists but well-funded government and military researchers.
Although prohibited by the 1972 Biological and Toxin Weapons Convention, the US has, in fact, maintained an illegal and secret germ warfare research program for decades. Long known to insiders but formally denied by the US government, the existence of the program was confirmed in the pages of The New York Times on September 4, 2001, the same day that the invasion orders for Afghanistan were sent to President Bush for authorization, one week before “the day that changed everything” and two weeks before the beginning of the anthrax false flag.
Although the program was downplayed as “foolish, but not illegal” and portrayed as a defensive program that was largely curtailed in the wake of the end of the Cold War, a groundbreaking 2018 investigation by independent journalist Dilyana Gaytandzhieva found that a network of Pentagon-run biolabs in ex-Soviet bloc states continues to this day to produce deadly bacteria, weaponized viruses and toxins prohibited by the Biological Weapons Convention.
But the US is certainly not alone in its multi-billion dollar quest to develop more deadly—and more precise—biological agents.
Britain’s program, centered around the research at the UK’s secretive Porton Down bioweapon laboratory, included the work of researchers like Vladimir Pasechnik, a microbiologist who had worked on the Soviet germ warfare program weaponizing anthrax and other biological agents before defecting to Britain in 1989. He was hired by the UK government to conduct his own research into anthrax antidotes at Porton Down and died just weeks after the anthrax attacks took place.
Dr. David Kelly, who debriefed Pasechnik after his defection and offered him the job at Porton Down, had told a friend that he was going to write a book exposing what he knew about the bioweapons program—but instead ended up dead on Harrowdown Hill under extremely suspicious circumstances.
The Soviets also had an extensive biological weapons research program. The fruits of that program included the novichok agent that has been blamed for high-profile assassination attempts in recent years, including the poisoning of Sergei and Yulia Skripal who were “randomly” discovered by the Chief Nursing Officer of the British Army just ten miles from the Porton Down bioweapons lab.
It was even reported by The Sunday Times over two decades ago that Israel—which is not a signatory to the Biological Weapons Convention—has worked on “developing a biological weapon that would harm Arabs while leaving Jews unaffected.” The Israel Institute for Biological Research where this research was conducted is a continuation of HEMED BEIT, a biowarfare unit in the Israel Defense Force whose founders believed that “if microbiology could help in providing the means to establish the Jewish State, so be it.” The institute made headlines earlier this year for its “groundbreaking research” identifying coronavirus antibodies and its subsequent quest to develop an Israeli COVID-19 vaccine.
But beyond the secret biological weapons programs, there has been a publicly acknowledged and funded program to weaponize viruses and pathogens that has been ongoing for years. And once again, the threat of bioterrorism has been invoked as a reason for funding this admittedly dangerous research to create the perfect bioweapon.
ANTHONY FAUCI: Bioterror is—there’s always the potential of bioterror. And we have a major bio defense research and development effort that spans agencies from the NIH to do the basic research to be able to develop better vaccines, how you counter engineered microbes, how you approach drug resistance, engineered microbes. The CDC has surveillance mechanisms to determine if there’s new microbes or anything out there in society particularly toxic that could be used in a bioterror situation, the Department of Homeland Security, the Department of Defense—we do all of that.
This work, referred to as gain-of-function research, involves weaponizing biological agents so that scientists can develop vaccines or other defenses against them. Of course, gain-of-function research is, in its key aspects, identical to an offensive biological weapons program, but is simply framed as a defensive and preventative measure.
The work of the researchers in this field has not been without controversy.
In 1995 researchers dug up a victim of the 1918 Spanish flu from the Alaskan permafrost in order to “resurrect” the virus using genetic sequencing.
In 2015, researchers at the Wuhan Institute of Virology participated in experiments weaponizing bat-derived coronavirus that even other molecular biologists warned were presenting the world with a “clear and present danger.” The research even received funding from USAID, which was illegal at the time, as the US had suspended funding for gain-of-function research in 2014.
Time and again, those looking at the history of biowarfare are confronted by a key fact: those who have dedicated their lives to weaponizing pathogens and dreaming up bioterror scenarios aren’t the shadowy terrorist biologists in their cave fortress compound, but the government-funded researchers at both secret and public biolabs around the world.
We have entered an age where the threat of a bioterror attack is very real. The only questions facing the public now are: Who are the real bioterrorists? And can we rely on government agencies, their appointed health authorities, and the corporate media to accurately identify those terrorists in the wake of the next spectacular terror attack?
Conclusion
Two decades ago, the idea of a false flag attack was incomprehensible to the general public. “Why would the government attack itself?” was the oft-heard question of those who could not imagine such duplicity being used to fool a nation into war.
But this is not the world of 2001. It is 2020, and by now nearly everyone is familiar with false flag operations. What was once an obscure tactic deployed by military and intelligence agencies in the shadowy world of spies and soldiers is now openly discussed and debated in the mainstream news.
Make no mistake: this is a major step. An important tool of control, used to pull the wool over the eyes of the public for centuries, had gone from a laughable fringe “conspiracy theory” to an openly acknowledged (and vigorously denied) conspiracy reality within the space of two decades.
But have we really learnt the lessons of history about false flag terrorism? Do we even really know what that term means? And would we recognize it if that trick were employed again in a different context?
They say forewarned is forearmed. Nowhere is that adage more aptly applied than in the realm of false flag terrorism. The entire reason that these deception operations have been used by country after country for centuries is that they are so effective. But they are only effective because throughout those centuries the general public was unable to wrap their minds around a trick so devious and downright evil.
Now we have to completely break the spell that governments have cast over the public. In the event of any spectacular terror attack (biological or otherwise), we have to take the history of false flag operations into account and put the government at the top of the list of suspects. When enough of the population has adjusted their thinking in this way, the trick will have lost its effectiveness and those seeking to direct society through fear will have to abandon it altogether.
This is a monumental task, but it is not to be taken lightly. Given the infrastructure for full-scale medical martial law that has been carefully laid over the past two decades, and given the lockdowns, forced vaccinations, enforced unemployment, and digital dollars tied to social credit scores that have been promised by those seeking to put us through the Great Reset, the future of humanity may depend on our response to the next bioterror attack.
The only question is: Can we wake up enough of the public to these tricks before the real bioterrorists launch their next false flag operation?
Your thoughts and opinions are incredibly important to those who want to direct your behaviour. So it should be no surprise that propagandists float trial balloons in order to gauge public reaction to new proposals before going ahead with their plans. Join James on today’s #PropagandaWatch as he breaks down this important mechanism of propaganda.
Not one area of life will be left untouched by The Great Reset plan, which aims to reform everything from government, energy and finance to food, medicine, real estate, policing — even how we interact with our fellow human beings.
The globalist technocracy is using the COVID-19 pandemic to bypass democratic accountability, override opposition, accelerate their agenda and to impose it on the public against our will.
The Great Reset refers to a global agenda to monitor and control the world through digital surveillance. You’ll be tied to it through an electronic ID linked to your bank account and health records, and a social credit ID that will end up dictating every facet of your life.
The Great Reset is about getting rid of capitalism and free enterprise, and replacing them with technocracy, publicly referred to as “sustainable development” and “stakeholder capitalism”.
There’s not a single area of life that is left out of this Great Reset plan. The planned reform will affect everything from government, energy and finance to food, medicine, real estate, policing and even how we interact with our fellow human beings in general.
Privacy protections are a major hurdle in this plan, which is why every effort is made to get people to loosen their views on the right for privacy. In the U.S., we also have the Constitution that stands in the way, which is why efforts to undermine, circumvent, ignore or nullify it are increasing.
What is this “Great Reset” we’re now hearing about? In a nutshell, the Great Reset refers to a global agenda to monitor and control the world through digital surveillance.
As explained by journalist James Corbett in his Oct. 16, Corbett Report above, the Great Reset is a new “social contract” that ties every person to it through an electronic ID linked to your bank account and health records, and a social credit ID that will end up dictating every facet of your life.
It’s about getting rid of capitalism and free enterprise, and replacing them with “sustainable development” and “stakeholder capitalism” — terms that belie their nefarious, anti-humanity intentions. As noted in the book, “Technocracy: The Hard Road to World Order”:
“… Sustainable Development is Technocracy … The Sustainable Development movement has taken careful steps to conceal its true identity, strategy and purpose, but once the veil is lifted, you will never see it any other way. Once its strategy is unmasked, everything else will start to make sense.”
The grand plan
In her blog post “The Great Reset for Dummies,” Tessa Lena summarizes the purpose behind the call for a global “reset”:
“The mathematical reason for the Great Reset is that thanks to technology, the planet has gotten small, and the infinite expansion economic model is bust — but obviously, the super wealthy want to continue staying super wealthy, and so they need a miracle, another bubble, plus a surgically precise system for managing what they perceive as ‘their limited resources.’
“Thus, they desperately want a bubble providing new growth out of thin air — literally — while simultaneously they seek to tighten the peasants’ belts, an effort that starts with ‘behavioral modification,’ a.k.a. resetting the western peasants’ sense of entitlement to high life standards and liberties (see awful ‘privilege’).
“The psychological reason for the Great Reset is the fear of losing control of property, the planet. I suppose, if you own billions and move trillions, your perception of reality gets funky, and everything down below looks like an ant hill that exists for you. Just ants and numbers, your assets. Thus, the practical aim of the Great Reset is to fundamentally restructure the world’s economy and geopolitical relations based on two assumptions:
“One, that every element of nature and every life form is a part of the global inventory (managed by the allegedly benevolent state, which, in turn, is owned by several suddenly benevolent wealthy people, via technology).
“And two, that all inventory needs to be strictly accounted for: be registered in a central database, be readable by a scanner and easily ID’ed, and be managed by AI, using the latest ‘science.’
“The goal is to count and then efficiently manage and control all resources, including people, on an unprecedented scale, with unprecedented digital … precision — all while the masters keep indulging, enjoying vast patches of conserved nature, free of unnecessary sovereign peasants and their unpredictability.”
Global asset reallocations will not benefit “the people”
These new global “assets” can also be turned into brand new financial instruments that can then be traded. An example of this was given by Vandana Shiva, Ph.D., in my interview with her.
In it, she explained how India is headed toward Zero-Budget Natural Farming — a brand-new concept of farming in which farmers must trade the carbon rate in their soil on the global market if they want to make a living. They’ll get no money at all for the crops they actually grow.
There’s not a single area of life that is left out of this Great Reset plan. The planned reform will affect everything from government, energy and finance to food, medicine, real estate, policing and even how we interact with our fellow human beings in general.
Privacy protections, of course, are a major hurdle in this plan, which is why every effort is made to get people to loosen their views on the right for privacy. In the U.S., we also have the Constitution that stands in the way, which is why efforts to undermine, circumvent, ignore or nullify it are increasing.
“To sum it up, the desired end result is a giant, joyless, highly controlled global conveyor of everything and everybody where privacy is tremendously expensive, dissent is unthinkable, and spiritual submission is mandatory.
It’s like a 24/7 medicated reality, except the medications are both chemical and digital, and they are reporting you back to the mothership, which can then punish you for bad behavior by, say, blocking your access to certain places or by putting a hold on your digital bank account — perhaps without any human intervention at all,” Lena writes.
Stakeholder capitalism
An Oct. 5, Winter Oak article addressed the “technocratic fascist vision” of professor Klaus Schwab, founder and executive chairman of the WEF who wrote the book, “The Fourth Industrial Revolution”. Schwab announced the World Economic Forum’s Great Reset Initiative in June 2020, which includes stripping all people of their privately owned assets.
In addition to being a staunch technocrat, Schwab also has a strong transhumanist bend, and he has spoken of a near future in which humans merge with machines and in which law enforcement will be able to read our mind.
Winter Oak — a British nonprofit social justice organization — points out that Schwab and his globalist accomplices are using the COVID-19 pandemic “to bypass democratic accountability, to override opposition, to accelerate their agenda and to impose it on the rest of humankind against our will.”
“Ultimately, the Great Reset will result in two tiers or people: The technocratic elite, who have all the power and rule over all assets, and the rest of humanity, who have no power, no assets and no say-so in anything.”
This is no conspiracy theory. The plan is out in the open. As noted by Time magazine, “The COVID-19 pandemic has provided a unique opportunity to think about the kind of future we want.” The same statement has been delivered by a number of politicians and organizations around the world in recent months.
Schwab’s book, “COVID-19: The Great Reset” also urges industry leaders and decision makers to “make good use of the pandemic” and “not letting the crisis go to waste.” Incidentally, the owner of Time magazine and founder of Salesforce, Marc Benioff, is also a board member of the WEF, so he’s clearly familiar with the reset plan.
The problem is that while the plan is being sold as a way to, finally, make life fair and equitable for all people, the required sacrifices do not apply to the technocrats running the system. Ultimately, the Great Reset will result in two tiers or people: the technocratic elite, who have all the power and rule over all assets, and the rest of humanity, who have no power, no assets and no say-so in anything.
While technocracy is not a political system but an economic one, in practical terms it does resemble fascism. None of it is being sold under the banner of fascism, of course. Instead, they use financial terms like “stakeholder capitalism,” described by Forbes magazine as “the notion that a firm focuses on meeting the needs of all its stakeholders: customers, employees, partners, the community and society as a whole.”
In that same article, Forbes points out that this strategy has already been tried and failed. It failed because balancing conflicting stakeholder claims was near-impossible and only led to mass confusion and poor returns. The failure of this strategy is what led big businesses to focus on maximizing shareholder value instead.
Now, at a time when big business finds itself under attack for “single-mindedly shoveling money to its shareholders and its executives at the expense of customers, employees, the environment and society as a whole,” the answer, they say, is to return to stakeholder capitalism. But if it didn’t work before, what makes us think it will work now?
“The architects of the plan claim it will reduce food scarcity, hunger and disease, and even mitigate climate change. But a closer look at the corporations and think tanks the WEF is partnering with to usher in this global transformation suggests that the real motive is tighter corporate control over the food system by means of technological solutions.”
Aside from the food industry, partners include data mining giants, telecommunications, weapons manufacturers, finance, drug companies and the biotechnology industry.
Looking at that list, it should come as no surprise that the WEF insists the future of food and public health hinges on genetically modified organisms (GMOs), laboratory-grown protein, drugs and industrial chemicals.
The EAT Forum and the rise of food imperialism
To further the fake food takeover, the WEF has partnered with the EAT Forum, which will set the political agenda for global food production. The EAT Forum was cofounded by the Wellcome Trust, which in turn was established with the financial help of GlaxoSmithKline.
EAT currently collaborates with nearly 40 city governments across Africa, Europe, Asia, North and South America and Australia, and maintains close relationships with imitation meat companies such as Impossible Foods, which was co-funded by Google, Jeff Bezos and Bill Gates.
As noted by The Defender, the ultimate aim is to “replace wholesome nutritious foods with genetically modified lab creations.” To this end, EAT is working with the United Nations Children’s Fund (UNICEF) to establish global dietary guidelines and sustainable development initiatives.
The “Planetary Health Diet” developed by EAT is a diet that is supposed to replace all others. Federic Leroy, a food science and biotechnology professor at University of Brussels told The Defender:
“The diet aims to cut the meat and dairy intake of the global population by as much as 90% in some cases and replaces it with lab-made foods, cereals and oil.”
Vandana Shiva, Ph.D., has raised harsh critique against the proposed diet saying it “is not about nutrition at all. It’s about big business and it’s about a corporate takeover of the food system.” The Defender adds:
“According to EAT’s own reports, the big adjustments the organization and its corporate partners want to make to the food system are ‘unlikely to be successful if left up to the individual,’ and the changes they wish to impose on societal eating habits and food ‘require reframing at the systemic level with hard policy interventions that include laws, fiscal measures, subsidies and penalties, trade reconfiguration and other economic and structural measures.’
But Shiva said this is the wrong approach, because ‘all of the science’ shows that diets should be centered around regional and geographical biodiversity. She explained that ‘EAT’s uniform global diet will be produced with western technology and agricultural chemicals. Forcing this onto sovereign nations by multinational lobbying is what I refer to as food imperialism.’”
The future of food and health care
You can get a feel for where the future of food is headed by analyzing the WEF’s strategic intelligence map. As you can see, this top-down approach ties food production to a wide range of sectors, including biotech, the chemical industry, artificial intelligence, the internet of things and the digital economy.
For more details on Schwab and the WEF’s strategic intelligence plan, see Covert Geopolitics’s article, “Breaking Down the Global Elite’s Great Reset Master Plan.”
Dark Journalist w/ Catherine Austin Fitts: Humanity in the Balance — Our Creative Shared Intelligence Faces a Globalist Financial Coup D’Etat & Incredibly Dark Agenda to Control Humanity
Truth Comes to Light editor’s note: This 3.5+ hour interview touches on a wide range of topics including the unfolding financial coup d’etat, attempts to manufacture a civil war in the US, global government secrecy, secret space program, underground bases, population reduction, the hidden history of humanity, transhumanism (integrating humans with robotics), mind control and much more — with an emphasis on awakening humanity, insistence on transparency, and consciously using our innate creativity to choose genuine humanity and freedom over transhumanism and slavery.
Excerpts:
DJ:You talk a lot about the transhumanist movement and what it’s trying to do. Now it’s right in our face. You’ve been talking about it for years about what they’ve been up to. And you have a whole section dedicated to Bill Gates’ creepy technology.
When you look at what they are essentially trying to do with things like smart phones, with things like nano particles in injections…and with the covid stuff also — the cover your face and all this, don’t interact with each other — what are they fundamentally trying to do there to human interaction? What’s the purpose behind it?
Catherine:Okay, so we live in the middle of a creative shared intelligence.
DJ:Yes.
Catherine:Okay? So we are physical beings but we are electromagnetic beings and we resonate with all life. We resonate with the sunlight and the sun, with the birds and the trees and the animals, with each other and all life. And literally what these guys, as far as I can tell, are trying to do, is put a toll booth between every connection and circumvent the resonation into their machines.
DJ:Wow.
Catherine:So they literally want to grid the entire morphogenetic field and get us to resonate with a machine instead of with life and each other. You know, this is trying to make themselves God.
[…]
Catherine: I really think they believe there is still a middle of the road and they can skate through on the middle of the road and I don’t think there is. I think it’s freedom or slavery, it’s transhumanism or a human civilization, and death is not the worst thing that can happen.
Now we haven’t brought up the weirdest scenario and the most weird scenario, as you know, is David Jacobs’s right.
DJ:Yes. ..And that’s an alien takeover basically…
Catherine:Or an interdimensional.
DJ: Yes. And this is actually very fascinating because there is so much research around it. And certainly the UFO file is undeniable, beyond just its incredible technological…Then you go really outside of it and look at it and you say, is it aliens?…because it is acting so alien.
[…]
Catherine: What’s important to understand is either aliens exist or we have become as aliens from each other. In other words, if the official reality and reality have separated much and the leadership class has separated so much from the average person that we have become as if separate species. So even if aliens don’t exist, you need to understand that they do, because we have a leadership class that sees us as an alien species.
[…]
Catherine:The thing they are trying to destroy, in addition to love, is imagination. Because we have the power and the ability to create and invent our world. We can create babies and we can create all sorts of stuff. We can create our world.
[…]
Catherine:They are tremendously emboldened by the success of the mind control technology… It’s been wildly successful and it’s really worked for them. The problem is, the more you try to engineer life with mind control and machine, the more nuts and incoherent everybody gets…
But what I’m watching is, I really feel like, by corrupting the general mind by the mind control technology, it’s also making them crazy. And I always say, people who win a rigged game get stupid. And I really think as a society, western civilization right now, is collectively — we’re losing our minds.
[…]
Catherine:I keep saying this again and again. I’m going to pound the table. Death is not the worst thing that can happen. Do not be afraid. Okay? You have no reason to fear death. I realize it’s inconvenient, particularly if somebody is depending on your cash flow. But death is not the worst thing that can happen. Slavery is the worst thing that can happen.
So get out of fear. It’s not hopeless. If it was hopeless, they wouldn’t be trying to persuade you that it was hopeless.
Dark Journalist Daniel Liszt welcomes Former Asst. HUD Secretary and Solari Report Publisher Catherine Austin Fitts to the show for a breakthrough discussion of the Global Agenda being rolled out.
Catherine sees a totalitarian great reset with the central controllers trying to keep humanity from discovering our power to shape events and make our own future!
[As a service to protect truth from censorship & to share widely, mirrored copies of this video are available at Truth Comes to Light BitChute, Brighteon, & Lbry/Odyseechannels. All credit, along with our sincere thanks, goes to the original source of this video. Please follow links provided to support their work.]
Solari Report’s growing body of work on the Missing Money
Truth Comes to Light editor’s note: See related videos — Greg Hunter’s interview with Dr. Mark Skidmore about the missing trillions and Richard Dolan’s interview with Dr. David Jacobs about an “alien” agenda of planetary acquisition.
Dr. Mark Skidmore – Deep State Cover-Up of Missing $21 Trillion Deeply Disturbing
“THIS PLANET WILL BE THEIRS.” David Jacobs on the Richard Dolan Show. Dec. 10, 2018.
James Corbett w/ Dan Dicks: The Canadian Military Declares War on Canadians
Dan Dicks of PressForTruth.ca joins us to delve deeper into the insane story of the Canadian military fake wolves psyop. We go beyond the ludicrous story of the government using fake wolves to scare the public to discover that the Canadian military is now openly announcing that they are targeting the Canadian public themselves with their newly-weaponized public affairs department. The Canadian military has declared war on Canada. Will Canadians even notice?
The Canadian Military Declares War on Canadians – #PropagandaWatch
[As a service to protect truth from censorship & to share widely, mirrored copies of this video are available at Truth Comes to Light BitChute, Brighteon, Lbry & Odysee channels. All credit, along with our sincere thanks, goes to the original source of this video. Please follow links provided to support their work.]
cover image credit pixabay
Jon Rappoport: Trump/Biden — Two Bombshell Breaking Stories | And, Why Trump Must Win
Excerpts:
“Trump passively gave in. He opened the door to a coup and then stood aside.
Biden is a complete puppet of the coup. He wants to take the tyranny to a whole new level, as his masters have commanded.”
— “Periods of tyranny come from the Right and they come from the Left. This one is coming mainly from the Left with its delusional Marxist utopian fantasies. But when all is said and done, all tyrannies, no matter their disguise, no matter their brand of rhetoric, come from power at the top. And power at the top has no political ideology. Ideology is merely a tool for propaganda and mind control.”
— “Trump is the lesser foe. With a large enough outpouring of public sentiment and demand on behalf of freedom, he could become, in certain but not all respects, an ally. Don’t trust him. Try to force his hand.”
— “The Oligarchs—bankers, mega-corporate CEOs, financiers, government leaders, intelligence agencies—collude to cut out competition so they can stand alone at the summit of the mountain. And they call this arrangement SOCIALISM. They PROMOTE socialism. They’ve staked out OWNERSHIP of socialism worldwide.”
— ‘ “We are being socialized in America and everybody knows it. If we had a chance to sit down and have a cup of coffee with the man in the street…he might say: ‘You know, the one thing I can never figure out is why all these very, very wealthy people like the Kennedys, the Fords, the Rockefellers and others are for socialism. Why are the super-rich for socialism? Don’t they have the most to lose…?’ In reality, there is a vast difference between what the promoters define as socialism and what it is in actual practice. The idea that socialism is a share-the-wealth program is strictly a confidence game to get the people to surrender their freedom to an all-powerful collectivist government. While the insiders [Oligarchs] tell us we are building a paradise on earth, we are actually constructing a jail for ourselves.” ‘
ONE: Tucker Carlson announced, on his highly popular FOX broadcast, that a trove of Biden documents implicating Biden in illegal business relationships with China, the Ukraine, and other countries has gone missing. [1]
The documents were shipped through a major commercial courier, from Manhattan to Carlson by FOX staff, and somewhere along the route, the envelope was found open by courier employees—and the contents were gone.
The courier did an extensive investigation of the route and found no evidence to indicate how this happened.
Questions: Did no one at FOX make a copy of these documents? There was only one set? The docs couldn’t have been sent to Tucker electronically? Tucker should consider the possibility that someone at FOX was the culprit.
TWO: “Executive Order on Creating Schedule F in the Excepted Service.” Sounds meaningless, right? It’s not. [2]
President Trump has just released a new executive order which gives him the power to fire a wide range of bureaucratic federal employees who resist implementing White House policies.
The executive order strips these bureaucrats of all sorts of built-in job protections.
It’s no secret that, since taking office, Trump has been receiving huge pushback from federal agencies, all of which are part of the Federal Branch, under his command.
If Trump wins the election, his order will stay intact. If Biden wins, he’ll cancel the order and go back to federal business as usual.
For decades, these alphabet agencies have been exceeding their legal powers by essentially making law. They do this by taking newly passed Congressional legislation and fashioning enforcement-regulations that “fit” the legislation.
Except, in practice, the agencies interpret the laws to their liking. They pervert the meaning of laws.
The American Thinker quotes the Washington Post [3]: “The directive [executive order], issued late Wednesday, strips long-held civil service protections from employees whose work involves policymaking, allowing them to be dismissed with little cause or recourse, much like the political appointees who come and go with each administration.”
“Federal scientists, attorneys, regulators, public health experts and many others in senior roles would lose rights to due process and in some cases, union representation, at agencies across the government. The White House declined to say how many jobs would be swept into a class of employees with fewer civil service rights, but civil service experts and union leaders estimated anywhere from tens of thousands to hundreds of thousands in a workforce of 2.1 million.”
There is major upside and downside to this executive order.
On the one hand, the president can fire bureaucrats who resist his policies because they want to undermine him. He can also fire bureaucrats who fashion regulations that pervert Congressional legislation.
On the other hand, the president can also fire bureaucrats who are simply doing an honest job which happens to get in the way of the president’s corrupt practices.
For example, the president wants a new class of dangerous pesticides green-lighted by the EPA. The EPA refuses to knuckle under. But under threats of being fired, EPA executives “reconsider.”
Of course, big-time corporations and other actors already exert corrupt influence over these federal agencies.
On the plus side, Trump might be able to fire Tony Fauci from his long-held throne at the National Institutes of Health.
Here are two backgrounders…
ONE: Why Trump must win.
For people who want to live free lives, who know what freedom is, it’s time to acknowledge that we’re living in a new age of tyranny.
It’s not coming, it’s already here.
Developments over the past nine months have shown this. On the back of a false pandemic, states have been locked down; over a million businesses have been closed; thus, millions of lives have been destroyed or taken to the brink of destruction; large cities have been decimated.
If that isn’t tyranny, I don’t know what is.
And it’s not over. Not by a long shot. At the drop of a hat, new lockdowns can be imposed.
But understand—-human society does pass through these episodes and periods of tyranny. We are in one now. We are not immune.
So at this point, there are questions about what to do, and these questions are strategic. They are asked from the basis of realizing what we are IN and UNDER. Rule by force. Rule through deception.
The last nine months were presided over by Donald Trump. There is no escaping that fact. He gave in. He stood aside. He was grievously and criminally derelict in his duty to freedom and liberty and the Constitution. He failed to keep America open.
He will never admit it, and neither will his most ardent supporters, who weave tales of imminent Trump-rescue by “citing” his unparalleled genius and his brilliant secret plans.
Popular leaders always have legions of true believers. This is nothing new. Don’t you think, in centuries past, when kings claimed to rule by Divine Right, that their followers concocted and believed extraordinary myths justifying their kings’ monumental acts of oppression?
But from where we stand now, and the questions of STRATEGY we are facing, in this new age of tyranny, we’re looking at two men who are vying for the presidency.
Who would be worse, Trump or Biden?
Trump passively gave in. He opened the door to a coup and then stood aside.
Biden is a complete puppet of the coup. He wants to take the tyranny to a whole new level, as his masters have commanded.
Biden doesn’t require his followers to make excuses for his criminal acts—as in the case of Trump. Biden’s followers WANT those criminal acts. They want more lockdowns. They want national mask mandates. They want forced tracing, testing, and vaccination, ORDERED FROM THE FEDERAL LEVEL, wiping out any resistance from brave governors, however few they may be.
Biden’s followers want climate change to move to the top tier of the federal agenda, in the form of reduced energy-output quotas for all companies. More destruction.
Biden’s followers want more riots in cities, and widespread defunding of the police. They truly believe “social justice” movements will effect beneficial change—when, in fact, these movements are funded by the super-wealthy, on behalf of socialism, which IS an illusion of share-and-care, a covert operation leading to even greater government of the rich, by the rich, for the rich. Because treacherous billionaires will end up owning all the means of production. If you need an education along these lines, start with Gary Allen’s 1971 classic, None Dare Call It Conspiracy.
For those who think Trump is an inveterate liar through and through, Biden is easily his equal.
Periods of tyranny come from the Right and they come from the Left. This one is coming mainly from the Left with its delusional Marxist utopian fantasies. But when all is said and done, all tyrannies, no matter their disguise, no matter their brand of rhetoric, come from power at the top. And power at the top has no political ideology. Ideology is merely a tool for propaganda and mind control.
Liberty and freedom are not ideological, either. They are the outcome of thousands of years of struggle. Their adherents know individual responsibility is a key corollary. The individual is free to live his life in any way he wants to, as long as he doesn’t encroach on another’s freedom.
Trump, even in his addled and manic state, understands some part of this. Biden has given up any pretense of understanding. He now comes from the school of, “Since we know what is best for you, we’ll impose it.” And that’s assuming Biden is mentally coherent, even on his best day.
On the medical front, Trump has shown some willingness to challenge the dictates of Fauci and the CDC. Biden is solidly in the camp of, “I’ll consult the experts and follow their advice.” That is a lethal position. For example, expect him, if elected, to push for a FEDERAL mandate to impose a toxic COVID vaccine.
If enough of the public demands freedom from lockdowns and masks and distancing, Trump will go along, at least part of the way. Biden will try to crack down.
Before his brain aneurysm and pulmonary thrombosis, in 1988, Biden was a highly intelligent political operator. His brand of globalism was similar to Bill Clinton’s, but without Clinton’s self-confident flair and big bullshit front. Since 1988, Biden has gradually deteriorated. If elected, there is every chance he won’t be able to finish his term, and the dangerously corrupt hatchet woman, Kamala Harris, would take over the Oval Office.
Trump modulates his failures by maintaining a relentlessly upbeat attitude. He covers his COVID betrayal (refusing to keep the economy open) with this super-salesman’s con and shuck and jive.
All in all, we are looking at a choice of opponents in the war for freedom. Trump and Biden. Strategically speaking, the choice is clear.
Trump is the lesser foe. With a large enough outpouring of public sentiment and demand on behalf of freedom, he could become, in certain but not all respects, an ally. Don’t trust him. Try to force his hand.
In a new age of tyranny, that’s enough for now.
Presidents are not messiahs.
BACKGROUNDER TWO: The Biden agenda.
I wrote this article several years ago. It spells out one of the central ruses of our time, and it is a ruse the puppet Biden prefers, because the men who control his strings prefer it…
There are “people’s” groups all over the world who advocate the overthrow of the Oligarchs who control nations.
These people’s groups want to install socialism as the answer to Oligarchy.
That’s preposterous.
The Oligarchs—bankers, mega-corporate CEOs, financiers, government leaders, intelligence agencies—collude to cut out competition so they can stand alone at the summit of the mountain. And they call this arrangement SOCIALISM. They PROMOTE socialism. They’ve staked out OWNERSHIP of socialism worldwide.
In other words, the “people’s” groups, who claim to be battling for a better world, are doing the Oligarchs’ bidding. Unconsciously, or on purpose.
Useful idiots.
Socialism has never been about toppling power-hungry leaders. Its pretension of equality and share-and-care is a cover for totalitarianism by the few, for the few.
Karl Marx, while predicting a coming utopia on Earth, expressed the absolute need for a “transition” phase called the “dictatorship of the proletariat.”
Of course, that was a partial misnomer. The “dictatorship” part was correct, but the proletariat would never run it. They would labor for it. They would look up from ground level at the leaders who were supposedly their friends and guardians—and soon realize they’d been taken in by a long con. There was no transition government. There was just the same old Oligarchy under another name, that’s all.
From Gary Allen’s classic, None Dare Call It Conspiracy, published 50 years ago:
“We are being socialized in America and everybody knows it. If we had a chance to sit down and have a cup of coffee with the man in the street…he might say: ‘You know, the one thing I can never figure out is why all these very, very wealthy people like the Kennedys, the Fords, the Rockefellers and others are for socialism. Why are the super-rich for socialism? Don’t they have the most to lose…?’ In reality, there is a vast difference between what the promoters define as socialism and what it is in actual practice. The idea that socialism is a share-the-wealth program is strictly a confidence game to get the people to surrender their freedom to an all-powerful collectivist government. While the insiders [Oligarchs] tell us we are building a paradise on earth, we are actually constructing a jail for ourselves.”
When a mega-corporate CEO, whose company is in deep financial trouble, magically secures a giant loan through a crony, and when that corporation continues to pollute the land and destroy lives, and while the government agency that should be hauling off the CEO to prison sits on its hands, that’s socialism in practice. That’s the real thing.
The government may not officially own such corporations, as in the classical definition of socialism, but at the top, the government and the biggest corporations are cooperating, as one. It’s a distinction without a difference.
Why don’t more people understand all this?
Because their minds are clouded with propaganda and feel-good New Age oatmeal. Because they’re convinced that believing in something that sounds good on the surface (“a better and more just world for all”) is enough, is a pinnacle of achievement for them. And since they’re told this belief is socialism, they’re for it.
They will fall for any program on that basis. If pernicious medical experts assure them that mandated mass vaccination will protect the planet from disease, they will snap up that vision in a minute. “A healthy Earth for everyone.” It must be true. It feels right.
Here is an astonishing statement from the Mayor of New York, Bill de Blasio [4]: “What’s been hardest is the way our legal system is structured to favor private property. I think people all over this city, of every background, would like to have the city government be able to determine which building goes where, how high it will be, who gets to live in it, what the rent will be. I think there’s a socialistic impulse, which I hear every day, in every kind of community, that they would like things to be planned in accordance to their needs. And I would, too…Look, if I had my druthers, the city government would determine every single plot of land, how development would proceed. And there would be very stringent requirements around income levels and rents. That’s a world I’d love to see, and I think what we have, in this city at least, are people who would love to have the New Deal back, on one level. They’d love to have a very, very powerful government, including a federal government, involved in directly addressing their day-to-day reality.”
The control of private property, from above, is of course one of the tenets of socialism.
Oligarchs, who promote their brand of socialism, who are also Globalists (no nations; no borders; global governance), want to sweeten their pot through floods of immigrants. No, they’re not thinking about “doing good.” They have propaganda operatives who spout that line.
They’re thinking about how they can blur and erase all sorts of distinctions surrounding private ownership of private property—and instead, disruptively resettle immigrants, make them dependent on the State, sink property values, and induce more and more citizens to accept the idea that “everything belongs to everybody.”
This gibberish phrase actually means: the Oligarchs own it all.
This is their premise and their goal.
They mean business, literally and figuratively.
On a much lower level, scratch the surface of any self-proclaimed socialist who happens own a home, and watch what happens when you demand he turn that home over to “the people.” He suddenly becomes a raw naked capitalist. He rails against the State…
The State—to whom, when the pressure is off, he claims every citizen should swear allegiance, so that money and property and services and goods and energy and every necessity and luxury of life can be managed, for the benefit of all.
This article illustrates the Biden agenda, stripped of pretense.
Echoing across 50 years, here is another excerpt from Gary Allen’s, “None Dare Call It Conspiracy”:
“What we are witnessing is the Communist tactic of pressure from above and pressure from below, described by Communist historian Jan Kozak as the device used by the Reds to capture control of Czecho-Slovakia. The pressure from above comes from secret, ostensibly respectable Comrades in the government and Establishment, forming, with the radicalized mobs in the streets below, a giant pincer around middle-class society. The street rioters are pawns, shills, puppets, and dupes for an oligarchy of elitist conspirators working above to turn America’s limited government into an unlimited government with total control over our lives and property.”
“The American middle class is being squeezed to death by a vise…In the streets we have avowed revolutionary groups such as the Students for a Democratic Society (which was started by the League for Industrial Democracy, a group with strong C.F.R. ties), the Black Panthers, the Yippies, the Young Socialist Alliance. These groups chant that if we don’t ‘change’ America, we will lose it. ‘Change’ is a word we hear over and over. By ‘change’ these groups mean Socialism. Virtually all members of these groups sincerely believe that they are fighting the Establishment. In reality they are an indispensable ally of the Establishment in fastening Socialism on all of us. The naive radicals think that under Socialism the ‘people’ will run everything. Actually, it will be a clique of Insiders in total control, consolidating and controlling all wealth. That is why these schoolboy Lenins and teenage Trotskys are allowed to roam free and are practically never arrested or prosecuted. They are protected. If the Establishment wanted the revolutionaries stopped, how long do you think they would be tolerated?”
“Instead, we find that most of these radicals are the recipients of largesse from major foundations or are receiving money from the government through the War on Poverty. The Rothschild-Rockefeller-C.F.R. [Council on Foreign Relations] Insiders at the top ‘surrender to the demands’ for Socialism from the mobs below. The radicals are doing the work of those whom they hate the most.”
Does that excerpt from “None Dare Call It Conspiracy,” written in 1971, sound familiar today? Of course it does. It reflects the same old strategy of pressure applied from both the top and bottom. The squeeze play.
The super-rich monopolists pretend to “bow to the socialist wishes” of the underclass and the protestors and the rioters.
It’s a straight con.
Don’t get caught in the word game which confuses Communism, Socialism, the Corporate State, Fascism, and Crony Capitalism.
When you put all these terms through the wash, they come out looking the same. They mean power at the top, disguised to appear as popular movements.
This is what lies beneath the “I have a plan” statements of Joe Biden.
In the same way the CIA invented foreign enemies which required us to go to war, there are people who have invented stories of fearful germs that demand medical treatment and prevention. The story tellers know that among the public, many people WANT the germ, need it, and even love it. Yes, love it, after enough conditioning has helped them along the path of surrender.
The COVID operation aims to engulf all of civilization in a preposterous and fake medical nightmare.
The operation has its roots in “modifying” citizens to accept medical dictates.
There are many kinds of such dictates, and it would take volumes to explore them all. Here I present a set of numbers from the US National Center for Health Statistics, a division of the CDC, covering the year 2018:
Percent of adults who had contact with a health care professional: 84.3%.
Percent of children who had contact with a health care professional: 93.6%.
Number of physician office visits (2016): 883.7 million.
Try to grasp how this unprecedented rate of exposure to doctors shapes the minds of Americans. Appointments, tests, diagnoses, advice, orders, prescriptions, drugs and vaccines, follow-ups, referrals to specialists.
These factors alone—never mind the toxic effects of treatments, or wall to wall medical ads and other propaganda—add up to a medical civilization.
Given this reality, how do you think people are going to respond when they are told there is a pandemic and they must follow orders?
After a hundred years of Rockefeller Medicine…new normal? We’ve been living under the new normal for a long time.
How many drug prescriptions do you think are written in the US every year? According to statista.com, “It is estimated that in 2019, 4.38 billion retail prescriptions will be filled throughout the United States.”
Many, many people accept the ubiquitous medical civilization without thought or pause. It’s “just the way things are.”
Pretended pandemics are an arm of medical civilization. But now we’ve reached a point where The Medical is a gateway into a technocratic Brave New World.
This attempted transition is launched from the foundation of lifelong conditioning of the public to doctors and everything those doctors order and represent.
Mind control par excellence.
Two important groups of people—politicians and journalists—are operating from bias in their decisions, because they, too, have been trained to place themselves under the care of doctors on an ongoing basis. Are they going to rip out that hard wiring of their own experience when the rubber meets the road, when they’re faced with professional questions about medical credibility? No. They’re going to side with the CDC and WHO and university experts.
What I’m describing in this article goes beyond the acceptance of “Science” as the dominant paradigm. This conditioning is deeply personal and deeply seated in the minds of people who have been trudging along the bleak path of medical care since early childhood. Medical care for every so-called “symptom.”
I have spent many hours exposing the actual death and maiming effects of medicines on the population. Again, here I’m simply discussing the up-close connection between eternal patient and doctor.
In that sense, telling a dedicated person to take off his mask is telling him to destroy what he believes is a deep lifeline, without which he might very well drown.
Medical civilization’s leaders want us to bow down to the germ. They want us to drool like Pavlov’s dogs, when they ring the bell signaling the presence of a “new virus.” Our anticipated food, in this case, is supposed to be treatment. Treatment and containment measures.
Surely, a Declaration of Medical Independence is needed. “When in the course of human events, it becomes necessary for one people to dissolve the medical bands which have connected them with some Health Authority…whenever any Form of Medicine becomes destructive…it is the Right of the People to alter or to abolish it, and to institute new Medicine, laying its foundation on such principles and organizing its powers in such form, as to them shall seem most likely to effect their Safety and Happiness…”
Under the heading of “such principles,” one statement would make it clear that every person has the natural right to reject false faith in the germ, in its power, and in its very existence.
Let those who fear the germ, or want it, cling to it like an idol, if they must, if they refuse to be dissuaded. The rest of us will go our way, secure in our freedom from the idolatry, knowing that medicalized civilization is a tyrant, built without our consent.
Keeping freedom is now the great challenge.
The global lockdowns, present and future; the business closures; the bankruptcies; the resultant family breakups and suicides and drug addictions; the expansion of poverty, hunger, starvation; the desolation of once-great cities—on what basis has all this destruction been launched?
A story about a virus.
So pardon me if I keep attacking that story. If I keep pointing out gaping holes in that story. My basic position is this: I reject the cultish rhetoric coming out of labs. It is divorced from the world of human beings. It aims to claim ownership over our bodies, minds, and souls. Through one abstraction piled on another, its proponents have staked out a cause that is anti-life. With the data they derive and invent from their serums and sequencing, they set up a prison in which we are supposed to be biological machines that merely react to the stimuli of microbes.
Reject that lunatic non-reality.
The set-up and the con are clear: “We say there is a deadly virus on the loose. We describe it and promote it. We run the game and make the rules. We say you are unprotected unless we protect you with treatment and containment measures. We can quibble about which treatments. We can quibble about how much containment, where and when, and under what circumstances, since we define the circumstances; and we can loosen and tighten the rules at our discretion. But in the end, we are the sellers and you are the buyers. You buy our story. We are a protection racket. You give us your lives or we close you down. And guess what? Either one of those choices produces the same result. Get it?”
So when I hear someone say, in effect, THIS containment measure is necessary and effective, but THAT one is minimally effective, and THIS country did well by adopting a LESS RESTRICTIVE MODEL, and SMART CONTAINMENT WOULD LOOK LIKE THIS, I know that person has bought enough of the story to keep the basic con going; and the elite planners are winning.
As my readers know, I’ve been exposing the fact that no one has proved the SARS-CoV-2 virus exists. I’ve been exposing the fact in a number of articles, coming at the issue from multiple angles. [1] [2] [3] [4] [5] [6] [7] [8]
I’m not surprised at what I’ve found. I could offer MANY reasons for my lack of surprise. In this article, I’ll just cite one reason. A prior case with similar features.
That case is astonishing because: it was exposed in the mainstream press; many alternative news outlets failed to recognize the implications; most independent reporters have rarely, if ever, mentioned the scandal.
It’s as if there is a fear of facing up to fraud beyond a certain level of “acceptability.”
“Yes, we can expose this fraud and that one, but the other one over THERE…don’t touch it. It’s too hot, it’s too big. Let’s pretend it didn’t happen. Let’s gloss over it and move on to other things…”
And with that, I take you back to the summer of 2009. The world was agog with a pandemic called Swine Flu, caused by the H1N1 virus.
The CDC was reporting thousands of cases in America. A new vaccine had been rushed into production.
But behind the curtain, something was wrong. Actually, the CDC had STOPPED counting cases. How could that be? The agency’s main task was reporting illness and death numbers. And in the wake of their stoppage, how could the CDC claim to know there were thousands of Swine Flu cases in the US?
These questions intrigued a star investigative reporter at CBS, Sharyl Attkisson. She dug in and found out why the CDC had stopped counting cases.
Here, from an interview I conducted with her, several years ago, is her explanation:
Rappoport: In 2009, you spearheaded coverage of the so-called Swine Flu pandemic. You discovered that, in the summer of 2009, the Centers for Disease Control, ignoring their federal mandate, [secretly] stopped counting Swine Flu cases in America. Yet they continued to stir up fear about the “pandemic,” without having any real measure of its impact. Wasn’t that another investigation of yours that was shut down? Wasn’t there more to find out?
Attkisson: The implications of the story were even worse than that. We discovered through our FOI efforts that before the CDC mysteriously stopped counting Swine Flu cases, they had learned that almost none of the cases they had counted as Swine Flu was, in fact, Swine Flu or any sort of flu at all! The interest in the story from one [CBS] executive was very enthusiastic. He said it was “the most original story” he’d seen on the whole Swine Flu epidemic. But others pushed to stop it [after it was published on the CBS News website [9]] and, in the end, no [CBS television news] broadcast wanted to touch it. We aired numerous stories pumping up the idea of an epidemic, but not the one that would shed original, new light on all the hype. It was fair, accurate, legally approved and a heck of a story. With the CDC keeping the true Swine Flu stats secret, it meant that many in the public took and gave their children an experimental vaccine that may not have been necessary.
—end of interview excerpt—
The routine lab testing of tissue samples from the most likely Swine Flu patients was coming back, in the overwhelming percentage of cases, with: NO SIGN OF SWINE FLU OR ANY OTHER KIND OF FLU.
Attkisson’s article about this scandal, published on the CBS News website, languished there. The next, bigger step—putting out the story on CBS television news—was waylaid. No deal. And CBS shut down any future investigation on the subject. Attkisson’s article died on the vine. No other major news outlet in the world picked up her article and ran with it deeper into the rabbit hole.
Those test samples from “Swine Flu patients” were being analyzed at state labs all over the country. The analysis was looking for the H1N1 virus, the purported cause of Swine Flu. Whatever the types of lab tests being done, they were coming back negative.
In other words, the virus wasn’t there. It was missing.
The whole pandemic, in the US, was resting on a virus that was absent.
There are important differences between the Swine Flu and COVID debacles. But you get the idea. Where is the virus?
There are punch lines to the Swine Flu story. One of them is: mainstream molecular biologists, geneticists, infectious disease specialists, and public health experts were not deterred in the slightest by Sharyl Attkisson’s revelations. These professionals did not go back to the drawing board. They did not question their own methods. They never questioned their ability to discover or isolate a new virus. They remained unshakable in their biases.
That’s called a clue.
Here’s another clue. About three weeks after Attkisson’s article was published by CBS, the CDC—the agency Attkisson had exposed—decided to double down and tell a new fantastic lie.
On November 12, 2009, WebMD published that CDC lie: “Shockingly, 14 million to 34 million U.S. residents — the CDC’s best guess is 22 million — came down with H1N1 swine flu by Oct. 17 [2009].” (“22 million cases of Swine Flu in US,” [10] by Daniel J. DeNoon).
22 MILLION cases. Based on nothing. Based on a virus that wasn’t there.
For months, I’ve been providing evidence that the SARS-CoV-2 virus has not been proven to exist.
Several recent objections to my analysis have been brought forward.
I’m not interested in mentioning names or getting into disputes with people who might otherwise be doing important work.
One objection that’s been raised: a key CDC document [1] I quoted [2], which openly admitted that the virus was “not available,” was not really published in July of this year. It was reprinted or updated in July; it was originally published in February, when presumably, the CDC might have had a problem obtaining isolated virus.
Really? The “pandemic” was already underway in February. The CDC, one of the two most powerful public health agencies in the world, couldn’t get isolated virus then—couldn’t get it anywhere. In other words, there was a declared pandemic without a proven virus.
That is a damning fact. I don’t care whether it was February or July. If the CDC couldn’t get the virus, no one had it.
No one had it, because no one had isolated it. Researchers simply assumed it existed.
Not only that, the CDC document [1] [2] in which the agency admitted the virus was “not available” was a long article describing how to perform the PCR test for the virus. What virus? The one that wasn’t there?
You put together a test procedure that will change the fate of humanity, but you don’t have the item the procedure is supposed to detect. This is permissible? This is excusable? Not unless science is fairy tales.
A few superficial critics of my work should also realize this CDC document is far from my only evidence showing the virus hasn’t been isolated. They should read all my articles on the subject.
Another objection to my analysis: labs do, in fact, have isolated virus in the form of “viral stocks.”
But what does that phrase mean? It means SOUP. In dishes, in labs, researchers assume they have virus mixed with cells, mixed with chemicals and drugs and who knows what else. If this is “isolation,” a rabbit is a spaceship.
Further, it is claimed, because some of those cells—monkey cells—die in the dish in the lab, this means the virus is there and is doing the killing.
Nonsense. First of all, the cells are being starved of nutrients. Second, they’re open to being poisoned by the drugs and chemicals in the soup. The presumption of the virus doing the killing is unwarranted and absurd. [3] [4] [5]
The third objection to my analysis: researchers can assemble the PCR test without actually having the virus. They can substitute “synthetic RNA” which is a close match to the virus.
I see. And they know the synthetic RNA is a close match to the missing virus exactly how? Answer: they don’t know. They assume. They pretend. [6] [7] [8] [9] [10] [11]
This would be like saying: “Ahem. There is an unknown planet in our solar system. We haven’t seen it, we don’t know where it is, we don’t know what it looks like, but we do know the moon is a very close version of the unknown planet. Therefore, we can use everything we know about the moon to infer a precise description of the unknown planet.”
This kind of tap-dancing might win you a prize at a junior high school variety show, but it has nothing to do with science.
For those who want to further explore the core issue of the existence of the virus—e.g., medical professionals, who have large gaps and blind sports in their understanding—I STRONGLY suggest accessing the work of Dr. Andrew Kaufman [12] and Dr. Tom Cowan [13].
I understand that some people who are very much opposed to the lockdowns and the economic destruction want to keep the argument along the channels of: the deceptive PCR test; the false case and death numbers; the dangerous vaccine; the ripping away of Constitutional and natural freedoms.
Anyone who has been reading my more than 200 articles about COVID [14] knows I’ve been tackling those issues since the beginning. But the existence of the virus is not merely a distraction. It’s at the starting gate of the whole effort to initiate new levels of enslavement for all humans. It can’t be brushed aside.
It would be foolish of me to criticize people who are otherwise doing very important work to stem the tide of the technocratic takeover of Earth, simply because they aren’t addressing the existence of the virus.
If a few of them want to criticize me, fine. I’ve been around the block more times than I can count. It’s not a problem. I’d suggest, though, they do more than a dip a toe into the water of the stupendous virus-fraud.
And don’t try the tactic of accusing me of “confusing people about the pandemic.” That is not a standard for measuring veracity. It’s actually a low-level con. When two sides disagree, proponents of one side assert the other side is sowing confusion. Baloney. The confusion, in this case, is inherent in the conventional view of virus-isolation and proof of discovery.
One disease one germ, a thousand diseases a thousand germs—this lock-step ironclad pharmaceutical propaganda of more than a century has caused monstrous harm. It’s time to end the madness.
We don’t need unanimity on every issue. But we do need a measure of good will and decency. I’m glad to report that, with only a few exceptions, this is what I find.
Coda: Blithely accepting the existence of the virus puts people on a slippery slope. From that point on, they may accept at least partial anti-human “containment measures.” Lockdowns under certain circumstances, some mask wearing, some distancing, some restrictions on the size and nature of gatherings, some isolation from loved ones, some tracing, some testing. Before they know it, they’re dealing from a position of weakness and compromise: “I agree that a certain amount of destruction is necessary, but not as much destruction as Fauci wants…” On moral, spiritual, strategic, political, economic, and scientific grounds, that’s disastrous.
Now, as a backgrounder, here is my article about Dr. Tom Cowan’s recent exploration of the COVID virus invented out of sheer nonsense: [5]
Dr. Tom Cowan explores the COVID virus invented out of sheer nonsense
—Dr. Cowan analyzes yet another key document posted by the CDC, in their journal, Emerging Infectious Diseases: “Severe Acute Respiratory Syndrome Coronavirus 2 from Patient with Coronavirus Disease, United States”—
by Jon Rappoport
October 19, 2020
The hits keep coming. The CDC used an arbitrary computer “tinker-toy” process to invent a description of the virus. The virus that no one has proven exists. This is the basic conclusion of Dr. Tom Cowan.
Dr. Cowan: “[The CDC journal article] was published in June 2020 [original publication, March 2020]. The purpose of the article was for a group of about 20 virologists to describe the state of the science of the isolation, purification and biological characteristics of the new SARS-CoV-2 virus, and to share this information with other scientists for their own research. A thorough and careful reading of this important paper reveals some shocking findings.”
“First, in the section titled ‘Whole Genome Sequencing,’ we find that rather than having isolated the virus and sequencing the genome from end to end, they found 37 base pairs from unpurified samples using PCR probes. This means they actually looked at 37 out of the approximately 30,000 of the base pairs that are claimed to be the genome of the intact virus. They then took these 37 segments and put them into a computer program, which filled in the rest of the base pairs.”
In other words, the sequencing of the SARS-CoV-2 virus was done by assumption and arbitrary inference. If this is science, a penguin is a spaceship.
Cowan: “To me, this computer-generation step constitutes scientific fraud. Here is an equivalency: A group of researchers claim to have found a unicorn because they found a piece of a hoof, a hair from a tail, and a snippet of a horn. They then add that information into a computer and program it to re-create the unicorn, and they then claim this computer re-creation is the real unicorn. Of course, they had never actually seen a unicorn so could not possibly have examined its genetic makeup to compare their samples with the actual unicorn’s hair, hooves and horn.”
“The researchers claim they decided which is the real genome of SARS-CoV-2 by ‘consensus,’ sort of like a vote. Again, different computer programs will come up with different versions of the imaginary ‘unicorn,’ so they come together as a group and decide which is the real imaginary unicorn.”
As I’ve been stating [10], the “discovery” of the “new virus” was actually the foisting of a PRE-DETERMINED STORY ABOUT A VIRUS. Nothing real or believable about it.
But once the official pattern is laid down, others follow it dutifully.
Dr. Cowan uncovers more insanity in the CDC journal article. Using the ASSUMED new virus, in an UN-ISOLATED STATE, the researchers try to prove it is harmful by injecting it on to several different types of cells in the lab:
Cowan: “The real blockbuster finding in this study comes later, a finding so shocking that I had to read it many times before I could believe what I was reading. Let me quote the passage intact:”
“’Therefore, we examined the capacity of SARS-CoV-2 to infect and replicate in several common primate and human cell lines, including human adenocarcinoma cells (A549), human liver cells (HUH 7.0), and human embryonic kidney cells (HEK-293T). In addition to Vero E6 and Vero CCL81 cells [monkey cells]. … Each cell line was inoculated at high multiplicity of infection and examined 24h post-infection. No CPE was observed in any of the cell lines except in Vero [monkey] cells, which grew to greater than 10 to the 7th power at 24 h post-infection. In contrast, HUH 7.0 and 293T showed only modest viral replication, and A549 cells [human cells] were incompatible with SARS CoV-2 infection’.”
“What does this language actually mean, and why is it the most shocking statement of all from the virology community? When virologists attempt to prove infection, they have three possible ‘hosts’ or models on which they can test…”
“The third method virologists use to prove infection and pathogenicity — the method they most rely on — is inoculation of solutions they say contain the virus onto a variety of tissue cultures. As I have pointed out many times, such inoculation has never been shown to kill (lyse) the tissue, unless the tissue is first starved and poisoned.”
“The shocking thing about the above [CDC journal] quote is that using their own methods, the virologists found that solutions containing SARS-CoV-2 — even in high amounts — were NOT, I repeat NOT, infective to any of the three human tissue cultures they tested. In plain English, this means they proved, on their terms, that this ‘new coronavirus’ is not infectious to human beings. It is ONLY infective to monkey kidney cells, and only then when you add two potent drugs (gentamicin and amphotericin), known to be toxic to kidneys, to the mix.”
“My friends, read this again and again. These virologists, published by the CDC, performed a clear proof, on their terms, showing that the SARS-CoV- 2 virus is harmless to human beings. That is the only possible conclusion, but, unfortunately, this result is not even mentioned in their conclusion. They simply say they can provide virus stocks cultured only on monkey Vero cells, thanks for coming.”
So first…use a process of genetic sequencing that involves concocting, out of an arbitrary computer program…
The existence and structure of the “new virus”…
And then, taking a soup that the researchers claim contains the virus, in an un-isolated state, inject the soup into several types of cells in the lab…
And discover the prime target—human cells—are not infected by the imaginary virus.
And after this good day’s work, walk away and pretend nothing odd or self-incriminating happened.
And oh yes, lock down the planet based on this “science.”
Naturally, we MUST take a toxic vaccine that prevents non-infection by the non-virus.
CHART: E Gene target sequence
